ID: 1138349081

View in Genome Browser
Species Human (GRCh38)
Location 16:56336924-56336946
Sequence CCCTCTGAGCACTGGGCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 291}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138349069_1138349081 23 Left 1138349069 16:56336878-56336900 CCCGGGCAGGGGGCAGCGCTGAG 0: 1
1: 0
2: 4
3: 63
4: 587
Right 1138349081 16:56336924-56336946 CCCTCTGAGCACTGGGCCTCGGG 0: 1
1: 0
2: 5
3: 35
4: 291
1138349066_1138349081 26 Left 1138349066 16:56336875-56336897 CCCCCCGGGCAGGGGGCAGCGCT 0: 1
1: 0
2: 0
3: 24
4: 233
Right 1138349081 16:56336924-56336946 CCCTCTGAGCACTGGGCCTCGGG 0: 1
1: 0
2: 5
3: 35
4: 291
1138349075_1138349081 -7 Left 1138349075 16:56336908-56336930 CCGCAGGATAGGCCAGCCCTCTG 0: 1
1: 0
2: 1
3: 17
4: 209
Right 1138349081 16:56336924-56336946 CCCTCTGAGCACTGGGCCTCGGG 0: 1
1: 0
2: 5
3: 35
4: 291
1138349067_1138349081 25 Left 1138349067 16:56336876-56336898 CCCCCGGGCAGGGGGCAGCGCTG 0: 1
1: 0
2: 2
3: 39
4: 381
Right 1138349081 16:56336924-56336946 CCCTCTGAGCACTGGGCCTCGGG 0: 1
1: 0
2: 5
3: 35
4: 291
1138349068_1138349081 24 Left 1138349068 16:56336877-56336899 CCCCGGGCAGGGGGCAGCGCTGA 0: 1
1: 0
2: 1
3: 32
4: 259
Right 1138349081 16:56336924-56336946 CCCTCTGAGCACTGGGCCTCGGG 0: 1
1: 0
2: 5
3: 35
4: 291
1138349070_1138349081 22 Left 1138349070 16:56336879-56336901 CCGGGCAGGGGGCAGCGCTGAGG 0: 1
1: 0
2: 5
3: 53
4: 522
Right 1138349081 16:56336924-56336946 CCCTCTGAGCACTGGGCCTCGGG 0: 1
1: 0
2: 5
3: 35
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138349081 Original CRISPR CCCTCTGAGCACTGGGCCTC GGG Intronic
900266447 1:1759648-1759670 CCCTCTGGGCTCTGTGTCTCTGG - Intronic
900341802 1:2193106-2193128 ACCTCTGGGCCCTTGGCCTCCGG - Intronic
900370387 1:2329569-2329591 CCCACTGGGCAGTGGGTCTCAGG - Intronic
900831567 1:4969311-4969333 CTCTCTGAGCCCAGGTCCTCAGG + Intergenic
901038337 1:6349629-6349651 CCCCTTGTGCACTGGGCCTTGGG - Intronic
901196694 1:7444267-7444289 CCCTCTTTGCCCTGGGCCCCAGG + Intronic
901336889 1:8457248-8457270 CCACCTGAGCATGGGGCCTCAGG - Intronic
902094853 1:13934720-13934742 TCCTCTGACCACTGGGCTTCCGG + Intergenic
902463997 1:16603357-16603379 CCCACTGAGAACTGGGGCTGTGG + Intronic
902474311 1:16673158-16673180 CCCTCTGAGCTCTGGCACTCAGG - Exonic
902484492 1:16734284-16734306 CCCTCTGAGCTCTGGCACTCAGG + Exonic
903157102 1:21453318-21453340 CCCACTGAGAACTGGGGCTGTGG - Intronic
903647829 1:24905458-24905480 CCCCCACAGCACTGGGCCACAGG - Intronic
903817509 1:26075550-26075572 TCCTCTGAGAACTTGGCCACTGG - Intergenic
904015054 1:27413331-27413353 CCCTCAGTGCACTGGGCCTTGGG + Intronic
904092671 1:27956169-27956191 TCCCCTGACCACTGAGCCTCAGG + Intronic
904412752 1:30334962-30334984 CCCTCTGAGTCCTGAGTCTCTGG - Intergenic
904470613 1:30733794-30733816 CCCTCCCAGCACTGGGGCTGGGG + Exonic
905028221 1:34865591-34865613 CCCTCTGCCCACTGGGCCCAGGG - Exonic
905605856 1:39299052-39299074 CACGCTGAGCACTTGGTCTCTGG + Intronic
905885663 1:41490585-41490607 CCCTCTGAGCACAGGGGCCTAGG - Intergenic
906925977 1:50117237-50117259 CCATCTGAACACAGGCCCTCTGG - Intronic
