ID: 1138360328

View in Genome Browser
Species Human (GRCh38)
Location 16:56422810-56422832
Sequence TGTTATTTTGGGCACTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 258}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138360328 Original CRISPR TGTTATTTTGGGCACTTTGG AGG (reversed) Intronic
901159926 1:7168195-7168217 CCTTATGTTAGGCACTTTGGTGG + Intronic
902444683 1:16454927-16454949 TGTTATTTTCAGCATTTTAGAGG + Intronic
903155286 1:21438685-21438707 TGTTATTTTCAGCATTTTAGAGG + Intergenic
904516970 1:31063890-31063912 TGTTATCTTGGGTAGTTTTGTGG + Intronic
905194896 1:36268355-36268377 TGACATTTTGGACATTTTGGAGG + Intronic
905254592 1:36672019-36672041 TATGATTTAGGGCACTCTGGAGG - Intergenic
908497533 1:64709780-64709802 TGTTATTTTGGACACATAGTGGG + Intergenic
908670357 1:66540078-66540100 TATTATTTTGGGCATTATGATGG + Intronic
911536653 1:99107943-99107965 TATTGTTTTGGGCACTTAAGTGG - Intergenic
912869167 1:113288230-113288252 TGGTATTTTGGTCACTTCTGTGG - Intergenic
913226544 1:116705516-116705538 TGTTATTTGGGGGATTTTTGTGG + Intronic
916373681 1:164127581-164127603 TTTTACTTTGGGTAATTTGGAGG + Intergenic
916812493 1:168317747-168317769 TCTTATTTGGAGCACTTTGTAGG + Intergenic
917590774 1:176474504-176474526 AGATATTTTGGGCACAATGGTGG + Intronic
921569999 1:216766286-216766308 TGCTGTTTGGGGCACTCTGGAGG + Intronic
921965116 1:221079820-221079842 GGCTATTTAGGGCACTTTCGTGG + Intergenic
923363528 1:233236195-233236217 TTCAATTTTGGGCATTTTGGAGG - Intronic
924278607 1:242412988-242413010 TTTTATTTTGGCCATTCTGGTGG + Intronic
924800178 1:247323673-247323695 TCTTATTTTGGGGACTGAGGTGG + Intronic
924864662 1:247965600-247965622 TGCCATCTTGGGCACTGTGGTGG - Exonic
1064769975 10:18712843-18712865 TGTAGTTTTGGCTACTTTGGAGG + Intergenic
1065310451 10:24410873-24410895 GATTATTTTAGGTACTTTGGGGG - Intronic
1065613886 10:27500607-27500629 TGTCATTTTGACCACTTGGGTGG - Intergenic
1065697527 10:28393588-28393610 TGTAATTTTAGGCACTTGGGAGG - Intergenic
1065981254 10:30900379-30900401 TGTTATTTGGGCTATTTTGGTGG - Intronic
1066507891 10:36064725-36064747 TGTAAATTTGGGTACTTAGGAGG + Intergenic
1068231664 10:54175383-54175405 TGTTATTTAGTGCTCTGTGGAGG - Intronic
1068598999 10:58935797-58935819 TGTTATTTGTGGCAACTTGGAGG + Intergenic
1069007172 10:63330823-63330845 TGTTATTCTGGGCATTTTAGTGG - Intronic
1069100486 10:64314342-64314364 TGTTATTGTGGGCAGTGTAGAGG - Intergenic
1071629006 10:87203445-87203467 GGTTATTTTGGTTATTTTGGTGG + Intergenic
1075968774 10:126635393-126635415 TGATATTTTGGGCTCTTCGAGGG - Intronic
1076396419 10:130141314-130141336 TTTTTTTTTGGTCAATTTGGTGG + Intronic
1079457324 11:20648116-20648138 TGTAATTTTGGGAACGCTGGAGG + Intronic
1080204726 11:29715778-29715800 TTTTATTTTCTGCACTTTTGAGG + Intergenic
1080718331 11:34825278-34825300 TTGTATTTTGGCCTCTTTGGAGG - Intergenic
1080770499 11:35336626-35336648 GGTCATTTTAGGCACATTGGTGG - Intronic
1082313717 11:50690430-50690452 GGATATTTGGAGCACTTTGGGGG + Intergenic
