ID: 1138360759

View in Genome Browser
Species Human (GRCh38)
Location 16:56425460-56425482
Sequence CAGCCAGGAGCGGCCCGGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 591
Summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 539}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138360759_1138360772 28 Left 1138360759 16:56425460-56425482 CCGGGCCGGGCCGCTCCTGGCTG 0: 1
1: 0
2: 6
3: 45
4: 539
Right 1138360772 16:56425511-56425533 CGCTGCTGCCCCTGCCGGCGCGG 0: 1
1: 0
2: 0
3: 39
4: 300
1138360759_1138360769 23 Left 1138360759 16:56425460-56425482 CCGGGCCGGGCCGCTCCTGGCTG 0: 1
1: 0
2: 6
3: 45
4: 539
Right 1138360769 16:56425506-56425528 GCTCCCGCTGCTGCCCCTGCCGG 0: 1
1: 1
2: 10
3: 94
4: 915

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138360759 Original CRISPR CAGCCAGGAGCGGCCCGGCC CGG (reversed) Exonic
900096112 1:940779-940801 CAGCCAGGGGCTGACCGCCCAGG - Intronic
900102902 1:970417-970439 CAGCCAGGTGGGGGCCGGGCTGG + Exonic
900111993 1:1011311-1011333 CAGGCATGAGCCGCCTGGCCTGG + Intergenic
900126298 1:1070342-1070364 CGGCCAGGAGGGCCCAGGCCAGG - Intergenic
900437236 1:2636832-2636854 CAGCCAGGTGTGGCCCAGGCAGG - Intronic
900530244 1:3149468-3149490 CAGCCAGGAGTGGCAGGGCAGGG - Intronic
900786308 1:4652889-4652911 GACCCAGGGGCGGCCCGGCAGGG + Intergenic
901017982 1:6242543-6242565 GCGCCAGGACCGGCCGGGCCGGG - Intergenic
901226001 1:7613392-7613414 CACACAGGAGAGGCCCAGCCTGG + Intronic
901503811 1:9671387-9671409 CAGCCCGGACAGGCCAGGCCTGG - Intronic
901577301 1:10210944-10210966 CGGGGAGGAGCGGCCGGGCCGGG + Intronic
901641182 1:10694007-10694029 CCCGCAGGAGCGGCCCGTCCCGG + Intronic
901842676 1:11963959-11963981 CAGCCAGGAGCAGACAGGGCAGG - Intronic
901842867 1:11964788-11964810 CAGCCAGGAGCGGGCAGCACAGG + Intronic
901976905 1:12952451-12952473 CAGGCATGAGCAGCCTGGCCCGG - Intronic
902008265 1:13249319-13249341 CAGGCATGAGCAGCCTGGCCCGG + Intergenic
902027234 1:13393086-13393108 CAGGCATGAGCAGCCGGGCCCGG + Intergenic
902295413 1:15463531-15463553 GAGCCAGGAGCCCCCAGGCCTGG + Intronic
902298305 1:15483409-15483431 GAGCCAGGAGCCCCCAGGCCTGG + Intronic
902916687 1:19644105-19644127 CAGCCCGGGGCGGGCGGGCCAGG + Intronic
903277784 1:22232823-22232845 CAGCCTGGGGAGGCCCTGCCAGG - Intergenic
904146364 1:28395187-28395209 CAGCCATGAGCCACCAGGCCCGG + Intronic
904211127 1:28887479-28887501 CAGCCAGGACCGGCCGGACCCGG - Intronic
904557490 1:31374706-31374728 CAGCCAGCAGCAGCCTGTCCAGG + Intronic
904673092 1:32180432-32180454 AGCCCAGGAGCGGCCCAGCCAGG + Exonic
904812649 1:33173311-33173333 CAGGCAAGTGCAGCCCGGCCAGG - Intronic
905304817 1:37010192-37010214 GAGCAAGGAGTGGCCCGGCTTGG - Intronic
906609145 1:47190140-47190162 CAGCCAGGGGAGGCCAGGTCTGG - Intronic
906719754 1:47996756-47996778 CGGCGAGCAGCGGCCCCGCCAGG + Exonic
906783096 1:48590112-48590134 TAGCCAGTAGCGGCCAGGCGCGG + Intronic
910358929 1:86395729-86395751 TATCCAGGAACGGCCCGGTCAGG + Intronic
911769082 1:101716406-101716428 CAGGCATGAGCCGCCCTGCCAGG - Intergenic
914350397 1:146835189-146835211 CAACCAGCACCGGCCCGGCACGG + Intergenic
914456642 1:147842724-147842746 CAGGCATGAGCAGCCGGGCCCGG + Intergenic
915326245 1:155082491-155082513 GAGCCAGGCGCGGGCCGGCAGGG + Intronic
919486914 1:198157304-198157326 CCGGCAGGAGCTGCCCGGTCCGG - Intronic
919520828 1:198584395-198584417 AAGCGAGGAGCGCCCCTGCCTGG - Intergenic
919822510 1:201482068-201482090 AAGCCAGCTGCGGCCAGGCCAGG - Intergenic
920341529 1:205278178-205278200 CAGCCAAGTGTGGCCTGGCCTGG + Intergenic
920401612 1:205680037-205680059 CGGCCCGGTCCGGCCCGGCCCGG + Intronic
921392626 1:214631775-214631797 CAGGCATGAGCCGCCCTGCCTGG + Intronic
922332533 1:224590017-224590039 CAGGCATGAGCCGCCAGGCCTGG + Intronic
922359937 1:224812043-224812065 CAGGCAGGAGAGGCCCAGGCTGG + Intergenic
922597759 1:226826972-226826994 CAGGCATGAGCCGCCAGGCCCGG + Intergenic
923934407 1:238745611-238745633 CAGCCAGCAGTGCCCCTGCCTGG - Intergenic
924624775 1:245688908-245688930 CTGCAAGGAGAGGCCAGGCCTGG - Intronic
1062976258 10:1685755-1685777 CAGCCAGGAGAGGTCTGGGCAGG - Intronic
1063213137 10:3899491-3899513 CAGGCATGAGCTGCCAGGCCCGG - Intergenic
1063663789 10:8050298-8050320 CAGCCGAGAGCGGCCCGGCGGGG - Intergenic
1064432281 10:15281471-15281493 CAGCCAGGGGTGGGCAGGCCTGG + Intronic
1064461979 10:15544002-15544024 AAGCTAGGAGGGGCCAGGCCTGG + Intronic
1064680325 10:17805621-17805643 CAGCTAGGTGAGGCCAGGCCGGG - Intergenic
1065414465 10:25469493-25469515 CAGCAAGAATCGGCCGGGCCTGG + Intronic
1066656183 10:37701478-37701500 CAGCCTGAGTCGGCCCGGCCTGG - Intergenic
1067091166 10:43266536-43266558 CTGCCACGCCCGGCCCGGCCCGG + Intronic
1067345946 10:45439407-45439429 CAGCCAAGAGCGGCCAGGAAGGG - Intronic
1067497650 10:46774466-46774488 CAGCGAGGAGCTGGCCGCCCTGG - Intergenic
1067837959 10:49653175-49653197 TAGCCAGAAGTGGTCCGGCCAGG + Intronic
1069236432 10:66081332-66081354 CAGCCATGAGCCACCAGGCCTGG - Intronic
1069813574 10:71179701-71179723 CAGCCAGGTGCAGCCCTCCCAGG + Intergenic
1071579620 10:86757021-86757043 GAGCCAGGGGCTGCCCGGCCCGG + Intronic
1073010690 10:100357034-100357056 CAGGCATGAGCCGCCGGGCCCGG - Intronic
1073251003 10:102120243-102120265 CAGCCAGGGGCCGCCCGCACCGG - Exonic
1073381130 10:103078861-103078883 CAGACAGCAGCGGGCCGGGCTGG + Exonic
1073499612 10:103924003-103924025 GAGCCTGGAGAGGCCAGGCCAGG - Intergenic