912654942 1:111477675-111477697 CCATCTCAGCAATGGGCCTGGGG - Exonic
913662042 1:121012864-121012886 CCCACTGAGCTCTGGCACTCAGG - Intergenic
914013416 1:143796049-143796071 CCCACTGAGCTCTGGCACTCAGG - Intergenic
914164409 1:145165136-145165158 CCCACTGAGCTCTGGCACTCAGG + Intergenic
914652040 1:149704658-149704680 CCCACTGAGCTCTGGCACTCAGG - Exonic
915238582 1:154502931-154502953 CCCTCTGAGCCCGGGGGCACGGG - Intronic
915359863 1:155279376-155279398 CCCTGTGTCCACTGGGACTCTGG - Intronic
920232585 1:204480535-204480557 CCTTCTGGGTACTGGGGCTCTGG - Intronic
920867920 1:209768708-209768730 CCCTCTGAGCCCTCGGCTCCCGG + Intronic
923612156 1:235504752-235504774 GCCTCCGAGCACCGGGTCTCCGG - Intergenic
923681893 1:236125042-236125064 CTCTCTCACCTCTGGGCCTCTGG + Intergenic
923688559 1:236171557-236171579 ACCTCTGAGCACGGGGACTGGGG + Intronic
1063053386 10:2477171-2477193 CCTGCTGGGCCCTGGGCCTCAGG - Intergenic
1063825562 10:9893544-9893566 CTCTCTCATCACTGGCCCTCAGG - Intergenic
1064772497 10:18738008-18738030 CCAACTCAGCACTGGGCTTCAGG - Intergenic
1065771618 10:29083481-29083503 CCCTCAGTGCTCTGGCCCTCTGG - Intergenic
1067185669 10:44025018-44025040 TGCTCTGGGCACTGGGCATCAGG + Intergenic
1067940099 10:50647939-50647961 CACACTGAGCACTGGTCCTGGGG + Intergenic
1069194238 10:65528513-65528535 CTGTCTGAGCAGTGGTCCTCTGG + Intergenic
1070698993 10:78585055-78585077 CCCTCTGAGCACTGGGGGAGGGG + Intergenic
1071277196 10:84066073-84066095 GCCTGTGAGCACTGGCCCTGAGG + Intergenic
1071476061 10:86025920-86025942 GCCTCTAAGCTCTGTGCCTCAGG + Intronic
1071588135 10:86845558-86845580 CCCTCTCCGCACTGTGGCTCTGG - Intronic
1072736519 10:97882939-97882961 TGCTCTGAGCTCTGGGCCTGGGG + Intronic
1073043879 10:100624773-100624795 ACCTCTAAACCCTGGGCCTCAGG - Intergenic
1073184117 10:101605284-101605306 CCCTCTGAGGGCCTGGCCTCTGG + Intronic
1073289803 10:102407988-102408010 CCCTCTGTGCAGTTGGCCTGGGG + Intronic
1073290654 10:102411706-102411728 CCCTCTGAGGACAGGGCTTCAGG + Exonic
1074190501 10:111131109-111131131 CTCTCTGAGCATTGGTCCCCCGG - Intergenic
1075786843 10:125055795-125055817 CCCTCTGAGGAGTGGGACTGTGG + Intronic
1076055940 10:127372949-127372971 CCATCTGAGTACTGGGACTCCGG - Intronic
1076342581 10:129759824-129759846 CCCAGGGAGCCCTGGGCCTCAGG - Intronic
1076431150 10:130403282-130403304 CCCAGTGAGCACTTGGCCTCAGG + Intergenic
1076613678 10:131742830-131742852 CCCTGTGAGGACACGGCCTCTGG + Intergenic
1076826434 10:132971968-132971990 CCATCTGTGCACTGTGCCTCGGG - Intergenic
1076982621 11:212917-212939 TCCTCTGAGTACTGGCCCTCGGG - Exonic
1077362517 11:2146987-2147009 CCTTCTGAGCAAAGGGCCTAAGG - Intronic
1079138942 11:17794941-17794963 CCCTGTGAGCGCTGGGGCTGAGG + Intronic
1081910224 11:46695609-46695631 CCCTCAGAGCTCCTGGCCTCAGG - Intronic
1083234256 11:61341766-61341788 CACTCTTAGCACTGGGCATCAGG - Intronic
1083637443 11:64128234-64128256 CCCACTGTGCGCTGGGTCTCAGG - Intronic
1083897660 11:65628186-65628208 CCCTCTGAGGGCAGGGCCTGTGG + Intronic
1084101605 11:66953282-66953304 CCCTCTGAATACTGGGAGTCTGG + Intronic
1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG + Intergenic
