ID: 1138352973

View in Genome Browser
Species Human (GRCh38)
Location 16:56356274-56356296
Sequence CTTCACATTTAGAATTTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 280}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138352972_1138352973 -7 Left 1138352972 16:56356258-56356280 CCGGTTTTAGTTGAGTCTTCACA 0: 1
1: 0
2: 0
3: 14
4: 164
Right 1138352973 16:56356274-56356296 CTTCACATTTAGAATTTGAAAGG 0: 1
1: 0
2: 0
3: 21
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138352973 Original CRISPR CTTCACATTTAGAATTTGAA AGG Intronic
902924499 1:19687251-19687273 CTCTACATTTAAAATTTAAAAGG - Intronic
906889984 1:49700955-49700977 TTTCACATTTAAAATTTTTAGGG - Intronic
907869453 1:58430114-58430136 CTTCAGGGTTAGAATTTGCAGGG + Intronic
908327664 1:63039427-63039449 CTGGCCATATAGAATTTGAAAGG - Intergenic
909135496 1:71794356-71794378 ATTAGCATTGAGAATTTGAAAGG - Intronic
910239717 1:85073616-85073638 CTTCACTTTTAGAAACAGAAAGG + Intronic
910313626 1:85857110-85857132 TTACTCATTTGGAATTTGAAAGG + Intronic
911067457 1:93803264-93803286 GTTCACATATAGAATGTAAAGGG + Intronic
911067638 1:93805395-93805417 CTGCACATATAGAACTTTAATGG - Intronic
911302086 1:96186801-96186823 CTTCATATTTAGTTTTTAAATGG + Intergenic
915866167 1:159501328-159501350 CCTCACATTGAGAATTTCTAGGG - Intergenic
916860971 1:168804956-168804978 CATGACATTAAGAATTTGTAGGG + Intergenic
916907598 1:169305119-169305141 TTTCAATTTTAGATTTTGAATGG - Intronic
917159225 1:172038975-172038997 TTTCACATTTACATTTTCAAAGG - Intronic
917368826 1:174265404-174265426 GTTCTCATTTTGTATTTGAAGGG + Intronic
917576832 1:176331384-176331406 AATCATATGTAGAATTTGAATGG + Intergenic
917772789 1:178298351-178298373 TTGCACATTGAGAAATTGAAGGG - Intronic
917891865 1:179447452-179447474 ATTCAAAATTAGTATTTGAAGGG - Intronic
918176430 1:182050290-182050312 CTTCACATTTGTAATTTTACTGG + Intergenic
918435549 1:184508158-184508180 CTTCACATTCACAATATTAAGGG + Intronic
919410011 1:197231327-197231349 AATCACATTTAAAATTTGAAAGG + Intergenic
919764816 1:201120234-201120256 CTACACAATTAGAATTGGCAAGG - Intronic
921312588 1:213858883-213858905 CTCCACATTTAACCTTTGAAAGG - Intergenic
921458743 1:215403927-215403949 CTTCAAAATAAGAATTTGAGGGG + Intergenic
922557033 1:226540438-226540460 CTTCAAATTTATTATTTGAGTGG + Intergenic
923831375 1:237561411-237561433 CTTCAGAGTTAGATGTTGAAAGG + Intronic
923831379 1:237561462-237561484 CTTCAGAATTAGATGTTGAAAGG + Intronic
1063889749 10:10617454-10617476 TATCAAATTTAGACTTTGAAAGG + Intergenic
1065260266 10:23916565-23916587 TTTCATATTTAGTGTTTGAAAGG - Intronic
1065941738 10:30571013-30571035 CTTCATATTTATAATTTTGATGG + Intergenic
1067303922 10:45040915-45040937 AGTCACATTAAGATTTTGAAGGG + Intergenic