1074169385 10:110918631-110918653 CAGCCAGAGGCAGCCCGGCCGGG - Intronic
1074591868 10:114821707-114821729 CAGCCCGGGGAGGCCCGGCCAGG - Intergenic
1074814610 10:117134726-117134748 CCCCCAGCAGCGCCCCGGCCCGG - Intronic
1075519981 10:123137416-123137438 CAGCTCGGAGCGAGCCGGCCTGG + Exonic
1075732919 10:124646952-124646974 TACCCAGGAATGGCCCGGCCAGG - Intronic
1075764946 10:124885733-124885755 CAGCCAGGAGCCACCATGCCCGG - Intergenic
1075891326 10:125953772-125953794 CAGCTAGGAGGGGCAGGGCCAGG - Intronic
1076648340 10:131969896-131969918 CAGCCAGGAAAGGCCAGGCGCGG + Intronic
1076683661 10:132187319-132187341 CGCCCAGGCCCGGCCCGGCCCGG + Intronic
1076688282 10:132208004-132208026 CGGCCGGGAGCGGCTAGGCCGGG - Exonic
1076773454 10:132679802-132679824 CAGCCAGGAGGCACCCTGCCTGG + Intronic
1076871504 10:133197205-133197227 CTGCCGGGAGCGGCCAGGCAAGG - Intronic
1077008383 11:369555-369577 GAGCCGGGAGCGGCCGGGCGGGG + Intergenic
1077356888 11:2122822-2122844 CACACAGGTGCGGCCAGGCCAGG - Intergenic
1077476240 11:2791783-2791805 CCGCCCGGAGCGGCGCGGCGAGG - Intronic
1077491329 11:2862324-2862346 CGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1077602145 11:3581274-3581296 GAGCCAGGAGCGGCCCGCGGAGG - Intergenic
1077680762 11:4237928-4237950 CACCCAGCAGCCGCCCTGCCTGG + Intergenic
1078083303 11:8219059-8219081 CAGCCAGCACAGGCCAGGCCCGG + Intergenic
1079128565 11:17735060-17735082 CAGCCAGGAGAACCCCCGCCTGG + Exonic
1081137430 11:39456395-39456417 CAGGCAGGAGCCACCAGGCCCGG - Intergenic
1081941975 11:46950902-46950924 CAGCCATGAGCCACCAGGCCTGG + Intronic
1082003999 11:47409769-47409791 CAGCCACCGGCGGCACGGCCCGG - Intronic
1083236637 11:61355161-61355183 TAGACAGGAGAGGCCAGGCCAGG - Intronic
1083590102 11:63888740-63888762 CAGGCAGGAACCGCTCGGCCTGG + Intronic
1083877042 11:65529704-65529726 CAGCCAAGAGTGGCCAGGCAGGG - Intronic
1083895636 11:65618481-65618503 CGACCAGGAGCGGCTCAGCCAGG - Exonic
1083923149 11:65791200-65791222 CAGCCAGAGGCAGGCCGGCCCGG - Intronic
1083970245 11:66070202-66070224 CAGCGCGGAGGGGCCGGGCCGGG - Intergenic
1084176788 11:67426684-67426706 CAGGCATGAGCGACCCTGCCTGG + Intergenic
1084310395 11:68313052-68313074 CCGCCAGGTGCGGCGCGGGCGGG + Intronic
1084677041 11:70641601-70641623 CAGCCAGAGGCGGCCGAGCCCGG + Intronic
1084786173 11:71442963-71442985 CAGCCAGGGGCGGCAGGGACAGG - Intronic
1084814703 11:71639390-71639412 GAGCCAGGAGCGGCCCGCGGAGG + Intergenic
1084978016 11:72814026-72814048 CGGCCAGGAGCGCGACGGCCTGG + Intergenic
1085276959 11:75306661-75306683 CAGGCAGCAGCAGCCAGGCCAGG + Intronic
1086438019 11:86800616-86800638 CAGCGAGCCGCGGCCCGGGCGGG + Exonic
1089069621 11:115689312-115689334 CAGGCAGGAGTGGCTCGGCAGGG + Intergenic
1089365491 11:117918642-117918664 CGGCCTGGAGATGCCCGGCCTGG + Exonic
1089563323 11:119356943-119356965 CAGCCCGGAGCGGGCAGGACCGG + Intronic
1090398132 11:126432517-126432539 CACACAGGAGCTGCCCAGCCAGG + Intronic
1091339410 11:134798675-134798697 CCTCCAGGAGCTGGCCGGCCAGG - Intergenic
1091661224 12:2385284-2385306 CAGCCAGGTACTGCACGGCCGGG + Intronic
1091718393 12:2795489-2795511 CAGCCGGCAGCGCCCGGGCCCGG + Intronic
1092172805 12:6384201-6384223 GGGCCGGGAGCGGCCAGGCCGGG - Exonic
1092505430 12:9093768-9093790 AAGCCAGGAGAGGCCGGGCGCGG + Intronic
1092879339 12:12875778-12875800 CAGTCCAGAGCGGCCTGGCCTGG - Intergenic
1094025735 12:25958632-25958654 CCGCCCGGCCCGGCCCGGCCCGG + Intergenic
1094025738 12:25958637-25958659 CGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1096515511 12:52153145-52153167 CAGGCAGGGGAGGCCAGGCCAGG - Intergenic
1096515753 12:52154255-52154277 CAGGTAGGAGAGGCCAGGCCAGG + Intergenic
1097019252 12:56008004-56008026 CAGGCAGGAGCTGCCAGGCGCGG + Intronic
1097191965 12:57223794-57223816 GAGGCAGGAGCGGCCGGGCCAGG - Intronic
1100565443 12:95790319-95790341 GAGCCGGGAGCAGCCGGGCCGGG + Exonic
1101737664 12:107475119-107475141 CAGCCAGAGGCAGCCAGGCCAGG - Intronic
1101893828 12:108739449-108739471 CAGGCATGAGCCGCCCCGCCCGG + Intergenic
1101903944 12:108811664-108811686 CACCCAGGACAGGCCAGGCCGGG - Intronic
1102519127 12:113468111-113468133 CATCCAGGTGCGGCCCGGGGCGG - Exonic
1103571343 12:121847033-121847055 CAGCCAGGGGCGGCCTCACCTGG + Exonic
1103614059 12:122141180-122141202 CAGCCAGGTGGGGCCGGGGCAGG + Intronic
1103763959 12:123269144-123269166 CAGCCAGGAGTGGCACAGCTGGG - Intronic
1103954840 12:124570152-124570174 CAGCCAGCTGCAGCCTGGCCTGG - Intergenic
1104720591 12:131043161-131043183 CACCCTGGAGCAGCCCGGCCCGG + Intronic
1105247395 13:18665926-18665948 CATCCAGGAGCAGCCCGGCCAGG + Intergenic
1105843207 13:24273080-24273102 TAGCCAGGAGCTGCTCGTCCTGG - Intronic
1106248669 13:27968326-27968348 GCGCCAGGAGGGGCACGGCCCGG - Intronic
1106977394 13:35236731-35236753 CAGCCATGAGCCACCCCGCCCGG + Intronic
1107447192 13:40479865-40479887 CAGGCAGGAGTGGCCAGGCAAGG + Intergenic
1112029608 13:95445051-95445073 CAGGCAGGAGCCGCCACGCCTGG + Intronic
1112091727 13:96090574-96090596 GAGCAGGGAGCGGGCCGGCCCGG + Intergenic
1113835039 13:113323125-113323147 CAGCCACGTGTGGCCCGTCCTGG - Exonic
1113901874 13:113802210-113802232 CAGCCAGGATTGGCCTGGGCAGG + Intronic
1115001200 14:28421392-28421414 CAGACAGGAGCAGCCTGGTCAGG - Intergenic
1115496481 14:34009901-34009923 CAGGCATGAGCCACCCGGCCTGG + Intronic
1115822116 14:37223789-37223811 CACCCAGGAGGGGCCAGGCAGGG - Intronic
1118159422 14:63273838-63273860 GAGCCAGGTGCAGCCTGGCCAGG + Intronic