1085016988 11:73180337-73180359 AGCTATTTTGGGGAGTTTGGGGG + Intergenic
1086228347 11:84539440-84539462 TGTCATTCTGGGCACCTTTGAGG + Intronic
1088049092 11:105489078-105489100 TGGTATTTAGGATACTTTGGGGG + Intergenic
1088689393 11:112312217-112312239 CTTTATTTTGCACACTTTGGGGG + Intergenic
1088876554 11:113941273-113941295 TCTTATTTTTGGCCCCTTGGGGG + Intronic
1095420619 12:42020350-42020372 TGTTACTTTGGGGACTGAGGTGG - Intergenic
1095716298 12:45350319-45350341 TGGTGATTTGGGCACTTGGGTGG + Intronic
1098216696 12:68228035-68228057 TGTTATTTAGGACACTTTGGGGG - Intergenic
1098691243 12:73490525-73490547 TGCTATTTTGGGGACTTTCTGGG - Intergenic
1098958523 12:76713424-76713446 TGTTATTTGGGTTACTTTAGGGG + Intergenic
1099510697 12:83532647-83532669 TGTAACTTTGGGCAAGTTGGTGG - Intergenic
1099602003 12:84751519-84751541 TCTTATTTTTGGCACTTTGTTGG + Intergenic
1100681207 12:96923517-96923539 TCTTATTTTTGCCACTTTGATGG + Intronic
1102285792 12:111655362-111655384 TGATATTTTGGGGTCTTAGGGGG - Intronic
1104971256 12:132531858-132531880 TGTAATTTTGTCCACATTGGTGG + Intronic
1106005815 13:25769389-25769411 TGTGATCTTGTGCAGTTTGGAGG + Intronic
1108192642 13:47957879-47957901 TGTCAGTTTGGACACTTTTGGGG + Intronic
1108671305 13:52691910-52691932 TTTTATTTTGGGAACTTGTGGGG + Intronic
1109113051 13:58347517-58347539 TATTATATTGGGCTCTTTTGGGG + Intergenic
1110539443 13:76691162-76691184 TTTTATTTTGGGATCTTTGGTGG - Intergenic
1111367670 13:87270689-87270711 TTTTATTTTGTGCTTTTTGGGGG + Intergenic
1111551990 13:89825595-89825617 TGTTATTGTTGTCATTTTGGTGG + Intergenic
1111894359 13:94122241-94122263 TTTTGTGTTGGGCACTTTGCAGG + Intronic
1111971813 13:94924652-94924674 TGTTGCTTTGTGCACTTAGGTGG - Intergenic
1113246653 13:108404002-108404024 TTTTATTTTTGCCCCTTTGGGGG + Intergenic
1114811771 14:25909083-25909105 TATTGTTTTAGGTACTTTGGTGG + Intergenic
1116244325 14:42389644-42389666 TGTAATTTTAGGCACTTAGATGG + Intergenic
1116527368 14:45922180-45922202 TTTTATTTTAGGCACTATTGTGG + Intergenic
1116642936 14:47487839-47487861 TGTTATAATGGACATTTTGGGGG - Intronic
1117032631 14:51689815-51689837 TTGTGTTTTGGGCACTCTGGTGG - Exonic
1117093575 14:52273940-52273962 TGTTGTTTGAGGCACTTTGCAGG + Intronic
1118234060 14:63984569-63984591 TGTTTTGTTGGGTAATTTGGAGG + Intronic
1118876373 14:69788121-69788143 TGTTAGTCTTGGCACTGTGGAGG + Intronic
1119033564 14:71211233-71211255 TTTTATTCTGAGCATTTTGGTGG - Intergenic
1120348687 14:83325277-83325299 AGTTATTATTGTCACTTTGGTGG - Intergenic
1120370375 14:83626596-83626618 AGTTACTATGGGCACCTTGGAGG + Intergenic
1120878779 14:89398423-89398445 TGTGATTACGGGCACTTTGAGGG + Intronic
1121360322 14:93251983-93252005 TTGTATTTTGAGCACTTTGTTGG - Intronic
1122434341 14:101684038-101684060 TTTTATTTTGGCCACTTAAGGGG - Intergenic
1123777806 15:23597938-23597960 TTTCAGTTTGGACACTTTGGAGG - Intronic
1125270746 15:37936075-37936097 TGTTAGATTGAGCACTTTGGAGG + Intronic