1084676415 11:70637948-70637970 CCCACTGAGCACAGGTTCTCGGG + Intronic
1085265567 11:75236097-75236119 CGCTCTGTGGCCTGGGCCTCTGG - Intergenic
1086666637 11:89491491-89491513 CGCTCAGAGCGCTGGGCGTCTGG - Intronic
1087755324 11:102048612-102048634 CACTCTGAGAACTGGGCTTCAGG + Intronic
1088778921 11:113114656-113114678 CTCTCAGAGCACTGTGGCTCAGG - Intronic
1089063756 11:115646433-115646455 CCCTCCGAGGACTGGGACTGGGG - Intergenic
1089681204 11:120119907-120119929 CCCTCAGAGCACTGGGCAGAGGG + Intronic
1091744298 12:2981447-2981469 GCCTCTGGGAACTGGGGCTCAGG + Intronic
1091788261 12:3256196-3256218 CCAGCTCACCACTGGGCCTCGGG - Intronic
1092771145 12:11898014-11898036 CCCTCTCAGCAGTGGCCTTCTGG + Intergenic
1093462405 12:19418747-19418769 ACCTCTTGGCACTGTGCCTCGGG + Intronic
1096467219 12:51853248-51853270 CCCTCTGCTCCCTTGGCCTCAGG + Intergenic
1096688233 12:53303264-53303286 AGCACTCAGCACTGGGCCTCGGG + Intronic
1097284223 12:57865316-57865338 CCCTCTGGACACTGCGGCTCCGG - Intergenic
1100679846 12:96907309-96907331 CCCGCTGACCTCAGGGCCTCCGG - Intronic
1101639991 12:106581003-106581025 CCTTCTGGGCACTGGGCATGGGG + Intronic
1101756029 12:107621130-107621152 CTTTCAGAGCTCTGGGCCTCGGG + Intronic
1102240726 12:111322963-111322985 CCTTCTTAGCACAGGGCCTTGGG + Intronic
1106783057 13:33079079-33079101 CCCTCTGAACTCTGGGGCCCAGG - Intergenic
1113511998 13:110863864-110863886 CCCACTGAACAATGGGGCTCTGG - Intergenic
1113836773 13:113333156-113333178 CCCTCCGAGCTCGGCGCCTCAGG - Intronic
1114031772 14:18585357-18585379 CCAGCTGAACTCTGGGCCTCAGG - Intergenic
1116954059 14:50905583-50905605 CTCACTGCGCACTGGGACTCTGG - Intronic
1117301753 14:54437008-54437030 CCCACTGAGCACTGTGCCAAGGG - Intronic
1118743887 14:68760312-68760334 ACCTGAGAGCACTGGGGCTCTGG - Intergenic
1121694913 14:95904576-95904598 ACCTCTTAGGACTCGGCCTCTGG - Intergenic
1121733822 14:96204652-96204674 CCCTCTGAGCCCTGGGGGCCAGG - Intergenic
1122543886 14:102511750-102511772 CAGGCTGTGCACTGGGCCTCAGG + Intergenic
1122695587 14:103550644-103550666 CAGGCTGAGAACTGGGCCTCTGG - Intergenic
1122883667 14:104701086-104701108 CCCTCCCAGCCCTGAGCCTCGGG + Intronic
1202897175 14_GL000194v1_random:16896-16918 CCAGCTGAACTCTGGGCCTCAGG + Intergenic
1202921098 14_KI270723v1_random:31071-31093 TCATCTGAGCACTGGTCCTTGGG - Intergenic
1202923812 14_KI270724v1_random:6509-6531 TCATCTGAGCACTGGTCCTTGGG + Intergenic
1123695743 15:22877957-22877979 GCCTCTGGGGACTGAGCCTCTGG - Intronic
1123758793 15:23417008-23417030 CCCACTGGGGACGGGGCCTCGGG + Intergenic
1124212513 15:27775340-27775362 TCATCTGAGAACTGGGCGTCTGG - Intronic
1124393715 15:29282526-29282548 CCCACTGCACACTGGACCTCAGG + Intronic
1124554024 15:30709050-30709072 GCCTCTGAGCACTGGGACACAGG + Intronic
1124677221 15:31696621-31696643 GCCTCTGAGCACTGGGACACAGG - Intronic
1125729198 15:41883274-41883296 CCCTCTGAGCACTGGCACTGGGG + Intronic
1125933143 15:43614144-43614166 CCCTCTGAACACTAGGCTCCAGG + Intronic
1125946241 15:43713606-43713628 CCCTCTGAACACTAGGCTCCAGG + Intergenic
1128732748 15:70032463-70032485 TCCTCTGAGCACTGATTCTCTGG - Intergenic
1129271366 15:74420994-74421016 CCCTCGGAGACCTGGGCCTGTGG - Intronic