1118480011 14:66155076-66155098 CAGGCAGGAGCCACCAGGCCGGG + Intergenic
1118764979 14:68903742-68903764 CAGCCTGGAGCTGCCAGCCCTGG + Intronic
1119325880 14:73759420-73759442 CACCCGGGCGCGGCCCCGCCAGG - Intronic
1119548732 14:75492840-75492862 CAGCCAGGAGGTGCCAGGCTGGG - Intergenic
1119744316 14:77033451-77033473 CTGCCAGGACCTGCCCAGCCTGG + Intergenic
1119834636 14:77737711-77737733 CAGGCATGAGCCACCCGGCCTGG - Intronic
1121437406 14:93928640-93928662 CATCCAGAAGCTGCCCAGCCTGG + Exonic
1122399438 14:101458351-101458373 CAGCCTGGGACGGCCTGGCCAGG + Intergenic
1122533175 14:102443371-102443393 CAGGCAGGAGCTGCCCTGTCCGG - Intronic
1122646242 14:103196342-103196364 CAGCTGGGAGGGGCCCGGACCGG - Intergenic
1122666623 14:103334467-103334489 CAGCGAGGAGCGGCCGGGCCAGG - Exonic
1122717003 14:103701902-103701924 CACCCAGGAGCTGCTCTGCCAGG + Intronic
1122893833 14:104745524-104745546 CAGCCAGGAGCAGCTCGCCCAGG - Intronic
1122993199 14:105248611-105248633 CAGCCTAGCGCAGCCCGGCCAGG - Exonic
1123019605 14:105391526-105391548 CCCCCAGGAGCTGCCTGGCCTGG + Intronic
1123035799 14:105471425-105471447 CGGCCAGGAGGGGTCCGCCCAGG + Intergenic
1123084544 14:105711426-105711448 CAGCCCGGCCCGGCCCGGCTCGG + Intergenic
1123164544 14:106314166-106314188 CAGCCAAGAGAGGCTGGGCCAGG - Intergenic
1123947544 15:25246074-25246096 CAGCTAGGAGCTGCCTTGCCCGG - Intergenic
1124577600 15:30923609-30923631 CAGCCAGCCCCGGCCTGGCCAGG + Intronic
1125714712 15:41812935-41812957 CAGCCCTGAGCGGCCCAGCAAGG - Exonic
1127429154 15:58884910-58884932 CAGCCACGAGCCACCAGGCCTGG + Intronic
1127595221 15:60474842-60474864 CAGCCAGGAGCCACTCTGCCTGG - Intronic
1128502096 15:68233751-68233773 CAGCCAGGAGGGGCCTGACTAGG + Intronic
1129082443 15:73052532-73052554 CAGCCCAGCCCGGCCCGGCCCGG - Exonic
1129273956 15:74433461-74433483 CAGCCAGGAGCCGCAACGCCCGG - Intronic
1129460367 15:75697333-75697355 CAGTCTGGAGGGCCCCGGCCTGG + Intronic
1129664158 15:77570047-77570069 CAGCCAAGAGCAGCCAGGCAGGG + Intergenic
1130347960 15:83066696-83066718 CAGCCCGGCCCGGCCCGGCCCGG + Intronic
1130347963 15:83066701-83066723 CGGCCCGGCCCGGCCCGGCCCGG + Intronic
1130347966 15:83066706-83066728 CGGCCCGGCCCGGCCCGGCCCGG + Intronic
1130347969 15:83066711-83066733 CGGCCCGGCCCGGCCCGGCCCGG + Intronic
1130537512 15:84797920-84797942 CATCCAGGAGCGACACTGCCAGG + Exonic
1131063165 15:89416857-89416879 CAGCCCGGAGTGTCCCCGCCAGG - Intergenic
1131092426 15:89632804-89632826 CAGCCAGGTGAGGCCCTGCCAGG - Exonic
1131347208 15:91661417-91661439 CAGGCATGAGCCACCCGGCCTGG - Intergenic
1131367579 15:91853460-91853482 CAGCGAGGAGCGGCTCGGCGAGG + Intergenic
1131506996 15:93028234-93028256 CAGCCTGGAGTTGCTCGGCCAGG - Intergenic
1132588122 16:715058-715080 CGGCCAGTCGCGGCGCGGCCCGG - Intronic
1132648785 16:1011100-1011122 CAGGCAGGAGCAGCCCCGCCCGG + Intergenic
1132651225 16:1022224-1022246 CAGCCAGGTGGGGCCCCTCCTGG + Intergenic
1132674246 16:1115089-1115111 CAGCCAGGAGAGGCCGGGGAAGG - Intergenic
1133021691 16:2969683-2969705 CCAGCAGGCGCGGCCCGGCCAGG - Exonic
1133234754 16:4382620-4382642 CGGCCAGGAGCACCGCGGCCAGG - Exonic
1133369936 16:5239727-5239749 GAGCCAGGAGCGGCCCGCGGAGG + Intergenic
1134216384 16:12319981-12320003 CAGCCAGGAGCTGTCAGGCAAGG - Intronic
1134644955 16:15858334-15858356 CGGCCCGGCCCGGCCCGGCCCGG - Intergenic
1134978793 16:18591036-18591058 CAGCCACCAGCGGCAGGGCCAGG - Intergenic
1136238910 16:28932449-28932471 CAGCCTGGGGCTGCCAGGCCTGG + Exonic
1136497019 16:30651030-30651052 CAGACAGGGGCGGCCCGAGCTGG - Intronic
1138360759 16:56425460-56425482 CAGCCAGGAGCGGCCCGGCCCGG - Exonic
1138457868 16:57131713-57131735 GGGCCAGGAGGGGCCAGGCCTGG - Intronic
1138472055 16:57245500-57245522 CTGCCCGGCCCGGCCCGGCCCGG - Intronic
1138551214 16:57749722-57749744 TGGCCAGGAGCGGCCCAGCCTGG - Intronic
1138578340 16:57923106-57923128 CAGCCAGAAGCAGCCTGGGCAGG + Intronic
1139366963 16:66439427-66439449 CAGGCAGGAGCAGCCCAGCATGG + Intronic
1139410050 16:66751652-66751674 GAGCGGGGGGCGGCCCGGCCCGG - Exonic
1139638691 16:68275215-68275237 CAGCCAGGAGACGGCAGGCCAGG - Exonic
1139962563 16:70726294-70726316 CACCCACCAGCGGCCCGGCCCGG - Intronic
1139983641 16:70880347-70880369 CAACCAGCACCGGCCCGGCACGG - Intronic
1140072342 16:71662097-71662119 CAGGCATGAGCGGCCACGCCCGG + Intronic
1141134674 16:81457692-81457714 CAGGCAGGGGCTGCCCGGGCTGG + Intronic
1141665557 16:85463508-85463530 CAGGCACGAGGGGCCCTGCCAGG - Intergenic
1141665704 16:85464091-85464113 CAGCCAGGAGGGGCCAGGCATGG - Intergenic
1141693991 16:85611536-85611558 GAGCCAGTAACGGCCCGACCCGG + Intronic
1142292897 16:89201014-89201036 CTGCCAGGCGCGGGGCGGCCTGG - Intronic
1142299217 16:89247099-89247121 CTGCCAGGAGCGGGGCGGCCTGG - Intergenic
1142306544 16:89289148-89289170 CAGCCAGGAGCTGCCTGCCCGGG - Intronic
1142309669 16:89305142-89305164 CAGCCCGGAGCAGCCCAGGCAGG - Intronic
1142764519 17:2057779-2057801 CAGCCTGGACGGGCCCGGCGCGG + Exonic
1142810247 17:2392796-2392818 CAGCCGGGAGGGGCGGGGCCGGG - Intronic
1143205914 17:5139179-5139201 CAGGCAGGTGGGGCCCAGCCCGG + Intronic
1143380848 17:6495564-6495586 CAGCCAGGAGCTGCAAGCCCAGG + Intronic
1145252480 17:21304182-21304204 CAGCCAGGACGTGCCCAGCCCGG - Intronic
1145310289 17:21697603-21697625 CAGCCAGGAGGGGCACTGCTGGG - Intronic
1145819845 17:27823876-27823898 CAGCCAGGAGGCCCCCAGCCAGG - Intronic