1067949186 10:50712789-50712811 CTTCAGTTTTAGGTTTTGAATGG - Intergenic
1068276105 10:54799291-54799313 GTTCACATTTAAATTTTGCATGG - Intronic
1068808239 10:61224888-61224910 CTTCACTGTGAGAATTTGTAGGG - Intergenic
1070884501 10:79877801-79877823 CTTCAGTTTTAGGTTTTGAATGG - Intergenic
1071877403 10:89856020-89856042 CTTCCTGTTTTGAATTTGAATGG + Intergenic
1074168893 10:110913114-110913136 TTTCACATTTATACTTTAAATGG + Intronic
1074195614 10:111182034-111182056 CTTCACATTCAAATTTTGGATGG + Intergenic
1074695312 10:116045301-116045323 CTTCACATTGACAATTGCAATGG + Intergenic
1075140213 10:119826970-119826992 CATCAGACTTAGAATTTGTAAGG - Exonic
1077914570 11:6602978-6603000 CTTCAGATTTGTATTTTGAAAGG - Intronic
1078659033 11:13270287-13270309 CTTCATATTTAACATTTTAAAGG + Intergenic
1079390286 11:20016345-20016367 TTTCAGATTTAGAATGGGAAGGG + Intronic
1079812474 11:25012522-25012544 CATCACATTTAGGACTTTAATGG - Intronic
1082756787 11:57084436-57084458 ATTCAATTTTAGAATTTTAAAGG - Intergenic
1082878115 11:58009032-58009054 CTTCCCATTTATAATGTAAAAGG - Intergenic
1083374784 11:62210750-62210772 CTTCACATTGAGAATCTTTAGGG + Intronic
1085450457 11:76629156-76629178 CTTAACATTTGGAATTGGAGAGG + Intergenic
1085933355 11:81113356-81113378 CTTCACATTTATAAATACAAAGG + Intergenic
1085945523 11:81266639-81266661 CTACTCATTTAGAGGTTGAAAGG - Intergenic
1086859880 11:91913279-91913301 TATCACATATAGAAATTGAATGG + Intergenic
1087315482 11:96597593-96597615 TTTCACATTTAAAACTGGAATGG - Intergenic
1087533124 11:99408638-99408660 ATTTACATTTATAATTTAAAAGG - Intronic
1089040239 11:115441327-115441349 TTACACATTTTGTATTTGAATGG - Intronic
1090158721 11:124468898-124468920 CTTGGCATTTAGATTTTAAATGG + Intergenic
1093835879 12:23827734-23827756 CATCACATTTAGTATTTTAAAGG - Intronic
1095402864 12:41835119-41835141 ATTGACATTTACAATCTGAAAGG + Intergenic
1095446179 12:42285022-42285044 AGTCATATTTAGAATTTGACTGG + Intronic
1097086520 12:56472581-56472603 CTTCAGCTTTGGAATTAGAATGG - Exonic
1098598687 12:72303419-72303441 TCACACATTTAGAATATGAAGGG - Intronic
1098995883 12:77119358-77119380 TCTCACATTTGGAATTTAAATGG + Intergenic
1099702647 12:86107134-86107156 CTTGAAATTGAGAATTTGACAGG + Intronic
1100669094 12:96790414-96790436 CTACATATATAGTATTTGAAAGG + Intronic
1101506353 12:105350148-105350170 CAACACATATAGAAATTGAAGGG - Intronic
1102519624 12:113470471-113470493 CTCCGCACTGAGAATTTGAATGG - Intronic
1107222226 13:37996681-37996703 CTTTACAATTAGAACTTAAAGGG + Intergenic
1107350031 13:39504219-39504241 CTTCCCATTTAAGTTTTGAAAGG - Intronic
1109711861 13:66171935-66171957 CTTCACATTTTGATTTTGAGAGG + Intergenic
1109966133 13:69698975-69698997 CTTCACTTTTAGAATAATAATGG - Intergenic