1129461601 15:75702643-75702665 GCCTCTGAGCCCTGGGGCTCTGG - Intronic
1129723252 15:77889203-77889225 GCCTCTGAGCCCTGGGGCCCTGG + Intergenic
1129737556 15:77974638-77974660 CCCTCTGAAATCTGGGCTTCGGG + Intergenic
1129762990 15:78142374-78142396 CCCACACAGCCCTGGGCCTCAGG - Intronic
1129853697 15:78810318-78810340 CTCCCTGAGCACCGGGCCTGGGG + Intronic
1130957232 15:88636335-88636357 CTCTCTGGGTACTGGGCCACCGG + Intronic
1131150837 15:90046422-90046444 CCCGCAGAGCCCAGGGCCTCAGG + Intronic
1131367468 15:91853163-91853185 CCCTCTGAGGCCTGGGCACCCGG + Intergenic
1131535285 15:93232297-93232319 CCCGCTGAGGACTGTGCCCCTGG - Intergenic
1132672718 16:1108301-1108323 CACTCTGAGGAAGGGGCCTCAGG - Intergenic
1132839599 16:1972548-1972570 ACCTCTGAGCAGTCGGCCTGGGG + Intronic
1132977180 16:2716630-2716652 CCCTCTGTGGACTGTCCCTCTGG - Intronic
1133586830 16:7203861-7203883 CCTTCTGAGGACTGGCTCTCTGG - Intronic
1135140525 16:19917474-19917496 CCCTCTGTGCACAAAGCCTCTGG - Intergenic
1135401768 16:22170990-22171012 CCCTCTGAGCTGTGGGTCCCGGG - Intronic
1135477118 16:22786410-22786432 GCTTCTGAGCACTGTTCCTCTGG + Intergenic
1135582407 16:23640004-23640026 GCCTCTGAGGCCTGAGCCTCTGG + Intronic
1135630611 16:24033222-24033244 CCCTCTGTCCTCTGGGCCTCAGG - Intronic
1135991766 16:27222871-27222893 GCCTCTGGGCACTTGGCCACTGG - Intergenic
1136367823 16:29816940-29816962 TCCTCTTCGCTCTGGGCCTCCGG - Exonic
1136513540 16:30753941-30753963 CCACCTGGGCCCTGGGCCTCAGG + Intronic
1137384611 16:48030067-48030089 TCCTCTGAGTGCTGGGACTCAGG + Intergenic
1138139723 16:54557797-54557819 CCCTCTCTCCCCTGGGCCTCAGG - Intergenic
1138349081 16:56336924-56336946 CCCTCTGAGCACTGGGCCTCGGG + Intronic
1139578416 16:67857167-67857189 CCATCTGTGAACTGAGCCTCAGG - Intronic
1140210969 16:72969945-72969967 CCTTCTGGGCAGTGGGCGTCCGG - Intronic
1141268272 16:82516626-82516648 CACTCTGGGAACTGGGGCTCTGG - Intergenic
1143236883 17:5409959-5409981 CCCTCTGTGCCCTGGCTCTCTGG - Intronic
1143405486 17:6674791-6674813 CGACCTGAGCCCTGGGCCTCGGG + Intergenic
1144773760 17:17773666-17773688 CCCTCTGTGTGCTGGGCATCAGG - Intronic
1145238181 17:21223673-21223695 CCCTCTGTGTCTTGGGCCTCGGG - Intergenic
1146491600 17:33287410-33287432 CTATCTGAGCACTGGGGCTTTGG - Intronic
1147132735 17:38418768-38418790 CACCCAGAGCACTGGGACTCAGG - Intergenic
1148240736 17:45998052-45998074 CCTTCTGGGCACTGGGCCTCGGG + Intronic
1148829997 17:50425411-50425433 CCCACTCACCCCTGGGCCTCAGG + Intergenic
1148868022 17:50639260-50639282 ACCTCTGAGCTCTTGGCTTCTGG + Intronic
1150017750 17:61575476-61575498 CCCTCTGACCACTTTGCCTTGGG + Intergenic
1150442551 17:65203067-65203089 CCCTCTGAGGACTTAGCCTCTGG + Intronic
1151537103 17:74745208-74745230 CTCTGGGAGCACTGGGCCACTGG + Intronic
1152446435 17:80347345-80347367 TCCTCTGAGCACTTGGCCTCGGG - Exonic
1152612585 17:81322963-81322985 CCTTCTCAGCATTGGGACTCCGG - Intronic
1152644324 17:81461780-81461802 CCCTTGGAGCGCAGGGCCTCGGG - Exonic
1152691355 17:81719566-81719588 CCCTCTGCCCACTGGACCCCGGG + Intronic
1153331119 18:3876216-3876238 CCTCCTGAGAACTGGGCTTCTGG - Intronic