1125618385 15:41036722-41036744 GGTTATTTTGGGCACTTTTAAGG - Intronic
1126044072 15:44621808-44621830 TGTTAAATTGGGCTCTGTGGTGG - Exonic
1126625145 15:50679211-50679233 TGTCATTTTAGGTACTTGGGAGG + Intronic
1127819035 15:62639287-62639309 TGCTATATTGGGGACTGTGGTGG + Intronic
1128114868 15:65098940-65098962 CCTCTTTTTGGGCACTTTGGGGG + Intronic
1128851566 15:70963007-70963029 TGTTAATTCCAGCACTTTGGGGG + Intronic
1129226390 15:74172890-74172912 TGGGATTTTGGGCCCTGTGGGGG + Intergenic
1130042396 15:80415835-80415857 AGATATTTTGGGCTTTTTGGTGG + Intronic
1130160128 15:81390218-81390240 TGTTTTTTTGGGTTTTTTGGGGG + Intergenic
1130534925 15:84777580-84777602 CATTATTTTTAGCACTTTGGTGG - Intronic
1131460107 15:92611807-92611829 CTTTATTATGGGCACTTTAGAGG - Intergenic
1131709160 15:95034085-95034107 TATTGTTTTGGTCACCTTGGGGG + Intergenic
1133268916 16:4600990-4601012 TGTAATTTCAGCCACTTTGGAGG + Intergenic
1134799425 16:17070985-17071007 TGTTATTTTTGTCAGTGTGGAGG - Intergenic
1135937554 16:26793898-26793920 TGCCATCTTGGGCACTTCGGTGG - Intergenic
1136576971 16:31130863-31130885 TCTTATACTGGGCACTTTTGAGG - Exonic
1136679623 16:31950580-31950602 TTTTATTATGGGGACTTTGCTGG + Intergenic
1136780175 16:32894006-32894028 TTTTATTATGGGGACTTTGCTGG + Intergenic
1136890432 16:33967521-33967543 TTTTATTATGGGGACTTTGCTGG - Intergenic
1136932998 16:34435698-34435720 TCTTATATTGGGCAGTTTGGGGG - Intergenic
1136971574 16:34976116-34976138 TCTTATATTGGGCAGTTTGGGGG + Intergenic
1137897541 16:52230280-52230302 TCTTCTTTTGGGCACATAGGAGG - Intergenic
1138360328 16:56422810-56422832 TGTTATTTTGGGCACTTTGGAGG - Intronic
1139080178 16:63508331-63508353 GTGTATTCTGGGCACTTTGGTGG - Intergenic
1141738660 16:85873847-85873869 TTTTATTTTGGGCATATGGGAGG + Intergenic
1203082597 16_KI270728v1_random:1156093-1156115 TTTTATTATGGGGACTTTGCTGG + Intergenic
1143447752 17:7019079-7019101 TGTTAGTTTGGGGGCTATGGAGG - Intergenic
1143835331 17:9687864-9687886 TTCTAATTTGGGCACTTTGGTGG - Intronic
1144383616 17:14728000-14728022 TGTTATTTTGGAAACTAAGGAGG + Intergenic
1145897628 17:28469642-28469664 TGATATCTAGGGCACTTTGCAGG + Intronic
1147219647 17:38920766-38920788 TCTTATATTGGGCGATTTGGGGG + Exonic
1148974683 17:51516738-51516760 TGTTGTTTTGGGGGCTTTTGTGG - Intergenic
1149625899 17:58080663-58080685 TATTGTTTTTGGCTCTTTGGTGG - Intergenic
1153154016 18:2128650-2128672 AGTTATTTTAGGGAGTTTGGAGG + Intergenic
1153759650 18:8318151-8318173 TGGTATTTTGGGCAATCTTGGGG + Intronic
1156160600 18:34353690-34353712 AGTTCTTTAGGGAACTTTGGTGG + Intergenic
1156186748 18:34672037-34672059 TCTTTTTTTGGCCAATTTGGTGG + Intronic
1156858173 18:41806915-41806937 GTTTATTTTGGGCACTTTGCAGG - Intergenic
1159747699 18:72259052-72259074 TGTTATTTTGGGCGTTTAGTGGG - Intergenic
1160114325 18:76063570-76063592 TGCTATTTGGGGCACTTTGGTGG - Intergenic
1164351665 19:27352868-27352890 GGATATTTGGGGCACTTTGAGGG - Intergenic