1111829792 13:93313315-93313337 CTTCCAATCTAGTATTTGAATGG + Intronic
1111830030 13:93317212-93317234 TTTCCTATTAAGAATTTGAATGG + Intronic
1113109316 13:106805194-106805216 CTCCACATTTTGAATTTTAATGG + Intergenic
1114372421 14:22104925-22104947 GTGCACATTTATAATTTGAGGGG + Intergenic
1114972562 14:28051528-28051550 CTTAACATTTATCTTTTGAAGGG + Intergenic
1115426359 14:33264703-33264725 ATTCACATTTATAGTGTGAAAGG - Intronic
1116296143 14:43112842-43112864 CTTCACATTTACACTTTGTAAGG + Intergenic
1116858790 14:49977436-49977458 CTTCATATGTCGAATCTGAAAGG + Intergenic
1117625033 14:57627104-57627126 GTTCACATTTTGCATTTAAATGG + Intronic
1120812116 14:88814404-88814426 CTTCACAGTCAGAATTTCACAGG - Intergenic
1121034112 14:90685017-90685039 CTGCCCATCTTGAATTTGAAAGG - Intronic
1121691431 14:95880177-95880199 CTTCAAACTTAGAGTTTGGAGGG - Intergenic
1121847405 14:97185228-97185250 CTGAACAATTAGAATTTGAGAGG + Intergenic
1121969497 14:98343472-98343494 CTTCACATTTAAAAAATGATTGG - Intergenic
1125160990 15:36643565-36643587 GTTAACATTTAGAAGTGGAATGG - Intronic
1125206354 15:37158090-37158112 CTTCAGATCTAGAACTTGCAGGG - Intergenic
1127280363 15:57485613-57485635 CCACACAATTACAATTTGAATGG - Intronic
1127348234 15:58123309-58123331 TGTAACATTTAGAATATGAATGG + Intronic
1127462162 15:59209321-59209343 CTTCACACTTACTATTTTAATGG + Intronic
1127513477 15:59667582-59667604 TATCACATGTAGAATTTGACTGG + Intronic
1128408493 15:67368496-67368518 GTTTGCATTTAGAATATGAATGG - Intronic
1129577283 15:76763783-76763805 CTTCACCTCTAGAATTTGTTTGG + Intronic
1133430395 16:5732104-5732126 ATCCACTTTTAGAATTTGAATGG + Intergenic
1134053079 16:11151091-11151113 CTTCAACCTAAGAATTTGAAGGG + Intronic
1135846588 16:25924422-25924444 CTTCAGTTTTGGATTTTGAAAGG - Intronic
1137816838 16:51406111-51406133 TTACAAAATTAGAATTTGAATGG - Intergenic
1138352973 16:56356274-56356296 CTTCACATTTAGAATTTGAAAGG + Intronic
1139304686 16:65974991-65975013 TTCCACGATTAGAATTTGAAAGG + Intergenic
1140238227 16:73178126-73178148 ATCCACATTTAGAATTTTGAAGG - Intergenic
1146065000 17:29627645-29627667 CCAAACATTTAGAATCTGAAAGG + Exonic
1146282098 17:31551273-31551295 CTTCTCATCAGGAATTTGAAGGG - Intergenic
1150322705 17:64229859-64229881 CCTCACATTGAGAAGCTGAATGG - Intronic
1150729838 17:67682793-67682815 CTTCACTTATAGATTGTGAAAGG - Intronic
1151101402 17:71559805-71559827 CTTCACAAATATAATTTGTAAGG - Intergenic
1154409226 18:14127543-14127565 CTGCACATTTAGGTCTTGAAGGG + Intronic
1156110124 18:33715745-33715767 CTTTACATTTAAAAATTGAGGGG + Intronic
1156737380 18:40276929-40276951 TTTGACATTTTGAATTTGATTGG + Intergenic
1157109780 18:44809773-44809795 CTTCTCATATATAATTTGGATGG - Intronic
1157708774 18:49833256-49833278 CTTCAAATTTACATTTTTAAAGG + Intronic
