ID: 1138353948

View in Genome Browser
Species Human (GRCh38)
Location 16:56362957-56362979
Sequence CATCCTTCGACGCAGGGTCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138353942_1138353948 1 Left 1138353942 16:56362933-56362955 CCTCCGTTCCGCGGCGGCAGCCA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1138353948 16:56362957-56362979 CATCCTTCGACGCAGGGTCACGG 0: 1
1: 0
2: 0
3: 2
4: 45
1138353943_1138353948 -2 Left 1138353943 16:56362936-56362958 CCGTTCCGCGGCGGCAGCCAGCA 0: 1
1: 0
2: 1
3: 7
4: 86
Right 1138353948 16:56362957-56362979 CATCCTTCGACGCAGGGTCACGG 0: 1
1: 0
2: 0
3: 2
4: 45
1138353944_1138353948 -7 Left 1138353944 16:56362941-56362963 CCGCGGCGGCAGCCAGCATCCTT 0: 1
1: 0
2: 1
3: 15
4: 156
Right 1138353948 16:56362957-56362979 CATCCTTCGACGCAGGGTCACGG 0: 1
1: 0
2: 0
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138353948 Original CRISPR CATCCTTCGACGCAGGGTCA CGG Exonic
918238113 1:182599524-182599546 CCTGCTGCAACGCAGGGTCAGGG + Exonic
920461178 1:206141514-206141536 CATCCTGCGAGGGGGGGTCAGGG + Intergenic
921317964 1:213909765-213909787 CATGCTTTGAAGCAGGGACAGGG + Intergenic
1072467946 10:95684492-95684514 CATCCTTCGCTTCAGGGTTAGGG - Exonic
1083803526 11:65060042-65060064 CAACCTGCGAGGCAGAGTCAAGG - Intergenic
1084451522 11:69241625-69241647 CATCCTTCAGCGTAGGGGCAGGG - Intergenic
1086824396 11:91477320-91477342 CATCCATAGGCTCAGGGTCAAGG + Intergenic
1092200764 12:6581140-6581162 CATCCTCTGAGGCAGGGGCAGGG + Exonic
1097340984 12:58437856-58437878 CATCTTTTGATGCAGGGTTAAGG + Intergenic
1106138554 13:26992263-26992285 CATCCAAGGACGCAGGGTCCAGG - Intergenic
1117316019 14:54571201-54571223 CATCCTTTGCCTCAGGCTCATGG + Intronic
1127461885 15:59206534-59206556 TATCCTTCCTGGCAGGGTCACGG + Intronic
1131226531 15:90628792-90628814 CATCCTTCCACGGCGAGTCATGG - Intronic
1138353948 16:56362957-56362979 CATCCTTCGACGCAGGGTCACGG + Exonic
1149604877 17:57917394-57917416 CATCCTGGGACGAAGGGGCAAGG + Intronic
1151512433 17:74569469-74569491 CAGCCCTTGACGCAGAGTCAGGG - Intergenic
1155990576 18:32275145-32275167 CACCCTTTGACACAGTGTCATGG + Intronic
1161944785 19:7428820-7428842 CATCCTTCGCCACAGGGCCGTGG + Intronic
1162661694 19:12174360-12174382 GATACTTCGACACAGGGACAGGG - Intronic
1163437936 19:17306334-17306356 CATCCTTCGCCGAATGCTCAAGG + Exonic
930077450 2:47418432-47418454 CATCCTTCCAAGCAGAGTCTGGG + Intronic
930479160 2:51925667-51925689 CATCCTCCTACATAGGGTCAGGG + Intergenic
940353681 2:152717315-152717337 CATCCTCCCTCGCAGGGTCCTGG - Intronic
942915869 2:181305750-181305772 CCGCCTTCGACTGAGGGTCAAGG - Intergenic
1168830664 20:843711-843733 CTTCCTTGGAAACAGGGTCAGGG + Intronic
1179468996 21:41598046-41598068 CACCCCTCGACTCAGGGTCAGGG + Intergenic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
955419547 3:58722585-58722607 TCCCCTTCGACGCAGGGTCAAGG + Intronic
966856672 3:184198767-184198789 CATCCTTAGTGGCAGGGGCAGGG + Intronic
970557809 4:17253184-17253206 CATCTTTTGATGCAGGGCCAAGG + Intergenic
972789610 4:42358275-42358297 CATTCTTGGACCCAGGGTGAAGG - Intergenic
973330134 4:48904598-48904620 CTTCCTTAGACACTGGGTCAAGG - Exonic
975444403 4:74445506-74445528 CCTCCTGCGGCGCAGGGTCGGGG - Intronic
985161305 4:187047579-187047601 CATCCTGTGAAGCAGGGTGACGG - Intergenic
985825217 5:2186202-2186224 CTTCCTTCGAAGCAGCCTCAGGG + Intergenic
992552284 5:77870218-77870240 CAGCCTTCCTAGCAGGGTCAGGG + Intergenic
1013481146 6:110553813-110553835 CATCCTTCTACACAGGGATATGG + Intergenic
1014068762 6:117157142-117157164 CATCCTTCAACTCAGCTTCAAGG + Intergenic
1035293499 7:157854701-157854723 CATCCAGCGAGGCAGGGTCCTGG - Intronic
1037602927 8:20413330-20413352 AATCTTTCGATGTAGGGTCAAGG + Intergenic
1045111037 8:98939994-98940016 CAGCCTTGGACGCGGGATCATGG + Intronic
1049262886 8:141649203-141649225 CAGCCTTCCAAGCAGGCTCAGGG - Intergenic
1056764498 9:89436530-89436552 CACCCTTCAGCGCAGGGACAAGG + Intronic
1057705365 9:97391749-97391771 CATCATTCGACTGAGGCTCAGGG + Intergenic
1060039687 9:120289198-120289220 CATCCTGGGACCCAGGGTGAAGG + Intergenic
1061836174 9:133331654-133331676 CATCCTTGAACGCAGGATCCGGG - Exonic
1203772252 EBV:55483-55505 CATCCTGCACCTCAGGGTCAAGG + Intergenic
1193489054 X:82125126-82125148 CCTCCTTCGACTCAGTTTCAGGG - Intergenic