1164938551 19:32233316-32233338 TGCCGTTTTGGGCACTTGGGCGG + Intergenic
1165564201 19:36709719-36709741 TTGTAATCTGGGCACTTTGGAGG - Intronic
1166946118 19:46397531-46397553 TTTTATTCTGGACATTTTGGGGG + Intergenic
1167950045 19:53019188-53019210 AGTAATTTTGAGCAGTTTGGTGG - Intergenic
1168489181 19:56793674-56793696 TTTCATTTTGGACATTTTGGAGG - Intronic
1168662873 19:58182024-58182046 GGTTTTTTTGGTCACTGTGGAGG - Intergenic
926091634 2:10054969-10054991 TGTTTCTTTGGGTTCTTTGGAGG + Intergenic
927020341 2:19010184-19010206 TGTAATCTTTGGCAGTTTGGGGG - Intergenic
927362740 2:22255406-22255428 GGTTATTTTTGTTACTTTGGGGG - Intergenic
928848053 2:35704602-35704624 TGGAATATTGGGCACTTTGTGGG - Intergenic
929768817 2:44874264-44874286 TTTCATTTTGTTCACTTTGGAGG - Intergenic
930437005 2:51357340-51357362 TTTTATTTTGAGCAATTTGTGGG + Intergenic
930638726 2:53833702-53833724 TGCTATTTGGGGGTCTTTGGGGG - Intergenic
931938359 2:67223574-67223596 TGTCAGTTAGGGCACTTTAGGGG - Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
934099438 2:88638935-88638957 TTTTATTTTAGGCATATTGGTGG - Intergenic
934889450 2:98054219-98054241 TGGCAGTTTGGCCACTTTGGCGG - Intergenic
936753111 2:115670291-115670313 TGTTTTTTTGGCCACTTCTGTGG - Intronic
939920089 2:148099516-148099538 GGCAATTTTGGGCATTTTGGAGG + Intronic
940125487 2:150318575-150318597 ATTGATTTTGGCCACTTTGGTGG + Intergenic
940388828 2:153107090-153107112 TCTTAATTTGGGCAACTTGGTGG + Intergenic
942476859 2:176335720-176335742 TTTTATTTTGGGAAGTTTGGGGG + Intronic
943113949 2:183642794-183642816 TGTAATTTTGGTCAGTTTGAAGG + Intergenic
943727820 2:191269871-191269893 TGTTATTTTGTGGAATTTAGAGG + Intronic
944138421 2:196427599-196427621 TTTTATTTGGTGCACTTAGGAGG + Intronic
944786803 2:203079772-203079794 TATTATTTTTGGCATTTAGGAGG + Intronic
944997416 2:205309612-205309634 TGTTAATTTGGCTAATTTGGTGG - Intronic
945078410 2:206063727-206063749 TGTTATTTAGTTCAATTTGGGGG - Intronic
946956185 2:224932352-224932374 TTTTATTTTTGGCACTATGAGGG - Intronic
1169060059 20:2654601-2654623 TGTTATCCTGGACATTTTGGGGG + Intronic
1169696922 20:8399825-8399847 TTTTATTTTCGGGACTTTGTGGG - Intronic
1169773570 20:9227784-9227806 TATTATTTTGGCTACTTGGGGGG + Intronic
1170240452 20:14160266-14160288 AGTTATTTGGGGTAGTTTGGGGG + Intronic
1171216645 20:23357136-23357158 TGCTAATTTGGACAATTTGGGGG + Intergenic
1171405113 20:24906977-24906999 TTTAATTTTAGCCACTTTGGTGG - Intergenic
1172265865 20:33613278-33613300 TGTAATTTGGGGCAGTTTTGGGG + Intronic
1173033837 20:39389472-39389494 TGGTCTTTTGGGCATTTTAGTGG + Intergenic
1174513887 20:51076497-51076519 TGTTATTCTGGCTACTTGGGAGG + Intergenic
1174988192 20:55479705-55479727 TGGTCTTTTGGGCATTTTGTAGG - Intergenic
1176876436 21:14134659-14134681 TGTTATTTTGTTGACTTTGTTGG - Intronic
1177887301 21:26762164-26762186 TGTTTTTATGGACAATTTGGTGG + Intergenic
1177891047 21:26804475-26804497 TCTTAATTTGGTCATTTTGGAGG - Intergenic
1178819013 21:35958359-35958381 TATTCTATTGGGCACTATGGAGG - Intronic