1154301227 18:13194399-13194421 CCCTGTGGGAACTGGGGCTCAGG + Intergenic
1157420507 18:47543936-47543958 TCTCCTGAGCCCTGGGCCTCAGG + Intergenic
1157619675 18:49009030-49009052 CCCACTGAGCACTGGGCGGGTGG + Intergenic
1159587931 18:70299585-70299607 CACTCTAGGCACTGGGTCTCTGG + Intronic
1159790949 18:72778159-72778181 CCCCCTAAACACTGGCCCTCTGG + Intronic
1160161520 18:76475703-76475725 CACACTGGGCACTGGGCATCTGG + Intronic
1160348362 18:78153167-78153189 CCCTTTGTGCCCTGGGTCTCGGG + Intergenic
1160810933 19:1012670-1012692 CCTGCTGAGCCCTGGGCCCCAGG + Intronic
1161237503 19:3205142-3205164 CCCTCTGGGCACTGTGTCTCTGG + Intronic
1161552832 19:4923618-4923640 CCCTCTGCGCACGTGGCCTTCGG + Intronic
1161553499 19:4927760-4927782 CCCTCTGGGCACTGGACCGTGGG - Intronic
1161570777 19:5029891-5029913 CACTCTCAGCACAGGGACTCAGG - Intronic
1162582232 19:11538571-11538593 CCCACTGTCCATTGGGCCTCTGG - Intergenic
1162851962 19:13437878-13437900 CCCTCTGTCCACTGGGGCTTTGG - Intronic
1163288517 19:16364209-16364231 CCCTCTGCTAACTGGGCCTTGGG - Intronic
1163344595 19:16732426-16732448 CCCTCTTCGTACTGGGCTTCAGG + Intronic
1163697815 19:18772808-18772830 CTCTCTGAGCTCTCGGGCTCTGG + Intronic
1165076308 19:33281649-33281671 CCATCTGAGCCCTGGGCTACTGG + Intergenic
1165092976 19:33396321-33396343 CCCCCTGACCACGGGGCCACAGG + Intronic
1168353404 19:55688689-55688711 TCCTCTGAGCACCTGGCGTCTGG + Intronic
1202679655 1_KI270711v1_random:40797-40819 CCCACTGAGAACTGGGGCTGTGG + Intergenic
1202707688 1_KI270713v1_random:35562-35584 CCCTCTGAGCTCTGGCACTCAGG - Intergenic
925013278 2:502247-502269 CCCTTTGAGAACTGGGAATCTGG + Intergenic
925288424 2:2730649-2730671 CCCGCTGTGACCTGGGCCTCAGG + Intergenic
926890363 2:17634232-17634254 CCTTCTGAGCACAGGGCCCTGGG - Intronic
927243052 2:20935397-20935419 CTCTCTGAGCAATAGGCCTGTGG - Intergenic
927277724 2:21275736-21275758 CCCTCTGGGCACTGGCCCCAGGG - Intergenic
928364375 2:30690094-30690116 CCCACTGAGCACCAGGCCTGAGG - Intergenic
928435272 2:31250907-31250929 CCCTCTGTGCTCTGTGGCTCTGG + Intronic
929454294 2:42055171-42055193 CCCTCTGTTCACTGGGGCACAGG + Intronic
929824801 2:45301864-45301886 CCCCCTGAACCCTGGGCCTCGGG - Intergenic
931905298 2:66836241-66836263 ACCCCTGAACACTGGGCCCCTGG - Intergenic
932756612 2:74414240-74414262 CCCTCTGATCCCTGAGCCTCTGG - Exonic
935212699 2:100952217-100952239 CCCTCTGTGCACGAGGCCACTGG - Intronic
938491138 2:131761902-131761924 CCAGCTGAACTCTGGGCCTCAGG - Intronic
938496426 2:131800435-131800457 CCAGCTGAACTCTGGGCCTCAGG + Intronic
948728121 2:239947052-239947074 CCTGCTGAGCACCGGGCTTCAGG - Intronic
948855381 2:240727874-240727896 CCCTGTGAGCACCAGGCCTGAGG - Intronic
948884071 2:240874343-240874365 CGGTCAGGGCACTGGGCCTCAGG - Intronic
948892401 2:240913912-240913934 ACATCTGAGGACAGGGCCTCCGG - Intergenic
1169055510 20:2617347-2617369 CCCTCTGAGCAGACTGCCTCGGG - Intronic
1169262692 20:4149483-4149505 CCCTCTGGGCTCCGGGCGTCCGG + Intronic
1171428313 20:25062467-25062489 GCATCTGAGCACTGCGACTCTGG - Intergenic
1173188431 20:40858603-40858625 CCCTTTGAGCACTGTGCCTCAGG - Intergenic
1173639537 20:44591108-44591130 CCCTCTGCCCACTAGCCCTCTGG - Intronic