1146365379 17:32221075-32221097 GAGCCAGAAGCGGCCAGGCGTGG + Intronic
1146842696 17:36166617-36166639 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1146855009 17:36254576-36254598 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1146865611 17:36333800-36333822 CAGGCAGGTGGGGCCCAGCCCGG + Intronic
1146870909 17:36378468-36378490 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1146878267 17:36429550-36429572 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1146882216 17:36450696-36450718 CAGGCAGGTGGGGCCCAGCCCGG - Intergenic
1147068480 17:37934412-37934434 CAGGCAGGTGGGGCCCAGCCCGG + Intronic
1147073793 17:37979092-37979114 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1147080003 17:38013949-38013971 CAGGCAGGTGGGGCCCAGCCCGG + Intronic
1147085314 17:38058630-38058652 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1147095952 17:38137909-38137931 CAGGCAGGTGGGGCCCAGCCCGG + Intergenic
1147101261 17:38182596-38182618 CAGGCAGGTGGGGCCCAGCCCGG - Intergenic
1147355707 17:39894641-39894663 CAGGCAGGAGCCGCCGCGCCTGG + Intergenic
1148206769 17:45784363-45784385 CGGCCCGGCCCGGCCCGGCCCGG - Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1148807854 17:50273272-50273294 GAGCCGGGAGGGGCGCGGCCGGG - Intronic
1149845858 17:60009102-60009124 CAGGCAGGTGGGGCCCAGCCCGG - Intergenic
1150084209 17:62265682-62265704 CAGGCAGGTGGGGCCCAGCCCGG - Intergenic
1150268810 17:63849369-63849391 CCGTGAGGAGCGGCCCGGCGAGG + Intergenic
1151763658 17:76121571-76121593 CGGCCTGGCCCGGCCCGGCCCGG - Intronic
1152007318 17:77690833-77690855 CCACCAGGACCGGCCCTGCCGGG - Intergenic
1152344324 17:79742155-79742177 CAGCTGGGAGGGGCCCGCCCCGG + Exonic
1152469307 17:80482096-80482118 CAGCCAGGAGCTGATGGGCCGGG + Intergenic
1152513262 17:80804680-80804702 CAGCTAGGAGTGGCCGAGCCTGG + Intronic
1153736279 18:8071713-8071735 CGGCCAGGAGAGGCCCCGACTGG - Intronic
1153805288 18:8705251-8705273 CAGCCGGGAGCGGCGGGGGCGGG + Intergenic
1153997542 18:10454875-10454897 CGGCCGGGTGCGGCCGGGCCAGG - Exonic
1154242742 18:12667482-12667504 CAGGCATGAGCCACCCGGCCTGG - Intronic
1154348939 18:13566978-13567000 CAGCCTGGTGCAGCCTGGCCTGG + Intronic
1154441450 18:14393196-14393218 CATCCAAGAGCAGCCCGGCCAGG - Intergenic
1156634478 18:39011020-39011042 CAGCCATGAGCCGCCACGCCTGG + Intergenic
1157496654 18:48161689-48161711 CTGCCCGGCCCGGCCCGGCCCGG + Intronic
1158454860 18:57597184-57597206 CAGCCAGGAGCCACCACGCCTGG - Intergenic
1158714807 18:59868965-59868987 CAGCCATGAGCCGCCGTGCCTGG - Intergenic
1160413193 18:78688588-78688610 ATGCCAGGATCGGCCCGGGCTGG + Intergenic
1160547870 18:79673029-79673051 CAGCCAGGAGCGGGCAGGACTGG - Intergenic
1160816115 19:1036556-1036578 CAGCCAGGTGGGGCTCGCCCGGG + Exonic
1160930678 19:1568226-1568248 CCGCCCGGCCCGGCCCGGCCCGG - Intergenic
1161077039 19:2290855-2290877 CAGCCAGCAGGGCCCCGGCCAGG + Exonic
1161342863 19:3752528-3752550 CAGCCAGGGGCAGCCCCACCAGG + Exonic
1161531487 19:4792556-4792578 CATCCAGGAGCAGCCCGGCCAGG + Exonic
1161645705 19:5452040-5452062 AAGCCAGGTGCGGCCGGGCGCGG + Intergenic
1161911608 19:7198351-7198373 CAGCCACGAGGGGCCCTCCCAGG - Intronic
1162317166 19:9946537-9946559 CAGGCATGAGCCACCCGGCCTGG + Intergenic
1162577029 19:11505318-11505340 GAGCCAGGCGCGTCCCGGCCAGG + Intronic
1163158061 19:15449710-15449732 CCGCCTGGCCCGGCCCGGCCCGG + Intronic
1163162303 19:15471870-15471892 CAGGTAGGAGGGGCCCGACCGGG - Exonic
1163842263 19:19618623-19618645 CGGCCATGAGCGGCAGGGCCGGG + Exonic
1164879102 19:31715688-31715710 CAGCCAGGAGGAGCCCCGCCAGG + Intergenic
1165425868 19:35745109-35745131 CAGCCAGGTGAGACCCGGCACGG - Exonic
1165906969 19:39200104-39200126 CAGCCAGGAACGGCCAGGTTTGG - Intronic
1166084728 19:40467211-40467233 CTGCCCGGCCCGGCCCGGCCCGG - Intronic
1166793132 19:45409604-45409626 CAGCCAGCAGGAGCCTGGCCTGG + Exonic
1167001064 19:46746097-46746119 CAACCCGGCCCGGCCCGGCCCGG - Intronic
1167291852 19:48629096-48629118 GAGCCAGGAGAGGCCAGGGCAGG - Exonic
1167337761 19:48897165-48897187 CAGCCGTGAGCTGCCCTGCCCGG + Intronic
1167454642 19:49591792-49591814 CGGCCCGGCCCGGCCCGGCCCGG - Intronic
1168152049 19:54454582-54454604 CAGCCAGGCGGGGCCCGCCACGG + Exonic
1168459185 19:56539190-56539212 CAGCGAGGAGCGGCCCCTACGGG + Exonic
1168645912 19:58059344-58059366 CGGCCCGGCCCGGCCCGGCCTGG - Intronic
925981925 2:9184191-9184213 CAGCCAGGAACAGCATGGCCAGG - Intergenic
926035527 2:9632449-9632471 CAGACAGGAGCGGCCTGGATTGG + Intergenic
926268071 2:11344325-11344347 CAGCCCGGCCCAGCCCGGCCCGG + Exonic
926268077 2:11344335-11344357 CAGCCCGGCCCGGCCCTGCCGGG + Exonic
926808334 2:16733762-16733784 CAGCCAGGAGAGTCTCAGCCAGG - Intergenic
927714040 2:25341415-25341437 AAGGCGGGGGCGGCCCGGCCGGG + Intronic
927884521 2:26710318-26710340 CAGCCAGGAGCGAGCTGGCAGGG + Intronic
928537526 2:32254906-32254928 AAGCCAGGAGCGGCCAGGTGCGG - Intronic
929198049 2:39206462-39206484 TGGACAGGAGCGGCCCGGCTAGG + Intronic
930726519 2:54687036-54687058 CAGGCATGAGCCGCCCCGCCTGG + Intergenic
931239086 2:60436569-60436591 CAGGCATGAGCGGCCACGCCGGG + Intergenic
932616465 2:73234526-73234548 CAGCCAGCCGCGGCCTGGCTCGG + Intronic
933666102 2:84966492-84966514 CAGCCATGAGCCACCAGGCCCGG - Intergenic
934763731 2:96869395-96869417 CAGCCGGGGACGGCGCGGCCCGG + Intronic
934978489 2:98822452-98822474 TCGCGAGGAGCGGCCCGGTCTGG - Exonic