1179163638 21:38918060-38918082 TGCTATTTTGGTCTCTTAGGGGG - Intergenic
1181835158 22:25599831-25599853 TTTTATTTTAGCCATTTTGGTGG - Intronic
1182508131 22:30800178-30800200 TGGTATTGTGGACACTTTGCTGG + Intronic
1183630225 22:39028008-39028030 TTTTATTCTCAGCACTTTGGTGG + Intronic
950036750 3:9891251-9891273 TTATATTTTGGGCCGTTTGGGGG + Intronic
950156619 3:10725819-10725841 TGTTAGTCTAGGCACTGTGGAGG - Intergenic
950193646 3:10994138-10994160 TGTGTCTTTGGGAACTTTGGGGG + Intronic
950537849 3:13591083-13591105 TGTAATTTTGGCCAGTCTGGAGG + Intronic
952179176 3:30899854-30899876 TGTGAATATGGGCACTTTGGGGG + Intergenic
953071437 3:39524518-39524540 TTTTATTTTTGCCACTTTGATGG - Intronic
953095578 3:39771525-39771547 TGTTGTATTGGGGTCTTTGGGGG + Intergenic
954274718 3:49534790-49534812 CGTTATTTTGGGTACTTTTTAGG + Exonic
957698007 3:83668748-83668770 TGTTCTTTTTGGCACTATGAGGG + Intergenic
958707924 3:97679390-97679412 TATCAGTTTAGGCACTTTGGAGG - Intronic
960456306 3:117877077-117877099 TTTTATTTTAGACATTTTGGTGG - Intergenic
960733703 3:120754479-120754501 CCTCCTTTTGGGCACTTTGGGGG + Intronic
962607731 3:137046241-137046263 TGTTTGTTTGGGGATTTTGGGGG - Intergenic
962815604 3:138995051-138995073 TATAATTTTAGTCACTTTGGAGG + Intergenic
963077419 3:141360038-141360060 TATTATTATGGGCACTTTATAGG - Intronic
964496811 3:157299975-157299997 TGCTATTTTCTGCACTTTGCAGG + Intronic
966313447 3:178619732-178619754 TTTTATTTTTGGCAATTTCGTGG - Intronic
967031844 3:185615259-185615281 TGTTATATTGGGCATGTAGGTGG + Intronic
968399239 4:276823-276845 TGCTATTTGGGGGTCTTTGGTGG - Intronic
969324627 4:6434478-6434500 TGTAATTTTAGGTACTTGGGAGG - Intronic
970079999 4:12271504-12271526 AGTTATTTTGGAAACTTTGGAGG - Intergenic
970711290 4:18866379-18866401 TGTTAATTTGGGGAATATGGGGG - Intergenic
972308823 4:37859691-37859713 AGCTATTTTGGGGACTTTTGGGG - Intronic
972411946 4:38803909-38803931 TCTTCTTTTGGAGACTTTGGAGG + Intronic
974870881 4:67639662-67639684 TGTAGTTTTAGGCATTTTGGGGG - Intronic
974890185 4:67872209-67872231 TTTTATTTTGGCCATTTTGGGGG - Intronic
976319347 4:83695217-83695239 TGCTATGTTGGGCACTTAGTAGG - Intergenic
980674728 4:136061735-136061757 TGTTATTTTATTGACTTTGGAGG - Intergenic
980797652 4:137705605-137705627 TGCTATTTTTTGCTCTTTGGTGG - Intergenic
981551469 4:145945861-145945883 TGTTATTTTGGGCAATTTGTAGG - Intergenic
981617762 4:146659627-146659649 TGTTCTTTTGAGAACCTTGGAGG + Intergenic
982521217 4:156418535-156418557 TGTTATTAAGGCCACTTTGTGGG + Intergenic
982969716 4:161969304-161969326 TGTTATTTTCAACACTTGGGTGG - Intronic
983288230 4:165766781-165766803 TATTATTTTGAGCACGTTGGGGG + Intergenic
986058631 5:4164980-4165002 TGCTAGTTTTGGCACATTGGTGG + Intergenic
986357265 5:6941043-6941065 TGTTATTATGAGCTCTTTGAGGG + Intergenic
988350678 5:30102805-30102827 TGTTATTTTGGGGGATGTGGAGG + Intergenic
989004241 5:36792262-36792284 TGTTATTTTTGGTACTTCAGGGG + Intergenic