1157992572 18:52514742-52514764 CTTCTCATTTCCCATTTGAATGG - Intronic
1158066232 18:53412717-53412739 CTTCATATTTAGCCTTTGCAAGG + Intronic
1158321138 18:56265983-56266005 CTTCACATTTATCCTTTGAGAGG + Intergenic
1158890207 18:61865393-61865415 CTACAGCTTGAGAATTTGAAAGG + Intronic
1159402992 18:67961289-67961311 ATTCACATATAAAATTTGAAGGG - Intergenic
1163882869 19:19942682-19942704 CTGCAGATTTAGAACCTGAACGG + Intergenic
1166542915 19:43617410-43617432 CTTGACATCCAGACTTTGAAGGG - Intronic
1167802712 19:51755507-51755529 CTTCAACCTAAGAATTTGAAGGG - Intronic
1168443451 19:56391750-56391772 CATGACTTTTAGAATTTCAAGGG + Exonic
926778619 2:16446838-16446860 CTTTAAATTTAAAATTTGGAGGG + Intergenic
928155529 2:28872639-28872661 ATTCATTTTTAGAATTAGAAGGG - Intergenic
928523974 2:32120879-32120901 CTTCTCATTAATAATTTGACTGG + Intronic
929379208 2:41330183-41330205 CTCGACATCTACAATTTGAAGGG - Intergenic
929879668 2:45824863-45824885 CTTCTCCCTTAGAAGTTGAATGG + Intronic
931097032 2:58952498-58952520 CTTTACATTAAGAATTTATAAGG - Intergenic
931215536 2:60239177-60239199 CTGGACATTTAGAATAGGAAAGG + Intergenic
932127980 2:69161838-69161860 CTTCTCATGCAGAATTTAAAAGG + Intronic
933471691 2:82734033-82734055 TTTCACATATAGAATATAAATGG - Intergenic
933547757 2:83736832-83736854 TTTCAAATTTTGAATTTGCAAGG + Intergenic
933887343 2:86730655-86730677 CTTTATATTTGGAATTTGAAGGG + Intronic
933922832 2:87066058-87066080 CTTTATATTTGGAATTTGAAGGG - Intergenic
934039949 2:88119770-88119792 CTTCACATTGAAAATATTAATGG + Intergenic
936600806 2:113892377-113892399 CTGCACATTGATGATTTGAATGG + Intronic
938018020 2:127884466-127884488 CCTCAGATTTAGAGTTTGCAAGG - Intronic
938606656 2:132900580-132900602 CTACATTTTTAGAATTAGAAGGG + Intronic
938852850 2:135279512-135279534 CTTGACATGTACATTTTGAAAGG - Intronic
939042775 2:137211103-137211125 CTTGACATTTAGTGTTTCAAAGG + Intronic
939416617 2:141907364-141907386 ATTCACATTTAGATTTAAAATGG - Intronic
939533865 2:143399864-143399886 CATCACATTTTGAAGTTGGAAGG - Intronic
939558889 2:143710567-143710589 CTTTAGATTTAACATTTGAATGG + Intronic
939834939 2:147118375-147118397 CTTCTCATTTGGAATGGGAAAGG + Intergenic
940298067 2:152150474-152150496 CTTCCAAATTAGAATTTGATGGG - Intronic
941522114 2:166558534-166558556 ATAGACTTTTAGAATTTGAAGGG - Intergenic
942347862 2:175021486-175021508 GTTCCCATTTATGATTTGAAGGG + Intergenic
942968250 2:181923802-181923824 CCTCATTTTTAGAATTTTAATGG + Intronic
944023028 2:195128256-195128278 ATTCTCATTTATATTTTGAATGG + Intergenic
944354589 2:198771334-198771356 GTTCACATTTAGAATTTCTTTGG + Intergenic
944382791 2:199131015-199131037 TTTAACATGTAGAGTTTGAAAGG + Intergenic