935755896 2:106276011-106276033 CGGCCGGGAGCTGCCCTGCCCGG - Intergenic
935971590 2:108534657-108534679 GCGCCAGGCCCGGCCCGGCCCGG - Intronic
936055416 2:109258596-109258618 CAGCCAGCTGTGGCCCGGCCTGG - Intronic
936302456 2:111314385-111314407 CCGACAGGAGCGGCCAGGACAGG - Intergenic
936514887 2:113175138-113175160 CAGGGAGGAGAGGCCCAGCCTGG + Intronic
937310886 2:120902677-120902699 CACCCAGGAGGGACCCGGCGAGG - Intronic
937853586 2:126656704-126656726 CAGCCAGGGTCCGACCGGCCAGG + Intronic
938067838 2:128291669-128291691 CAGGCTGGAGAGGCCAGGCCAGG - Intronic
938108480 2:128549124-128549146 CAGCCAGGAGCAGCGGGGCCTGG - Intergenic
938289843 2:130143376-130143398 CAGCCAGGAGAGGACAGGCCAGG - Intronic
938466685 2:131529562-131529584 CAGCCAGGAGAGGACAGGCCAGG + Intronic
946417936 2:219549955-219549977 CAGCCTGGAGAGGGCTGGCCTGG + Exonic
947266685 2:228290132-228290154 CAGGCATGAGCCGCCAGGCCTGG - Intergenic
947549745 2:231037743-231037765 GAGCCAGGCGCGGCCAAGCCGGG + Exonic
947623193 2:231604081-231604103 CACCCAGGGGTGGCCTGGCCTGG + Intergenic
947641137 2:231708449-231708471 CAGCCAATAGCGGCCGGGCATGG + Intronic
948188714 2:236042199-236042221 CAGCCAGGGTCGGCTTGGCCGGG + Intronic
948824673 2:240568461-240568483 GCGCCGGGAGCCGCCCGGCCCGG - Intronic
949027539 2:241773602-241773624 AAGCGAGGAGGGGCCCGTCCCGG - Intergenic
1169220551 20:3820117-3820139 CAGCCCGTAGCTGCGCGGCCCGG + Intergenic
1169423818 20:5480961-5480983 CAGGCATGAGCTGCCCTGCCTGG - Intergenic
1170584961 20:17727658-17727680 CTGCCAGGATCTGCCCGCCCAGG - Intronic
1170704960 20:18737000-18737022 CAGACAGGACCGGCACGGCAAGG - Intronic
1170751277 20:19147900-19147922 CAGCCAAGGGCGGCCGGGCGCGG - Intergenic
1172118168 20:32583821-32583843 CCGCCCGGACCGGGCCGGCCCGG + Intronic
1172210903 20:33197894-33197916 CAGCCATGAGCAGCCCTGCTGGG + Intergenic
1172386529 20:34537803-34537825 CAGCCTGGAGCAGCCTGGCCCGG + Intronic
1172704897 20:36875985-36876007 CACCCAGCAGCAGCTCGGCCTGG + Intergenic
1173522825 20:43712045-43712067 CAGCCAGGCACTGCCTGGCCTGG - Intronic
1174246829 20:49188084-49188106 CCACCAGGCCCGGCCCGGCCCGG + Intronic
1175205860 20:57310640-57310662 CAGGCATGAGCCACCCGGCCTGG + Intergenic
1175394790 20:58650688-58650710 CTGCCAGCGGCGGCGCGGCCAGG + Intergenic
1175489860 20:59372599-59372621 CAGCCAGGGCCGGCCTGGGCTGG + Intergenic
1175967212 20:62665691-62665713 CAGCCCAGAGGGGCCAGGCCAGG - Intronic
1176111154 20:63411387-63411409 CAGCCAGGAGGGGCCTGTCCAGG + Intronic
1176126188 20:63475949-63475971 CAGGCATGAGCCGCCTGGCCTGG - Intergenic
1176155109 20:63615601-63615623 CAGGCAGGAGCCACCAGGCCTGG + Intronic
1176310216 21:5145362-5145384 CAGCAAGGAGGGGCCCAGGCTGG + Intronic
1176454611 21:6897979-6898001 CATCCAGGAGCAGCCCGGCCAGG + Intergenic
1176832784 21:13763027-13763049 CATCCAGGAGCAGCCCGGCCAGG + Intergenic
1178350903 21:31872845-31872867 CAGCCGGAGGCGGCCCGACCTGG + Intergenic
1178981213 21:37267070-37267092 CCGCCAGGTGCGTCCCCGCCAGG - Intronic
1179195270 21:39157554-39157576 CAGCCAGGAGCCCCTCTGCCCGG + Intergenic
1179497745 21:41784522-41784544 CAGGCAGGAGCCACCCTGCCCGG - Intergenic
1179545695 21:42111181-42111203 CAGCCAGGGGAGCCCCAGCCAGG + Exonic
1179545717 21:42111256-42111278 CAGCCAGGGGAGCCCCAGCCAGG + Exonic
1179545734 21:42111316-42111338 CAGCCAGGGGAGCCCCAGCCAGG + Exonic
1179545741 21:42111331-42111353 CAGCCAGGGGAGCCCCAGCCAGG + Exonic
1179545746 21:42111346-42111368 CAGCCAGGAGAGCCCCAGCCAGG + Exonic
1179846840 21:44116674-44116696 CAGCAAGGAGGGGCCCAGGCTGG - Intronic
1179878578 21:44284098-44284120 CAGCGAGCAGCAGCCCGGCCTGG + Intergenic
1180084926 21:45504288-45504310 CAGCCAGCAGCTCCCAGGCCTGG + Intronic
1180222366 21:46367166-46367188 CAGCGAGGAGAGGCCTGCCCTGG - Intronic
1180871696 22:19150277-19150299 CCGCCATGCCCGGCCCGGCCGGG + Exonic
1180958974 22:19754197-19754219 CAGCCGGGAGGGGGCCGGCCAGG - Intergenic
1181520946 22:23448796-23448818 CAGCCAGGCGGGGCCCGGGAGGG + Intergenic
1182067758 22:27442585-27442607 CAGACATCAGCGGCCCTGCCGGG - Intergenic
1183350954 22:37334644-37334666 CAGCCCGGAGCGCCCAGGCGGGG - Intergenic
1183525964 22:38322864-38322886 CAGGCAGCAGAGGCCCGGCCCGG - Intronic
1183544588 22:38448800-38448822 CAGACAGGAGCTGCTGGGCCAGG + Intronic
1183725849 22:39589317-39589339 CACCCAGGAGTGGCCCCGCTGGG + Intronic
1183744847 22:39686285-39686307 CAGCAAGGACCCCCCCGGCCGGG + Exonic
1184278899 22:43426193-43426215 CAGCAAGGAGAGCCCCGGGCTGG - Intronic
1184384180 22:44164907-44164929 CAGGCAGGAAGGGACCGGCCAGG - Intronic
1184535630 22:45084874-45084896 CAGGCAGGCGCGGCCAGGGCTGG + Intergenic
1184570891 22:45324289-45324311 CAGCAAAGAGGGGCCCTGCCCGG - Intronic
1185047609 22:48536920-48536942 CAGCCAGCTGCAGCCCAGCCAGG - Intronic
950072630 3:10164867-10164889 TAGCCAGGGGCGGACCGGCGGGG - Exonic
950153800 3:10707890-10707912 GAGGCAGGGGCGGCCGGGCCCGG - Intronic
950499651 3:13355550-13355572 CAGGCAGGCGGGGCCTGGCCAGG - Intronic
950665742 3:14493769-14493791 CGGCCAGGAGTGGCACCGCCAGG + Exonic
952354005 3:32567978-32568000 CAGGCAGGAGCTGCCGTGCCAGG + Intronic
953660826 3:44890435-44890457 CAGCCAGGAGCGCCCCTGCAAGG - Intronic
953989947 3:47476086-47476108 CCGCCCGGCCCGGCCCGGCCCGG - Exonic
954011122 3:47639434-47639456 CAGGCATGAGCGGCCATGCCTGG - Intronic
955856462 3:63278400-63278422 CACCCTGGAGCAGCCCGGCGAGG - Exonic
957072990 3:75580338-75580360 GAGCCAGGAGCGGCCCGCGGAGG - Intergenic