989785364 5:45321163-45321185 TGTTATTTTGGGGGCTGTGTAGG - Intronic
989863491 5:46415355-46415377 TGATATTTGGAGCACTTTGATGG + Intergenic
990421774 5:55642477-55642499 TGTTATTAGGGAGACTTTGGTGG + Intronic
990747498 5:58974987-58975009 GGATATTTTGGACACTTTGGAGG - Exonic
993350670 5:86846117-86846139 TGTTAGTTTGGGAACTCTTGAGG + Intergenic
996108020 5:119529558-119529580 TGGTATTTTGGGCATTTTTTGGG - Intronic
996143836 5:119948671-119948693 GGTTATTTCAGGCTCTTTGGAGG - Intergenic
997125107 5:131218357-131218379 TGTTATTTTAGTCATTTTGGGGG - Intergenic
997703496 5:135924476-135924498 CTTTATTTTTGGCACTGTGGTGG - Intronic
997935177 5:138104348-138104370 TGTAATCTTGGCCACTTGGGAGG - Intergenic
999396095 5:151229359-151229381 TGATGTTGTGGGCTCTTTGGGGG + Intronic
999503737 5:152173578-152173600 TCTTATTTTGGGCTTTTTAGTGG + Intergenic
1000956941 5:167554623-167554645 TGCTATTTTTTGCACTTTGCAGG + Intronic
1001040063 5:168328199-168328221 TGTTATTATGCACACTTTGTGGG - Intronic
1001646783 5:173288053-173288075 TGTAACTTTGGGCACTTTGGGGG - Intergenic
1002343523 5:178532418-178532440 TGTTTCTTGGGGCACCTTGGGGG - Intronic
1202776616 5_GL000208v1_random:83511-83533 TGATATTTGGGGCGCTTTGAGGG - Intergenic
1202776877 5_GL000208v1_random:87939-87961 TGATATTTGGGGCGCTTTGAGGG - Intergenic
1002836028 6:865870-865892 TGACATTTTTGGCACTCTGGGGG + Intergenic
1004194969 6:13495264-13495286 TATTATTTTGGGCATTTCAGAGG - Intergenic
1004276445 6:14240527-14240549 TGTTATGTTTGGCATTTTGGTGG - Intergenic
1004643913 6:17541320-17541342 TGTAATGATCGGCACTTTGGGGG + Intronic
1004955030 6:20720152-20720174 TGTGGTTTTGGGCCCTGTGGTGG + Intronic
1007967482 6:46015871-46015893 GGCTATTTTGGGCGCGTTGGCGG - Intronic
1009344711 6:62599077-62599099 GGTTATTGTGGGTACTATGGGGG + Intergenic
1011273986 6:85610448-85610470 TCTTAATTTGGGGACTTGGGAGG - Intronic
1011627554 6:89296006-89296028 TGCTGTTTTGGTTACTTTGGGGG + Intronic
1011895587 6:92220696-92220718 TGTTATGTTTGCCTCTTTGGTGG - Intergenic
1011895704 6:92222207-92222229 TGTTATTTTGCCCACTTTTTTGG - Intergenic
1012196711 6:96351035-96351057 TTTTATTTTAGGCACTCTGGTGG + Intergenic
1013969167 6:115995489-115995511 TGATATTTTCAGCAATTTGGAGG - Intronic
1015825817 6:137310374-137310396 TGCTAGTTTGGCCACTTTGGGGG + Intergenic
1019826709 7:3290505-3290527 TGCTGTTTTGGGCACTGGGGAGG + Intergenic
1020526353 7:9264144-9264166 TTTTATTTTTGACACTTTAGTGG + Intergenic
1020782548 7:12535133-12535155 TCTTATTTTGGCTATTTTGGTGG - Intergenic
1020897062 7:13953389-13953411 TTTTATTTTTGGAACTTTGCAGG - Intronic
1021066746 7:16184947-16184969 TGTTGTTTTGGACATTTTTGTGG + Intronic
1021775654 7:24052732-24052754 TGTTATTAAGGGCATTTTAGTGG + Intergenic
1023339947 7:39209638-39209660 ATTTATCTTGGGCACTTTTGAGG - Intronic
1023558709 7:41449986-41450008 TGTTTTCTTGGGCACTTTACAGG + Intergenic
1028448524 7:90953359-90953381 TGTTATTTTGGGAAGTTATGTGG + Intronic
1028505834 7:91569296-91569318 TGTAATTTGGGTCACCTTGGAGG - Intergenic
