ID: 1138356569

View in Genome Browser
Species Human (GRCh38)
Location 16:56385828-56385850
Sequence TGCCGGGTATATGACCTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138356569 Original CRISPR TGCCGGGTATATGACCTTGT TGG (reversed) Intronic
902248519 1:15138018-15138040 TGCTGAGTTAATGACCTTGTGGG - Intergenic
904429094 1:30450467-30450489 TGCTGTTTATATGACCTTGTTGG + Intergenic
909084336 1:71153947-71153969 TAACTGGTATATGACCTTCTAGG + Intergenic
909816862 1:80005231-80005253 TGCCAGGTAGATGAACATGTTGG - Intergenic
911235379 1:95406271-95406293 TAACTGGTATATGACCTTTTAGG - Intergenic
912500559 1:110119360-110119382 TGCCGAGCATATGACCTTGCTGG + Intergenic
913025527 1:114834067-114834089 TAACTGGTATATGACCTTCTAGG - Intergenic
914434767 1:147650133-147650155 TGCCAGGTACCTGATCTTGTCGG + Exonic
915666979 1:157453998-157454020 TGGCTGGTATATGACCTTCTAGG + Intergenic
917310315 1:173671381-173671403 TAACTGGTATATGACCTTCTTGG + Intergenic
917592184 1:176487683-176487705 GGCCTGGTCTAGGACCTTGTAGG + Intronic
921294931 1:213692685-213692707 TAACTGGTATATGACCTTCTAGG - Intergenic
921522011 1:216167453-216167475 TAACCGGTATATGACCTTCTGGG + Intronic
923162061 1:231323274-231323296 TAACTGGTATATGACCTTCTAGG + Intergenic
1065806499 10:29398093-29398115 TGTAGGGTCGATGACCTTGTTGG - Intergenic
1066363049 10:34749661-34749683 TGCCGGATATATGGACTTCTTGG + Intronic
1067893901 10:50159548-50159570 TAACTGGTATATGACCTTCTAGG + Intergenic
1079682812 11:23320150-23320172 TAACTGGTATATGACCTTCTAGG + Intergenic
1082984952 11:59160545-59160567 TCCCTGGAATATGACCATGTAGG + Intergenic
1086390168 11:86355655-86355677 TAACTGGTATATGACCTTCTGGG + Intergenic
1086737069 11:90320096-90320118 TAACTGGTATATGACCTTCTAGG + Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1088253579 11:107882395-107882417 TAACTGGTATATGACCTTATAGG + Intronic
1092886324 12:12927434-12927456 TAACTGGTATATGACCTTCTAGG + Intergenic
1094324403 12:29221123-29221145 TTACGGGTATATGACCTTACAGG - Intronic
1100462966 12:94819022-94819044 TAACTGGTATATGACCTTCTAGG + Intergenic
1101571512 12:105958104-105958126 TAACTGGTATATGACCTTATAGG + Intergenic
1108483007 13:50894409-50894431 TGACTGGTATATGACCTTCTAGG + Intergenic
1109343180 13:61088015-61088037 TAACTGGTATATGACCTTCTAGG + Intergenic
1111243264 13:85503361-85503383 TACCTGGTATATGACCTTCTAGG - Intergenic
1111298582 13:86316732-86316754 TAACTGGTATATGACCTTCTAGG + Intergenic
1120477677 14:85008729-85008751 TAGCTGGTATATGACCTTGTAGG - Intergenic
1120538113 14:85722056-85722078 TAACGGGTATATGACCTTCTAGG + Intergenic
1120821766 14:88918052-88918074 TGACGTGTGTATGACCGTGTGGG - Intergenic
1127913295 15:63435867-63435889 TCACTGGTATATGACCTTATAGG + Intergenic
1127946945 15:63764911-63764933 TAACTGGTATATGACCTTCTAGG + Intronic
1128849882 15:70943660-70943682 TAACTGGTATATGACCTTCTAGG - Intronic
1137746234 16:50822240-50822262 TACCTGGTATATGACCTTCTAGG - Intergenic
1138261758 16:55628701-55628723 TACCTGGTATATGACCTTATAGG + Intergenic
1138356569 16:56385828-56385850 TGCCGGGTATATGACCTTGTTGG - Intronic
1139099680 16:63750317-63750339 TAACTGGTATATGACCTTCTGGG - Intergenic
1139352897 16:66348379-66348401 TGCAGGGTTCCTGACCTTGTGGG + Intergenic
1140200400 16:72890169-72890191 TGTTGGGGATAGGACCTTGTGGG + Intronic
1141112352 16:81280634-81280656 TACCAGGTATGTGACCTTGGAGG + Intronic
1143147410 17:4785734-4785756 TGCTGTGTATATGACCTGGTGGG + Intronic
1144445490 17:15323401-15323423 TGCAGGGTAGATGACTTTGCAGG + Intronic
1153175507 18:2367773-2367795 TAACTGGTATATGACCTTCTAGG + Intergenic