958262737 3:91401915-91401937 CAGGCAGGAGCTGCCATGCCAGG - Intergenic
961281095 3:125766440-125766462 GAGCCAGGAGCGGCCCGCGGAGG + Intergenic
961551183 3:127671466-127671488 CTGCCAGGCGCGGGCCAGCCAGG + Exonic
965107193 3:164371869-164371891 CAGCCATGAGCTGCCCTGGCAGG + Intergenic
965830357 3:172779626-172779648 CAGGCAGGAGCCACCAGGCCTGG - Intronic
965978571 3:174657432-174657454 CAGGCATGAGCGACCCTGCCCGG + Intronic
966711881 3:182980332-182980354 CAGGCAGGAGAGCCCCCGCCTGG + Intronic
966874560 3:184314843-184314865 CAGCCAGGCCCGGCCGGGCCAGG - Intronic
966911404 3:184562193-184562215 CGGCCCGGCGCGGCCCGGCTCGG + Exonic
967880367 3:194297279-194297301 CAGGCGGGAGCGGTCCGGCGGGG - Intergenic
968154005 3:196363377-196363399 CAGGCATGAGCCACCCGGCCTGG - Intronic
968520338 4:1032192-1032214 CAGGAAGGAGAGGCCGGGCCAGG - Intergenic
968609054 4:1548927-1548949 CACGCAGGAGCGGCCGGGCCAGG - Intergenic
968620790 4:1602682-1602704 CAGGCAGGAGCTGCGAGGCCAGG + Intergenic
968648651 4:1751839-1751861 CAGGCAGGAGCCTCCGGGCCTGG - Intergenic
968688467 4:1977062-1977084 CAGCCCAGAGGGGCCTGGCCTGG + Intronic
968757415 4:2423926-2423948 CAGCCAGGACCGTCACTGCCCGG - Intronic
968763683 4:2457093-2457115 CAGGCAGGAGCCACCGGGCCTGG + Intronic
969431930 4:7160473-7160495 CAGGGCAGAGCGGCCCGGCCAGG + Intergenic
969663224 4:8542557-8542579 CACCCAGGAGCGGAAGGGCCCGG - Intergenic
972813254 4:42613859-42613881 CAGGCATGAGCCGCCCCGCCTGG + Intronic
975410043 4:74038737-74038759 AAGCCCGGAGCGGCCGGGCCAGG + Intronic
975612089 4:76213563-76213585 CTGGCGGGTGCGGCCCGGCCCGG - Exonic
976199112 4:82561844-82561866 CAGCCAGGGGGCGTCCGGCCCGG - Intronic
978777220 4:112516096-112516118 GTGCCAGGAGCCGCACGGCCAGG - Exonic
980465775 4:133178511-133178533 CAGGCATGAGCCACCCGGCCTGG + Intronic
981429161 4:144640704-144640726 CAGGCATGAGCCACCCGGCCCGG + Intergenic
981717210 4:147763603-147763625 CAGCCAGGCCAGGCCAGGCCAGG - Intronic
983604880 4:169572019-169572041 CAGGCAGGAGCCACCGGGCCCGG + Intronic
983604883 4:169572032-169572054 AAGCCAGGGTCGGCCGGGCCCGG - Intronic
984066471 4:175054593-175054615 CAGGCATGAGCCACCCGGCCCGG - Intergenic
985650218 5:1104092-1104114 GACCCAGGAGGGGCCTGGCCTGG + Intronic
985947484 5:3197721-3197743 CTGGCAGGAGCGGCCCTCCCTGG + Intergenic
986768644 5:10951004-10951026 CAGCCGTGAGCTGCCTGGCCAGG - Intergenic
989812675 5:45696248-45696270 CAGCTAGCAGCGGCGCGGTCGGG - Intergenic
990003832 5:50922913-50922935 CACGCAGGAGCGGCCGGGCCAGG + Intergenic
991352622 5:65734275-65734297 CAGGCATGAGCAGCCTGGCCCGG + Intronic
992111571 5:73498825-73498847 TAGCCAGGGCCTGCCCGGCCCGG - Intronic
992529107 5:77638466-77638488 CAGCCAGGAGAAGCCGGGGCAGG - Intronic
993095548 5:83474320-83474342 CAGCCAGGAACGGACCGGAAGGG + Intronic
996698374 5:126423449-126423471 GAGCTTGGCGCGGCCCGGCCTGG + Intronic
996980784 5:129491290-129491312 CACTCAGGAGTGGCCCGGCCTGG - Intronic
997201287 5:132011560-132011582 CAGCGGGGCCCGGCCCGGCCCGG + Exonic
997635097 5:135398976-135398998 TGCCCGGGAGCGGCCCGGCCTGG - Intronic
997690494 5:135824706-135824728 CAGCCAGGAAGGGCCAGGCTGGG - Intergenic
997822376 5:137077722-137077744 CAGTCCAGAGCGGCCCAGCCAGG + Intronic
998156148 5:139788248-139788270 CAGGGAGGAGCGGCCAAGCCGGG - Intergenic
999382040 5:151128112-151128134 GAGCCAGGAGAGTCCCCGCCTGG + Intronic
1001387723 5:171353652-171353674 CAGGCAGGAGCCACCCTGCCTGG - Intergenic
1002137677 5:177117879-177117901 CAGGCATGAGCCACCCGGCCCGG - Intergenic
1002277673 5:178114143-178114165 CTGCCGGGAGCGGCTGGGCCGGG - Intronic
1002280960 5:178129951-178129973 CAGGCGTGAGCCGCCCGGCCCGG + Intergenic
1002524316 5:179806891-179806913 CAGCCCAGCCCGGCCCGGCCCGG - Intronic
1002586696 5:180253117-180253139 CAGCCAGGGGCCGACCGGGCAGG + Intronic
1002815960 6:680583-680605 CAGCCAGCAGCTGCCCTGCAGGG - Intronic
1004294421 6:14397278-14397300 CAGCAAGGGGCGACCTGGCCAGG - Intergenic
1004548333 6:16621442-16621464 CAGGCATGAGCCGCCGGGCCTGG - Intronic
1005826182 6:29632897-29632919 CGGGGAGGAGCGGCCGGGCCTGG - Exonic
1005882960 6:30074507-30074529 CAGGCAGGAGCGGCCAGGGGTGG - Intronic
1006116196 6:31777290-31777312 CAGCCAAGGGAGGCCCGCCCTGG - Exonic
1006400544 6:33814736-33814758 CTGCCAGGAGCAGCCCTACCGGG + Intergenic
1007390720 6:41548143-41548165 CAGCCGGGAGGGGGCTGGCCAGG - Intronic
1007447990 6:41921616-41921638 CAGCCAGGATCTGATCGGCCAGG - Exonic
1008992676 6:57620972-57620994 CAGGCAGGAGCTGCCATGCCAGG + Intronic
1009181299 6:60520083-60520105 CAGGCAGGAGCTGCCATGCCAGG + Intergenic
1009279750 6:61733311-61733333 CAGGCATGAGCCGCCAGGCCCGG - Intronic
1010791569 6:80070657-80070679 CGGCCTAGAGCGTCCCGGCCGGG - Intergenic
1013121688 6:107147015-107147037 CAGGCAGGAGCCACCCCGCCTGG - Intergenic
1013667879 6:112366713-112366735 CATCCAGGAGCAGCCCAGCCAGG - Intergenic
1014234033 6:118935209-118935231 GAGCCAGGAGGGTCCCGGGCGGG + Intergenic
1016213073 6:141563707-141563729 CAGCCATGAGCTGCTCAGCCTGG + Intergenic
1016461534 6:144284861-144284883 CAGCCCGCAGCAGCCCGGCTCGG - Intergenic
1017324780 6:153131667-153131689 CACCCAGGAGCCGGCCTGCCAGG + Intergenic
1017376439 6:153775308-153775330 CAGACAGGAGCTGCCATGCCAGG - Intergenic
1017816085 6:158017690-158017712 CAGCCATGAGCCGCCGTGCCTGG + Intronic
1018038947 6:159904809-159904831 AAGGCAGGAACGGCCCGGCAAGG - Intergenic
1018253973 6:161899843-161899865 CAGGCAAGAGCCGCCTGGCCCGG - Intronic