944581292 2:201134895-201134917 CTTCCCATTTTGCATTTGATGGG - Intronic
945488182 2:210423317-210423339 CTTCTCATTTAGAATTTATAAGG - Intergenic
946377003 2:219316890-219316912 TTTCACATTTTTATTTTGAAAGG + Intergenic
946782685 2:223206979-223207001 CTTCACTTCTAGAATTTGTTTGG - Intergenic
1169661338 20:7981751-7981773 TTTCACAGCTAGAAATTGAAAGG - Exonic
1169741222 20:8896852-8896874 CTTCATTTTTAGACTTTGATTGG - Intronic
1170307136 20:14950950-14950972 TTGCAAATTTAGAATTAGAAGGG + Intronic
1172330362 20:34071660-34071682 CTTCAAATTTAGATCCTGAATGG + Intronic
1175030803 20:55951861-55951883 TTTAACAGTGAGAATTTGAATGG + Intergenic
1176863995 21:14032346-14032368 CTGCACATTTAGGTCTTGAAGGG - Intergenic
1178045475 21:28689257-28689279 CTTAACATCTACAATTTGCATGG - Intergenic
1178168684 21:30012869-30012891 GTTCACATTAAAAATTAGAATGG + Intergenic
1178989925 21:37344377-37344399 CTTCAAAATTATAGTTTGAAAGG + Intergenic
1179355660 21:40656325-40656347 TTTCACATTAGGATTTTGAAGGG - Intronic
1181654621 22:24286546-24286568 CATGACATTTTGAATTTGAAAGG + Intronic
1183342616 22:37290100-37290122 CTACAGATGTAGAATTGGAATGG - Intronic
1184929879 22:47673119-47673141 CATCCCTTTTAGAATTTGAGGGG - Intergenic
950990118 3:17425863-17425885 CTTCCCATTTAGATTTTCAAAGG + Intronic
951251577 3:20400173-20400195 CTACAAATTTTGATTTTGAAAGG + Intergenic
951990747 3:28673794-28673816 CTTGACTTTTAGAATGAGAATGG - Intergenic
952077181 3:29711523-29711545 CATGAAATTTAGAACTTGAAGGG + Intronic
952118937 3:30218049-30218071 CTTCAGATGTAGATTATGAAGGG - Intergenic
953311120 3:41880132-41880154 TTTCAGTTTTAGAATTTGATGGG + Intronic
953574170 3:44099578-44099600 CTTCACGTTTAGATTTTGCCAGG + Intergenic
956500808 3:69883017-69883039 CTTGAAATTTAAAATTTTAAAGG + Intronic
956538906 3:70312214-70312236 TTTCACATTGAGAAATTGTAAGG - Intergenic
958094812 3:88930034-88930056 TTATACATTTACAATTTGAAAGG + Intergenic
958461851 3:94407924-94407946 CTTCAAGTTGAGAAATTGAAAGG - Intergenic
958695607 3:97524076-97524098 CTTTACATTTAAAATTAGTATGG + Intronic
959346516 3:105201674-105201696 TTTCACATTCAGAAACTGAAAGG - Intergenic
959372507 3:105545735-105545757 CTTCATATAAAGAAATTGAAGGG + Intronic
959677126 3:109048904-109048926 CTTCAACTTATGAATTTGAAAGG + Intronic
962246492 3:133799561-133799583 CTTCATTTTGAGAAGTTGAATGG - Intronic
962270212 3:133972231-133972253 TTTTACATTATGAATTTGAATGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
965043939 3:163550995-163551017 CTCCACATTTAGCATTGGACAGG - Intergenic
965663230 3:171064391-171064413 CTTGACTTTGAGAATTTGAAGGG - Intronic
966425060 3:179772120-179772142 TTTCACATTTTGTATTGGAATGG + Intronic
967220783 3:187246174-187246196 CTGCCCAGTTAGAATTAGAAAGG - Intronic
967290217 3:187912450-187912472 CTTCTCATTTATCATTTTAATGG - Intergenic