1175228689 20:57460229-57460251 CACTCTGAGCTCAGGGCCTGTGG + Intergenic
1175414240 20:58791161-58791183 CGCTCTGTGCCGTGGGCCTCAGG - Intergenic
1175779688 20:61674499-61674521 CCTGCTGAGCACTGGGCCCAGGG - Intronic
1175933102 20:62502634-62502656 CCCACAGAGCAGTGGGCCTTGGG + Intergenic
1176616859 21:9032885-9032907 CCAGCTGAACTCTGGGCCTCAGG + Intergenic
1176708275 21:10130762-10130784 CCAGCTGAACTCTGGGCCTCAGG - Intergenic
1179297792 21:40078959-40078981 TCCTTTGAGAACTGGGGCTCTGG + Exonic
1179560864 21:42215309-42215331 CACACTGAGGACTTGGCCTCTGG - Intronic
1179767933 21:43587909-43587931 CCCTTTTAGCTCTGGTCCTCCGG - Intronic
1180074083 21:45453905-45453927 CCCTCTGAGCACAGAGCCTTCGG + Intronic
1180455886 22:15512414-15512436 CCAGCTGAACTCTGGGCCTCAGG - Intergenic
1181021801 22:20107455-20107477 CCCTCTGAGCACAGAGCCTCAGG - Intronic
1181032051 22:20153017-20153039 CCCTCTGATCCCTGCGCCTCTGG + Intergenic
1181511492 22:23391166-23391188 CCCTCTGATCCCTGCACCTCTGG - Intergenic
1181545595 22:23600343-23600365 CCCTCTGAGCTCTGAGTGTCTGG + Intergenic
1181814712 22:25429556-25429578 CCCTCTGAGCTCTGAGTGTCTGG - Intergenic
1183210443 22:36448004-36448026 CTCTCTGAGGGCTGGGCATCTGG + Intergenic
1183379621 22:37484427-37484449 CCCTGTGAGGACTGGGTCACTGG - Intronic
1184248761 22:43248709-43248731 CCTGATGAGCACTGGGCCTGGGG + Intronic
1184502225 22:44880972-44880994 GCCTCTGAGGACTGGGAATCGGG + Intergenic
1184594726 22:45506817-45506839 GGCTCTGAGCACTGGGCACCTGG + Intronic
1184610680 22:45601351-45601373 CCCTCTGAGAAGTGTGGCTCGGG + Intergenic
1184863099 22:47188083-47188105 CCATCTGAGCATGGGGCCTTTGG - Intergenic
1185309412 22:50145898-50145920 CTCCCTGAGCACTGAGTCTCTGG - Intronic
949890986 3:8733595-8733617 GCCTCAGGGCACTGGGCCTCAGG - Intronic
950638234 3:14331029-14331051 CCCTCTTAGCTGTGGGCCTCGGG + Intergenic
952382212 3:32814523-32814545 TCCTCTGAGCAATGGTCCCCAGG + Intergenic
953211446 3:40878574-40878596 TTCTCTGAGCCCTGGGGCTCTGG - Intergenic
953544881 3:43857053-43857075 CCCTCTGGGAACTGTTCCTCTGG - Intergenic
954751882 3:52818427-52818449 CCCTGTTAGGACAGGGCCTCTGG + Exonic
955129057 3:56145596-56145618 GTCTCTGAGAACTGAGCCTCTGG - Intronic
960447366 3:117764525-117764547 CCTTCTGTGCACTGGGGCTATGG - Intergenic
961448575 3:126992326-126992348 ACCACTGCCCACTGGGCCTCTGG - Intronic
961473306 3:127131988-127132010 CCTTCTGAGCCCTGGGTGTCTGG + Intergenic
961516742 3:127442709-127442731 CCCTCTAGGCCCTGGGCCTCAGG + Intergenic
961529665 3:127532863-127532885 CCCTAGGAACACTGGTCCTCAGG + Intergenic
961616863 3:128189185-128189207 GCCTGTGAGCACTGGTTCTCTGG + Intronic
961693025 3:128684126-128684148 ACCTCAGAGCCTTGGGCCTCAGG + Intergenic
962009772 3:131381757-131381779 CCCTCTGCCCATTGGGCCTTCGG + Intronic
962827245 3:139108819-139108841 CCCTCCAAGCACGGGGCCTGAGG - Intronic
965097721 3:164255496-164255518 TCTTCTAAGCAATGGGCCTCAGG + Intergenic
967829929 3:193909927-193909949 CCCCCTGAGCATCGAGCCTCTGG - Intergenic
967919844 3:194606274-194606296 CCCCCTGAGCACTGGTCCTAAGG - Intronic
968511220 4:996785-996807 CCCCCTGGGCACTCAGCCTCTGG - Intronic