1031910099 7:127507035-127507057 AGCTATTTTGGGCAATTAGGAGG + Intergenic
1033904174 7:146181136-146181158 AGTTACTTTAAGCACTTTGGGGG + Intronic
1036131934 8:6123484-6123506 TGTAATATTGGGCACTGTGTTGG - Intergenic
1041254726 8:55970395-55970417 TGATATTTTGGGCACATTGTGGG - Intronic
1042044916 8:64639571-64639593 TTTTATTTTAGCCACTGTGGTGG - Intronic
1042194947 8:66223850-66223872 TGTTAGTTTGGGCCCTCCGGGGG + Intergenic
1043075786 8:75697827-75697849 TGTTATTATCTTCACTTTGGAGG - Intergenic
1043231594 8:77808998-77809020 TGTTAATTTGGGCTCTTTTGTGG - Intergenic
1043871309 8:85436480-85436502 TGATATATTGGGCAATTTGTAGG - Intronic
1046190567 8:110789701-110789723 AGTTTTTTTGGGCAATTTGGTGG + Intergenic
1046252946 8:111657163-111657185 ATTTATTTTTGGCGCTTTGGTGG - Intergenic
1050699120 9:8317423-8317445 TGTTATTATGAGCAGTATGGTGG + Exonic
1051782715 9:20707811-20707833 TGTTATTTTGGGAGTGTTGGTGG + Intronic
1051945717 9:22567456-22567478 TGGTATTGTGGGCACTTTTTTGG + Intergenic
1052129796 9:24829260-24829282 TGTCATTTGCAGCACTTTGGAGG + Intergenic
1058449204 9:105080488-105080510 GGTGATTTAGGGCAGTTTGGAGG - Intergenic
1060091082 9:120744111-120744133 TGTTATTTTTCACAATTTGGCGG - Intergenic
1060444150 9:123671953-123671975 TGTTCTTTTGAGCATTTTAGAGG - Intronic
1061293814 9:129666532-129666554 TCTTAAGTTGGGCTCTTTGGGGG + Intronic
1061368635 9:130185662-130185684 GGCTATTTTTGGCACTGTGGGGG + Intronic
1061748592 9:132758142-132758164 TGAGCTCTTGGGCACTTTGGTGG + Intronic
1185923818 X:4124411-4124433 TGTTATTTGGTGCATTTTGCTGG + Intergenic
1186045155 X:5528036-5528058 TGTTATCTTGTCCACTTGGGAGG + Intergenic
1186095790 X:6100309-6100331 TTTTGTTTTGGCCAGTTTGGGGG + Intronic
1186478776 X:9879763-9879785 TGTTGTTTTGGGGTCTCTGGAGG + Intronic
1187129046 X:16483186-16483208 TGTTTTTATGGGAACTATGGGGG - Intergenic
1187198625 X:17112940-17112962 TGTTATTCTGGGCATGGTGGCGG + Intronic
1189709950 X:43799498-43799520 TGTTATTGTTGGCAATTTGGTGG + Intronic
1190632878 X:52405640-52405662 TGTCATTTTGGGTTTTTTGGAGG + Intergenic
1190927581 X:54922819-54922841 AGTTATTTTGGGCTTGTTGGTGG - Exonic
1195509746 X:105701184-105701206 TGGAATTTTGGGCACTATGCAGG + Intronic
1195840443 X:109170727-109170749 TGTAATTTTGGGGACTTTGATGG + Intergenic
1196092959 X:111766335-111766357 TTTTATTTTAGTCATTTTGGTGG + Intergenic
1196648565 X:118145638-118145660 TGTTATTGAGGTCACTATGGTGG - Intergenic
1197334266 X:125192856-125192878 TGTTATTTAAGGCACTATGTTGG + Intergenic
1197879471 X:131150866-131150888 TTTAATTTTAGGCAATTTGGTGG + Intergenic
1197952398 X:131911831-131911853 TGATATTTTGGGCACTAAGCAGG + Intergenic
1198006638 X:132501356-132501378 TGTTTTTATGGGAACGTTGGTGG - Intergenic
1198185859 X:134253720-134253742 TTTTATTTTTAGCACTTTGGGGG - Intergenic
1199525401 X:148785973-148785995 TGTTACATTGGGCACCTTGCTGG - Intronic
1199635682 X:149809355-149809377 TGTTCTCTTGGGCGATTTGGAGG + Intergenic
1199643746 X:149885433-149885455 TGTTCTATTGGGCGATTTGGAGG + Exonic