971275253 4:25190457-25190479 CTTCACCATATGAATTTGAAAGG + Intronic
971737347 4:30472109-30472131 GTTCACATTTATATTTTAAAAGG - Intergenic
972245211 4:37239758-37239780 CTTCACATTAAAAATTGGAGAGG + Intergenic
972336409 4:38110661-38110683 CTTCACATATAAAATGAGAATGG - Intronic
972814094 4:42624403-42624425 CTAGACATTTTGAAGTTGAATGG + Intronic
973710335 4:53623641-53623663 CTTCAAATTGAGAATTTGATTGG - Intronic
973773356 4:54225930-54225952 CTTCACAATTTGAAAATGAAGGG - Intronic
974451446 4:62067072-62067094 CTTTAAAGTAAGAATTTGAAAGG - Intronic
974873842 4:67677446-67677468 CTTAAAATGGAGAATTTGAAAGG + Intronic
977118444 4:93064698-93064720 TTTCACATCTAAAACTTGAAAGG + Intronic
977127756 4:93192009-93192031 CTTCAAATGTAGAATATAAAGGG - Intronic
977360183 4:95993781-95993803 ATTCATATTTAAAATTTGATAGG + Intergenic
977700143 4:100012571-100012593 CTTCATTCTTAAAATTTGAAGGG + Intergenic
977911601 4:102543642-102543664 CTTAACATTTAGGATTTTTAAGG - Intronic
978077989 4:104557109-104557131 CTTAACAATTGCAATTTGAAGGG - Intergenic
978092332 4:104732993-104733015 GTTCAAATTTAGAATTCTAATGG - Intergenic
978178848 4:105768436-105768458 ATTTTCCTTTAGAATTTGAAAGG + Intronic
981872227 4:149500133-149500155 CCTTTCATTTAGTATTTGAAAGG + Intergenic
982357274 4:154484725-154484747 CTTTTCATTTATAATTTAAAAGG + Intronic
982410188 4:155066930-155066952 CTTCATTTTTAGAATTTAATTGG + Intergenic
982799011 4:159679689-159679711 CTTCTCATTGAGAATCTGATAGG - Intergenic
982881573 4:160725319-160725341 CTTCATTTTTAAAATATGAAAGG - Intergenic
983016742 4:162622672-162622694 CTTCACAGTGAGAATTTGATAGG + Intergenic
984568744 4:181364324-181364346 CTGCTCATTTAGAGTTTTAATGG + Intergenic
986283363 5:6341672-6341694 CTTCATAACTAGAATTTTAATGG + Intergenic
986757310 5:10850192-10850214 CTTCACAATTAGCATATGATGGG - Intergenic
987582263 5:19809370-19809392 CTTAAGATATAGAATTAGAATGG + Intronic
988565321 5:32316138-32316160 CTTCACTTTTCGAAGTAGAATGG + Intergenic
989710480 5:44390420-44390442 CTTCACATTTAATGTTTAAAGGG + Intergenic
990728469 5:58782869-58782891 CTTCATATTTTAAATCTGAAAGG - Intronic
991141407 5:63248305-63248327 GTTCACAGTTACAATTTTAAGGG + Intergenic
991339305 5:65589278-65589300 GTTTACATTTAAAATTTAAAAGG + Intergenic
991508092 5:67345751-67345773 CTTCACATTAGAAGTTTGAAAGG - Intergenic
992042600 5:72849644-72849666 CTTCCCATTTAAAAGTGGAAGGG + Intronic
992285460 5:75230635-75230657 CTTCCCTTTTGGTATTTGAAAGG - Exonic
992797640 5:80267397-80267419 TTTCACATTAATAATTTGCATGG + Intergenic
993537882 5:89109452-89109474 TTGCACATTTAAAATTTAAAGGG + Intergenic
994451224 5:99946899-99946921 CTTCACTTTTAGAATTAGCAAGG + Intergenic
995205593 5:109476090-109476112 CTTTTCTTTTAGAATTTCAAGGG - Intergenic