968548655 4:1211246-1211268 CCCTCTGCCCACTGGGTCTGTGG - Intergenic
968946788 4:3669113-3669135 CCGTCTGTGCACTGGCCCTGCGG + Intergenic
969301645 4:6300568-6300590 CCCTCTGACCACCCTGCCTCTGG - Intronic
969506485 4:7591334-7591356 CCCTCCCAGCCCTGGGACTCTGG - Intronic
970565424 4:17327474-17327496 CCCTCTGAGAACTGGCATTCTGG + Intergenic
972739752 4:41878561-41878583 CTCTCTGAGCTCAGGGCCACTGG - Intergenic
973735069 4:53863743-53863765 GGCTCTGAACACTGGGCTTCAGG - Intronic
973878101 4:55241576-55241598 CCCTCTGAGCACAGGGCCTGCGG - Intergenic
978087583 4:104672687-104672709 CCCTCTGAGAACTGGAACACTGG - Intergenic
978542957 4:109838392-109838414 CTTTCTGAGCAGTGGTCCTCAGG - Intronic
980868787 4:138586246-138586268 CCCTCTAAGCACAGGGCCCTGGG - Intergenic
981010819 4:139922990-139923012 CCTTCTGAGCACTGGGGTGCAGG - Intronic
982126663 4:152189716-152189738 CCCTGTGCTCACTGGGCCCCTGG + Intergenic
983520268 4:168701272-168701294 CCTTCTGAGCACTGGGCACATGG - Intronic
985316473 4:188663470-188663492 CCCTATGAGCCCTGGGTCTGGGG - Intergenic
985536722 5:469211-469233 CCCTCTGAGCACCAGGACCCAGG - Intronic
986356568 5:6933978-6934000 CCCTCTGGGGACTGAGCCACAGG + Intergenic
988486674 5:31673202-31673224 CCCTCTGACCACTGGTTCTGTGG + Intronic
988684344 5:33513266-33513288 CCCTCTGAAACCTGGGCTTCAGG + Intergenic
993622085 5:90180383-90180405 TCCTCTGAGCAGTAGGCCTGCGG + Intergenic
994305222 5:98195080-98195102 CTCTCTAAGCACTGGGTCTCTGG - Intergenic
994560723 5:101367459-101367481 CCCTCTGGAAACTGGGCCTCGGG - Intergenic
996096268 5:119402196-119402218 CCCACTGAGATCTGGGCCTATGG - Intergenic
996434916 5:123423367-123423389 TCCCCTGGGCACTGGGCCTGCGG - Intronic
997362603 5:133304852-133304874 CCATCTGTGCACTGGGGTTCTGG - Intronic
997582910 5:135028434-135028456 CCCTCCGCGGAGTGGGCCTCCGG + Exonic
999382997 5:151134783-151134805 CTCTCTGAGGACAGGGCCCCAGG + Intronic
1000729739 5:164818697-164818719 CTCTCTCAGCACTGCGGCTCTGG + Intergenic
1000897464 5:166873065-166873087 CCCTCAGACCACTGGGCAGCAGG - Intergenic
1002076656 5:176712481-176712503 TCCTCTGTGCCCTGGGGCTCTGG + Intergenic
1003460619 6:6324657-6324679 CACCCTGAGCACTGAGCCTCTGG - Intergenic
1008651456 6:53568076-53568098 CCTTCTAAGCTCTGGACCTCTGG - Intronic
1009944765 6:70330494-70330516 CCCTGTGGGAACTGGGGCTCAGG - Intergenic
1010275673 6:73966010-73966032 CACTCTGCTCACTGGTCCTCTGG - Intergenic
1010379602 6:75209065-75209087 CCCTCTGAGTCCTGGGCTCCCGG + Intergenic
1013052424 6:106549231-106549253 GCCTCTGCCCACAGGGCCTCAGG - Intronic
1014696922 6:124633786-124633808 CCCTCAGAGGACTGGTCCTCGGG - Intronic
1018984459 6:168625707-168625729 CCGTGTGAGCCCTGGGCCCCAGG + Intronic
1019135875 6:169907494-169907516 CCCCCTGAGCCCTGTGCCCCTGG - Intergenic
1019288275 7:234492-234514 TCCTCTGAGCCCTGGTCTTCTGG + Intronic
1021220402 7:17969451-17969473 CCCTCAGAGGACTGGGCCATGGG + Intergenic
1024510209 7:50197816-50197838 CCCACAGAGCACCGGGCGTCAGG - Intergenic
1028762273 7:94509725-94509747 ACCCCGGAGCACTGGGCATCCGG + Intronic
1033557306 7:142500058-142500080 CCCTCTGTGCCATGGGCCCCGGG + Intergenic
1033583677 7:142758850-142758872 GTCTCTGAGCAGTGGGTCTCCGG + Intronic