1018580202 6:165301810-165301832 CATCCAGGAGGGCCCCGTCCAGG + Exonic
1018686444 6:166307861-166307883 CAGCCACGTGCGCCCCGCCCCGG - Exonic
1018740627 6:166725812-166725834 CCGCCAGGAGCCTCCCTGCCCGG - Intronic
1019175913 6:170159487-170159509 CAGCCTGGAGCGGACGGGGCAGG - Intergenic
1019183456 6:170207465-170207487 CATCCAGGAGCTGCTAGGCCAGG - Intergenic
1019354835 7:573026-573048 CAGACAGGTGCGGCGGGGCCCGG - Intronic
1019442077 7:1052555-1052577 CTGCCAGGGACGGCCTGGCCTGG + Intronic
1019472004 7:1226035-1226057 CAAACAGAACCGGCCCGGCCCGG - Intergenic
1019546737 7:1581144-1581166 CAGCCAGGAGCCCCCAGACCTGG - Intergenic
1019586859 7:1809788-1809810 CAGCCAGGCGCACCCCGGCCGGG - Intergenic
1019724483 7:2593570-2593592 AAGCCCTGACCGGCCCGGCCCGG + Intronic
1019759664 7:2801092-2801114 CAGGCAGATGCGGCCCAGCCTGG + Intronic
1020042906 7:5017641-5017663 CAGCCAGGAGCCTCCCCGCAGGG - Intronic
1020238454 7:6374440-6374462 CGGGCGGGAGCGGCCCCGCCCGG + Intergenic
1021678350 7:23104643-23104665 CAGGAATGAGCGGCCAGGCCTGG - Intergenic
1022375381 7:29806907-29806929 CGGCCCGGCCCGGCCCGGCCGGG - Intronic
1022375385 7:29806912-29806934 CCGCCCGGCCCGGCCCGGCCCGG - Intronic
1022706885 7:32810259-32810281 CAGCCAGCAGCGCCCCTGCCTGG + Intergenic
1024772759 7:52743770-52743792 CTGCCAGGAGCAGCCAGGGCAGG + Intergenic
1026510169 7:71020922-71020944 CAGCCGTGAGCCACCCGGCCTGG - Intergenic
1026724423 7:72859481-72859503 CAGCCAGGAGCCTCCCTGCAGGG - Intergenic
1028417470 7:90595954-90595976 CGGCCGGGAGGGGCGCGGCCGGG + Intronic
1029075065 7:97928435-97928457 GAGCCAGGAGCGGCCCGCAGAGG - Intergenic
1029398268 7:100324255-100324277 CAGCCAGGAGCCTCCCCGCAGGG + Intergenic
1029473454 7:100768744-100768766 CAGGCAGGAGGGGCTGGGCCTGG + Intronic
1032087435 7:128891374-128891396 AGGCCAGGAGAGGCCCGCCCAGG - Intronic
1033146211 7:138872222-138872244 CAGGCAGGAGCCACCGGGCCCGG + Intronic
1033757180 7:144404666-144404688 CAGCCAGGGGCGGCCCTGCCAGG + Exonic
1034440046 7:151081711-151081733 CAGCCCGGAGGGGCCGGGCTCGG + Exonic
1034447984 7:151123099-151123121 CCCCCAGGAGCAGCCGGGCCGGG - Intronic
1034748524 7:153545601-153545623 TAGCCAGCAGCTGCCCAGCCAGG - Intergenic
1035203490 7:157280561-157280583 CAGCTGGGTGAGGCCCGGCCGGG + Intergenic
1035685305 8:1519828-1519850 AAGCCATGGGCGGCCCTGCCGGG - Intronic
1035900918 8:3457522-3457544 AAGCCAGGAACGGCCAGGCGTGG - Intronic
1036242464 8:7091944-7091966 GAGCCAGGAGCGGCCCGCGGAGG + Intergenic
1036359151 8:8065439-8065461 GAGCCAGGAGCGGCCCGCGTAGG + Intergenic
1036830275 8:12015187-12015209 GAGCCAGGAGCGGCCCGCGGAGG - Intronic
1036891807 8:12601513-12601535 GAGCCAGGAGCGGCCCGCGTAGG - Intergenic
1036899352 8:12659486-12659508 GAGCCAGGAGCGGCCCGCGGAGG - Intergenic
1036964080 8:13276701-13276723 GACCCAGGAGCAGCCCGGCGCGG - Intronic
1037803845 8:22048970-22048992 CAGGGAGGGGCCGCCCGGCCTGG - Intergenic
1039475583 8:37837819-37837841 GAGCCAGGAGGGGCCCGGGGAGG + Exonic
1039502912 8:38031073-38031095 GATCCAGGAGAGGCCTGGCCTGG + Intronic
1039590380 8:38741434-38741456 CAGGCAGGAGCCGCCGCGCCTGG + Intronic
1039936520 8:42051441-42051463 CGGGGAGAAGCGGCCCGGCCCGG + Intronic
1039989671 8:42476882-42476904 TAGCCAGGAGCTGGCCGGACGGG - Intronic
1040480886 8:47825300-47825322 TAGCCAGGATCCGCCCGCCCCGG - Intronic
1041358142 8:57022250-57022272 CAGCCAGGAGCCCCTCTGCCCGG + Intergenic
1041675104 8:60530434-60530456 CAGCCAGGAGCAGCCAGGCATGG - Intronic
1042547804 8:69966374-69966396 CAGGCATGAGCCACCCGGCCCGG - Intergenic
1042696032 8:71556405-71556427 CAGCCACGAGCGTCCCGGGCGGG + Intronic
1043570179 8:81594349-81594371 CAGCCTTGAGCAGCCCAGCCTGG + Intergenic
1043854163 8:85245672-85245694 CAGGCGGGAGCGCCCCGGACCGG + Exonic
1043871585 8:85438951-85438973 CAGGCAGCCGCGACCCGGCCAGG + Intronic
1047526850 8:125641283-125641305 CAGCCAGGAAGTGGCCGGCCAGG + Intergenic
1049090621 8:140511341-140511363 AGGCCGGGAGCGGCCCGTCCGGG - Exonic
1049355002 8:142183216-142183238 CAGCCAGGAGCTGCCTGACGTGG - Intergenic
1049624038 8:143612168-143612190 CAGAGAGGAGGGGCCAGGCCAGG + Intergenic
1049718501 8:144104813-144104835 CAGCCAGACCCGGCCCGGCGCGG + Exonic
1050498398 9:6268212-6268234 GTGGCAGGAGGGGCCCGGCCAGG + Intergenic
1051592770 9:18793392-18793414 CAGCCTGGAGAGACCCGGCAAGG + Intronic
1056020027 9:82431336-82431358 CAGTGAGGAGCGCCCCTGCCCGG - Intergenic
1056395497 9:86177415-86177437 CAGCCAAGAGCAGCCCATCCAGG - Intergenic
1058424194 9:104862633-104862655 CGGCCCGGCCCGGCCCGGCCCGG - Intronic
1058424197 9:104862638-104862660 CGGCCCGGCCCGGCCCGGCCCGG - Intronic
1058424200 9:104862643-104862665 CGGCCCGGCCCGGCCCGGCCCGG - Intronic
1058424203 9:104862648-104862670 CGGCCCGGCCCGGCCCGGCCCGG - Intronic
1058424206 9:104862653-104862675 CGGCCCGGCCCGGCCCGGCCCGG - Intronic
1058424209 9:104862658-104862680 CGGCCCGGCCCGGCCCGGCCCGG - Intronic
1058424212 9:104862663-104862685 CGGCCCGGCCCGGCCCGGCCCGG - Intronic
1058424215 9:104862668-104862690 CGGCCCGGCCCGGCCCGGCCCGG - Intronic
1058424218 9:104862673-104862695 CGGCCCGGCCCGGCCCGGCCCGG - Intronic
1058424221 9:104862678-104862700 CGGCCCGGCCCGGCCCGGCCCGG - Intronic
1059118120 9:111617510-111617532 AAGCCAGGAGCGTCTCCGCCCGG - Intergenic
1059251272 9:112889952-112889974 CAGCCAGGAGCTCCCCGCCGTGG - Exonic
1060514430 9:124257266-124257288 CAGCCAGGAGCGGCCGCTCTCGG + Intergenic
1060853544 9:126897070-126897092 CAGCCAGGTGTGGCCGGGCACGG - Intergenic