999403858 5:151289242-151289264 CTGCAGATTTTGAATTTGTAAGG - Intronic
999569351 5:152901264-152901286 TTTCACATTAAGAATATGAAAGG + Intergenic
999602336 5:153281183-153281205 CATCAAATTAAGAATGTGAAAGG + Intergenic
1000050379 5:157557872-157557894 CTTCAACATAAGAATTTGAAGGG + Intronic
1000254886 5:159528062-159528084 GTACAGATGTAGAATTTGAAAGG + Intergenic
1000969710 5:167700237-167700259 CTTCACATTTAAATTCTTAAAGG - Intronic
1002962591 6:1930041-1930063 CTTGGCATTTAGAATATCAATGG + Intronic
1003086918 6:3068116-3068138 CTTCACAATTACCATTTTAAAGG + Intronic
1003816016 6:9840839-9840861 CTTCAAATTTGGAGTCTGAAAGG + Intronic
1004412865 6:15397735-15397757 GTTCAAATTTACAAGTTGAATGG - Intronic
1005764946 6:29002081-29002103 CTTTAGCTTTAGAAATTGAAAGG + Intronic
1006940845 6:37751365-37751387 ATTCACATTAGGTATTTGAATGG - Intergenic
1007946693 6:45833442-45833464 CTTCACATATAAAATGAGAATGG + Intergenic
1008353323 6:50519387-50519409 CTTCTCATTAAGAATGGGAAAGG - Intergenic
1008796249 6:55306569-55306591 TTTAACACTTAGAATTTGGAGGG + Intergenic
1009029108 6:58035538-58035560 GTTCTCTTTAAGAATTTGAATGG - Intergenic
1009690459 6:67025341-67025363 CTGCATATTTAAAATTTGGAGGG - Intergenic
1009983606 6:70756357-70756379 CTTCTCAATTATAATTTAAAAGG - Intronic
1010943437 6:81947221-81947243 CTCCTCATTTAGAATGTGAGCGG - Intergenic
1011437267 6:87351592-87351614 CTTCACATTTTGAACTGAAATGG - Intronic
1011533137 6:88346667-88346689 CTTCACATTTATCACTTTAATGG - Intergenic
1012709129 6:102575551-102575573 CTTAATATTTACCATTTGAAGGG - Intergenic
1012814650 6:104007590-104007612 TTTCAGATTTAAAATTTCAAGGG + Intergenic
1013945597 6:115718619-115718641 ATGCTCATTCAGAATTTGAAAGG + Intergenic
1014502389 6:122207687-122207709 CTTCACATTTAAAATATTAGTGG + Intergenic
1014572152 6:123022971-123022993 CTCCACATTTAGCATTTAATAGG - Intronic
1014632070 6:123801040-123801062 CGGCAGAATTAGAATTTGAAGGG - Intergenic
1014678484 6:124398337-124398359 CTTCACAGGTAGAATTTAAGTGG + Intronic
1014715985 6:124864801-124864823 CTTCACATTTGACATATGAAAGG - Intergenic
1015164563 6:130189167-130189189 TTCAACATATAGAATTTGAAAGG - Intronic
1018672272 6:166189583-166189605 CTTCACCTTCAGAATTTATAAGG + Intergenic
1018995737 6:168709330-168709352 GTTCAAAATTAGAAATTGAATGG + Intergenic
1020675270 7:11176176-11176198 CATCACATTTAACGTTTGAAAGG + Intergenic
1021309139 7:19071224-19071246 CTTCACCATAAGAATTTGATGGG - Intronic
1026445665 7:70482481-70482503 CTGGACATTTAGTATTTTAACGG + Intronic
1026709609 7:72726067-72726089 CTCCACATCTGGAATTTGACTGG - Intronic
1030008564 7:105142485-105142507 CTTCACCTTAAGAATTTGATGGG + Exonic
1030117437 7:106072683-106072705 CTTCATATTTATCATTTCAAAGG - Intergenic