1153348879 18:4057327-4057349 TAACTGGTATATGACCTTGTAGG + Intronic
1154040726 18:10853071-10853093 TAACTGGTACATGACCTTGTAGG + Intronic
1156644255 18:39140801-39140823 TAACTGGTATATGACCTTCTAGG + Intergenic
1165320749 19:35083824-35083846 TGCCGGGTCTCTGACCTCGTAGG + Intergenic
1166428603 19:42702083-42702105 TTTCTGGTATATGACCTTCTAGG + Intronic
1167632544 19:50634503-50634525 TGCCTGGTATATGTCCCTGCAGG - Intronic
925587386 2:5476837-5476859 TAACTGGTATATGACCTTCTGGG + Intergenic
926459121 2:13106529-13106551 TGCCGGGCAGATGTCCTCGTAGG - Intergenic
926828253 2:16931435-16931457 TAACTGGTATATGACCTTCTAGG - Intergenic
929560851 2:42955550-42955572 TGCCAGGAATATGAAGTTGTGGG - Intergenic
933368494 2:81386292-81386314 TAACAGGTATATGACCTTCTAGG + Intergenic
944037551 2:195313743-195313765 TGCTGGTTAGATGACATTGTGGG + Intergenic
944481354 2:200160794-200160816 TAACTGGTATATGACCTTCTGGG - Intergenic
944914474 2:204344070-204344092 TAACTGGTATATGACCTTCTAGG + Intergenic
1169751600 20:9000242-9000264 TAACTGGTATATGACCTTCTAGG + Intergenic
1182880073 22:33725464-33725486 TGACAGGTAAATGACCTTGTTGG - Intronic
955740591 3:62087305-62087327 TTCCTGGAATATGACCTAGTAGG + Intronic
958151232 3:89697122-89697144 TACCTGGTGTATGACCTTCTAGG + Intergenic
965376111 3:167926335-167926357 TAACTGGTATATGACCTTCTGGG + Intergenic
973003901 4:44986763-44986785 TAAGTGGTATATGACCTTGTAGG + Intergenic
974713189 4:65630315-65630337 TAACTGGTATATGACCTTGGAGG + Intronic
975485464 4:74930645-74930667 TAACTGGTATATGACCTTCTGGG - Intergenic
979183166 4:117755857-117755879 TAACTGGTATATGACCTTATGGG - Intergenic
979793491 4:124815375-124815397 TTACCGGTATATGACCTTCTAGG + Intergenic
980420003 4:132546888-132546910 TAACTGGTATATGACCTTCTAGG + Intergenic
981526409 4:145710555-145710577 TAACTGGTATATGACCTTCTAGG - Intronic
986321849 5:6637812-6637834 AGCCAGGTCCATGACCTTGTGGG + Intronic
986748498 5:10764132-10764154 TGACTGGTATATGACCTTCTAGG + Intergenic
988740671 5:34066075-34066097 TAACTGGTATATGACCTTCTAGG - Intronic
992424639 5:76644243-76644265 TGCCTGGTATGGGAACTTGTGGG - Intronic
996765633 5:127031562-127031584 AGCCTGGAATATGGCCTTGTGGG + Intergenic
1012096528 6:94969513-94969535 TGCTGGATATTTGACCTTGTTGG - Intergenic
1012192673 6:96299904-96299926 TAACTGGTATATGACCTTCTAGG - Intergenic
1024765305 7:52650600-52650622 TGCTGGGTAAAGGCCCTTGTAGG + Intergenic
1026258261 7:68731747-68731769 TACCTGGTTTATGACCTTCTAGG + Intergenic
1028794202 7:94885760-94885782 TAACTGGTATATGACCTTCTAGG - Intergenic
1034080643 7:148274826-148274848 TGCCGATTGTATGACTTTGTCGG + Intronic
1036441198 8:8782443-8782465 TGACTGGTATAGGACCTTCTAGG + Intergenic
1037236003 8:16720185-16720207 TAACTGGTATATGACCTTCTAGG + Intergenic
1040673088 8:49716014-49716036 TAACTGGTATATGACCTTCTAGG + Intergenic
1042311162 8:67380600-67380622 TAACTGGTATATGACCTTCTAGG + Intergenic
1042655876 8:71095966-71095988 TGCAGGGCATCTGACCTTGTTGG + Intergenic
1045977764 8:108148926-108148948 TAACTGGTATATGACCTTCTGGG - Intergenic
1051750839 9:20339397-20339419 TGCCCAGTATATGACCCTCTTGG - Intergenic
1058301016 9:103373112-103373134 TAACCGGTATATGACCTTTTAGG - Intergenic
1187222131 X:17338475-17338497 TGCTGGGTATCTCACCTTCTGGG - Intergenic
1189580467 X:42400908-42400930 TAACTGGTATATGACCTTCTAGG + Intergenic
1191646614 X:63488429-63488451 TGAGGGGAATATGACCTAGTGGG + Intergenic
1193330765 X:80233185-80233207 TAACTGGTATATGACCTTCTAGG - Intergenic
1195229316 X:102830155-102830177 TGCCAGGATTATGCCCTTGTGGG - Intergenic
1199082444 X:143591864-143591886 TAACTGGTATATGACCTTCTAGG - Intergenic