1033604385 7:142915219-142915241 CTCTCTGAGTTCTAGGCCTCAGG - Intronic
1034238553 7:149591912-149591934 CCCTCTGAGCCCAGGCCCACCGG - Intergenic
1034986405 7:155518153-155518175 CCCTTTGAGCACTGTGGATCTGG - Intronic
1035117976 7:156540807-156540829 CCCTCTGCTCACTGAGCCTGTGG + Intergenic
1035284864 7:157799610-157799632 CGCTCAGAACACTGGGCCTGAGG - Intronic
1038316194 8:26486398-26486420 CCTTCTGTGCACTGAGACTCAGG - Intronic
1039896075 8:41717551-41717573 CCCTCTGAGCTCTTGGTCTAGGG + Intronic
1041030330 8:53729811-53729833 TCCTCTGAGGAATGGGCCTCAGG + Intronic
1043536350 8:81209214-81209236 CCCTCTGAGCATTGTTCCTTAGG + Intergenic
1044558920 8:93593576-93593598 CCCTATGGGCACTGGGCCCCAGG + Intergenic
1046847333 8:118932753-118932775 TCCTCTGAGCAATGGTCCTTTGG + Intronic
1048572467 8:135667184-135667206 CTCCCTGCCCACTGGGCCTCAGG + Intergenic
1049204627 8:141358002-141358024 CCAGCTGAGTTCTGGGCCTCAGG - Intronic
1049248225 8:141574222-141574244 CCCTCTGAGCTGGGGGCTTCTGG + Intergenic
1049852629 8:144841306-144841328 TTCTCTGAGCACAGGGCCTAAGG + Intronic
1049853964 8:144850047-144850069 CCCTCAGAGCGCTGTGCCCCCGG + Intronic
1051150178 9:14071603-14071625 GCCTCGGACCACTGTGCCTCTGG + Intergenic
1053645237 9:40116276-40116298 CCAGCTGAACTCTGGGCCTCAGG - Intergenic
1053760478 9:41347252-41347274 CCAGCTGAACTCTGGGCCTCAGG + Intergenic
1054326259 9:63714174-63714196 CCAGCTGAACTCTGGGCCTCAGG - Intergenic
1056227108 9:84506417-84506439 CCATCTGAGCAAAGGGCTTCTGG - Intergenic
1056332393 9:85531999-85532021 CCCTCTCAGCTCTGAGCCTCCGG + Intergenic
1057016794 9:91659096-91659118 CCCTCTGTGAAATGGGCCCCTGG - Intronic
1057304699 9:93905296-93905318 CCCTCTGACCTCAGGACCTCAGG - Intergenic
1058444132 9:105039264-105039286 GCCCCTGAGAACTTGGCCTCTGG + Intergenic
1059331756 9:113539947-113539969 CCATCTGGGCACTGGGCCCGTGG + Intronic
1059740556 9:117145578-117145600 CCCTGTGAGAACTGGGACTGTGG - Intronic
1060206153 9:121684038-121684060 ACCTCTGAGCTGTGGACCTCAGG + Intronic
1060409134 9:123388753-123388775 CCTGCTGAGCACATGGCCTCTGG - Intronic
1060591306 9:124818760-124818782 CCCACCGTGCACTGAGCCTCAGG - Intergenic
1061237873 9:129352609-129352631 CCCTCTGCGCAGTGGGGCTGTGG + Intergenic
1062252781 9:135606619-135606641 CCCCCAGAGCCCTGGGCCTCTGG + Intergenic
1202793036 9_KI270719v1_random:99731-99753 CCAGCTGAACTCTGGGCCTCAGG - Intergenic
1186191690 X:7073054-7073076 CCCTCTACCCACTGGGTCTCTGG + Intronic
1186292990 X:8120392-8120414 CCCTCTGAGCCCTGTGTTTCTGG - Intergenic
1186641646 X:11461926-11461948 CCCTCCTAGCCCTGGGCTTCAGG - Intronic
1187451577 X:19401516-19401538 CCCTCTGAACACTGGTCTTGGGG - Intronic
1190281931 X:48936845-48936867 CCATCAGAGCAGTGGTCCTCTGG - Intronic
1192789730 X:74369480-74369502 CCCTCTGAACACTTGGCCAGTGG - Intergenic
1194079344 X:89439316-89439338 CCCCCTGGGCACTGGGCATATGG - Intergenic
1196245258 X:113392077-113392099 CCCTCTGGGCGCTCTGCCTCAGG + Intergenic
1200431964 Y:3094621-3094643 CCCCCTGGGCACTGGGCATATGG - Intergenic
1201150260 Y:11091736-11091758 CCAGCTGAACTCTGGGCCTCAGG + Intergenic
1201958383 Y:19650777-19650799 CTCTCTGAGAGCTGGGTCTCAGG + Intergenic