1031083088 7:117277367-117277389 CTTCTCACTTAGAATCCGAAGGG - Exonic
1031558030 7:123202541-123202563 CTTCAAGTCTAGAATTTGTATGG + Intergenic
1033038238 7:137894906-137894928 CTTAACATTTAGAGGTAGAATGG - Intronic
1033061493 7:138113415-138113437 CTTCACATTTGAAATTTTAGGGG + Intronic
1033925550 7:146455419-146455441 GTCCACATTTTGAAATTGAAAGG - Intronic
1033933496 7:146553508-146553530 ATTCACATTTAAAATTTAGAAGG + Intronic
1034022833 7:147663848-147663870 TTCCACATTTAGAAATTAAAGGG - Intronic
1035657539 8:1321626-1321648 TTTCACCTTTAGTATTAGAAAGG + Intergenic
1036461520 8:8957603-8957625 CTTCACATTTTTCATTTGCAAGG - Intergenic
1037506395 8:19534035-19534057 TTTTAAATTTAGATTTTGAAAGG - Intronic
1038551643 8:28474449-28474471 AATCAATTTTAGAATTTGAAAGG + Intronic
1038912531 8:31982533-31982555 CTGCACATTTAGAATTAAGAGGG + Intronic
1038955787 8:32467100-32467122 TTTCAGATATAGAATTTGCAAGG + Intronic
1040759879 8:50827318-50827340 CTTCACCTATAAAATTAGAATGG + Intergenic
1042016089 8:64313621-64313643 TGTCACATTTAGAGTTTGCATGG - Intergenic
1042057427 8:64780829-64780851 CTTGACTCTGAGAATTTGAAGGG - Intronic
1042219207 8:66456999-66457021 CTTAACATCTAGAATATGCAGGG + Intronic
1042297309 8:67235499-67235521 CTTAACATTTAAAAATTCAATGG - Intronic
1044014700 8:87036926-87036948 CTTCACAAGTAAAATTGGAAGGG - Intronic
1044268573 8:90212332-90212354 CATCACATTTATAATTTAATAGG + Intergenic
1046833894 8:118778251-118778273 CTTCAAATTTAGCATTAAAATGG - Intergenic
1047119502 8:121885162-121885184 CTTAACATTTAGTAAGTGAAGGG - Intergenic
1047219409 8:122907570-122907592 TTTCTCATTTTGAATGTGAAGGG - Intronic
1047582431 8:126231071-126231093 CTTCTGATTTAGAATTTTAAAGG - Intergenic
1049491695 8:142907140-142907162 CTTCACTTTTAGATTAGGAAAGG - Intronic
1050104851 9:2155107-2155129 CTTCACATTTATAATTTGGTAGG + Intronic
1050273162 9:3967855-3967877 CTTCACACTTATTATTTTAAGGG + Intronic
1050729486 9:8691742-8691764 CATCACATTGAAAATGTGAAAGG - Intronic
1051330140 9:16016212-16016234 CTTGACACTTAAAATTTGACAGG - Intronic
1052494471 9:29210792-29210814 TTTCACCTTAAGAATTTAAATGG - Intergenic
1054976366 9:71150594-71150616 CTTCATATAAATAATTTGAAAGG - Intronic
1058121794 9:101147225-101147247 CTGCACATTTATAATTTGTAAGG + Intronic
1058337263 9:103846022-103846044 ATTCACATTTTGAATTTTTAAGG - Intergenic
1061334720 9:129925028-129925050 CTTCTCCTCTGGAATTTGAAAGG + Exonic
1188157649 X:26759701-26759723 CTCCATATGTGGAATTTGAAAGG - Intergenic
1189518985 X:41745777-41745799 CTTCACATTGAAAATCTGCAGGG + Intronic
1193023115 X:76814045-76814067 CTTGATATTTAGAAGTTGAGTGG - Intergenic
1197546878 X:127836927-127836949 CTTCTCTTTTAGAATTTCTATGG - Intergenic
1198698544 X:139370478-139370500 GTTCTCATTTATTATTTGAATGG - Intergenic