1061077959 9:128353228-128353250 CAGCCAGGTGCGGCCAGGTTGGG + Exonic
1061144153 9:128787398-128787420 TGGCCAGGAGTGGCCCAGCCGGG - Intronic
1061407597 9:130401050-130401072 CAGCCAGGAGAGGCAGTGCCAGG - Intronic
1062580575 9:137227598-137227620 CAGCCAGGAGCTGCCCACCAAGG + Exonic
1185473084 X:396814-396836 CAGGCAGGAGCCATCCGGCCCGG - Intergenic
1187665907 X:21609210-21609232 CTGCCAGGAGCGGCGCTGACTGG - Exonic
1190082179 X:47365233-47365255 CAGCCAGGCGCGGCCAGGCGCGG - Intergenic
1190273846 X:48887562-48887584 CAGGCAAGAGCAGCCTGGCCTGG - Intergenic
1190312082 X:49123736-49123758 CAGCAAGCAGCGCGCCGGCCTGG - Exonic
1192436847 X:71148412-71148434 TTGCCAGGAGGGGCCTGGCCCGG + Intronic
1192469723 X:71387519-71387541 CAGCCATGAGCCGCCATGCCCGG - Intronic
1195936066 X:110126794-110126816 CACACAGGAGTGGCCCAGCCAGG - Intronic
1196296212 X:114000314-114000336 CAGGCATGAGCGACCCCGCCCGG - Intergenic
1196442225 X:115727976-115727998 AGGCCAGGCCCGGCCCGGCCCGG - Intergenic
1196443332 X:115732928-115732950 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196443337 X:115732938-115732960 CGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196444185 X:115736999-115737021 CGGCCCGGCCCGGCCCGGCCCGG - Intergenic
1196444190 X:115737009-115737031 AGGCCAGGCCCGGCCCGGCCCGG - Intergenic
1196445653 X:115844843-115844865 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196445658 X:115844853-115844875 CGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196445661 X:115844858-115844880 CGGCCCGGCCCGGCCCGGCCAGG + Intergenic
1196446324 X:115847824-115847846 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196446329 X:115847834-115847856 CGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196446332 X:115847839-115847861 CGGCCCGGCCCGGCCCGGCCAGG + Intergenic
1196446995 X:115850805-115850827 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196447000 X:115850815-115850837 CGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196447003 X:115850820-115850842 CGGCCCGGCCCGGCCCGGCCAGG + Intergenic
1196447664 X:115853788-115853810 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196447669 X:115853798-115853820 CGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196447672 X:115853803-115853825 CGGCCCGGCCCGGCCCGGCCAGG + Intergenic
1196448334 X:115856767-115856789 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196448339 X:115856777-115856799 CGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196448342 X:115856782-115856804 CGGCCCGGCCCGGCCCGGCCAGG + Intergenic
1196449003 X:115859758-115859780 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196449008 X:115859768-115859790 CGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196449011 X:115859773-115859795 CGGCCCGGCCCGGCCCGGCCAGG + Intergenic
1196449674 X:115862749-115862771 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196449679 X:115862759-115862781 CGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196449682 X:115862764-115862786 CGGCCCGGCCCGGCCCGGCCAGG + Intergenic
1196450343 X:115865732-115865754 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196450348 X:115865742-115865764 CGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196450351 X:115865747-115865769 CGGCCCGGCCCGGCCCGGCCAGG + Intergenic
1196451013 X:115868717-115868739 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196451018 X:115868727-115868749 CGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196451021 X:115868732-115868754 CGGCCCGGCCCGGCCCGGCCAGG + Intergenic
1196451684 X:115871696-115871718 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196451689 X:115871706-115871728 CGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196451692 X:115871711-115871733 CGGCCCGGCCCGGCCCGGCCAGG + Intergenic
1196452355 X:115874683-115874705 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196452360 X:115874693-115874715 CGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196452363 X:115874698-115874720 CGGCCCGGCCCGGCCCGGCCAGG + Intergenic
1196453025 X:115877652-115877674 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196453030 X:115877662-115877684 CGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196453033 X:115877667-115877689 CGGCCCGGCCCGGCCCGGCCAGG + Intergenic
1196453695 X:115880645-115880667 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196453700 X:115880655-115880677 CGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196453703 X:115880660-115880682 CGGCCCGGCCCGGCCCGGCCAGG + Intergenic
1196454364 X:115883654-115883676 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196454369 X:115883664-115883686 CGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196454372 X:115883669-115883691 CGGCCCGGCCCGGCCCGGCCAGG + Intergenic
1196455444 X:115888726-115888748 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1198270518 X:135052054-135052076 CGGGCCGGAGGGGCCCGGCCAGG + Exonic
1199946303 X:152670848-152670870 CAGCCATGAGCTGGCCAGCCAGG - Intergenic
1199976606 X:152898138-152898160 CGGCCCGGCCCGGCCCGGCCGGG + Intergenic
1200069551 X:153521225-153521247 CAGCCAGGCGCTGCTTGGCCTGG - Intronic
1200144837 X:153921190-153921212 CTGCCCAGAGCGGCCCCGCCAGG + Intronic
1201579060 Y:15492306-15492328 AAGCCAGGAGCGGCCTGGGAGGG - Intergenic