ID: 1138360800

View in Genome Browser
Species Human (GRCh38)
Location 16:56425578-56425600
Sequence CGCTGGCGGGACGGGCGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 336}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138360787_1138360800 -5 Left 1138360787 16:56425560-56425582 CCGCCGCCCCCAGCGGGACGCTG 0: 1
1: 0
2: 1
3: 21
4: 273
Right 1138360800 16:56425578-56425600 CGCTGGCGGGACGGGCGCAGGGG 0: 1
1: 0
2: 3
3: 24
4: 336
1138360784_1138360800 16 Left 1138360784 16:56425539-56425561 CCTGGGCGGGCTCGGGACAGGCC 0: 1
1: 0
2: 0
3: 22
4: 252
Right 1138360800 16:56425578-56425600 CGCTGGCGGGACGGGCGCAGGGG 0: 1
1: 0
2: 3
3: 24
4: 336
1138360778_1138360800 30 Left 1138360778 16:56425525-56425547 CCGGCGCGGAAGAGCCTGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1138360800 16:56425578-56425600 CGCTGGCGGGACGGGCGCAGGGG 0: 1
1: 0
2: 3
3: 24
4: 336
1138360789_1138360800 -8 Left 1138360789 16:56425563-56425585 CCGCCCCCAGCGGGACGCTGGCG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1138360800 16:56425578-56425600 CGCTGGCGGGACGGGCGCAGGGG 0: 1
1: 0
2: 3
3: 24
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138360800 Original CRISPR CGCTGGCGGGACGGGCGCAG GGG Intergenic
900276145 1:1830025-1830047 AGATGGCGGGCCGGGCGCAGTGG - Intronic
900393592 1:2444137-2444159 TGTGGGCGGGACGGGCGGAGCGG + Intronic
900717066 1:4152087-4152109 GGCTGGGGGGCCGGGCGCAGTGG - Intergenic
902318961 1:15646192-15646214 GGCTGGCGGGAAGGCCGCAGAGG - Intronic
903971486 1:27121833-27121855 CAGTGGAGGGCCGGGCGCAGTGG + Intronic
904004863 1:27358388-27358410 GGGTGGCGGGATGGGCACAGTGG - Intronic
904065194 1:27744412-27744434 AGCTGCCGGGCCGGGCGCGGTGG - Intronic
904598437 1:31661065-31661087 CACTGGCCGGCCTGGCGCAGAGG - Exonic
905180000 1:36159810-36159832 CGTTGGTGAGACTGGCGCAGTGG + Intronic
905746280 1:40421453-40421475 CGGTGGCGGGGCGGGGGCGGGGG - Intronic
905810790 1:40911689-40911711 CGGTGGCCGGGCGGGCGCAGTGG + Intergenic
908258355 1:62320220-62320242 CTCTGGTGGGCCGGGCGCCGTGG - Intergenic
910221357 1:84892718-84892740 GGCTGGCGGGCTGGGCGCAGAGG - Intronic
911333210 1:96549506-96549528 TGCTGTGGGGCCGGGCGCAGTGG - Intergenic
912489286 1:110052851-110052873 CACTAGGGGGCCGGGCGCAGTGG - Intronic
912955027 1:114149355-114149377 GGCTGGGGGGAGGGGAGCAGAGG + Intronic
914261688 1:146004313-146004335 CTCTGACTGGCCGGGCGCAGTGG - Intergenic
914779930 1:150776121-150776143 CGGGCGCGGGCCGGGCGCAGTGG - Intergenic
914824758 1:151132769-151132791 CGCGGGCCGGGCGGGGGCAGAGG + Exonic
915908817 1:159899752-159899774 CACTGGTGGGCCGGGCGCGGTGG - Intronic
917974614 1:180230704-180230726 GGCTGGCGGCCGGGGCGCAGAGG + Intronic
918983688 1:191596196-191596218 CTCTGGCCGGGCGGGGGCAGTGG - Intergenic
920076060 1:203337689-203337711 CGGTGGCTGGCCGGGCGCGGTGG - Intergenic
920249475 1:204613849-204613871 GGCTGGCGGGAAGGCTGCAGTGG + Intergenic
920719850 1:208376883-208376905 GGGTGGGGGGCCGGGCGCAGTGG - Intergenic
921266047 1:213421398-213421420 CATTGGAGGGCCGGGCGCAGTGG - Intergenic
1063137573 10:3230496-3230518 CGCTGGAGGTGCAGGCGCAGAGG + Intergenic
1063746198 10:8885057-8885079 AGCTGGAGGGCCGGGTGCAGTGG + Intergenic
1064022861 10:11823557-11823579 CGCCGGCGGGTCGGGCAGAGAGG + Intronic
1064100258 10:12457498-12457520 AGCTGGGCGGCCGGGCGCAGTGG + Intronic
1065582630 10:27187012-27187034 AGCTGGAAGGCCGGGCGCAGTGG + Intergenic
1066464420 10:35640385-35640407 CGGTGGCGCGCCGGGCGCGGGGG - Exonic
1067037929 10:42933161-42933183 GGCAGGAGGGACGAGCGCAGCGG - Intergenic
1070302038 10:75210738-75210760 CGCTGCAGGGACAGGCGCGGCGG + Intronic
1070670750 10:78375659-78375681 CGCTGGAGGGACGGGAGCAGGGG + Intergenic
1074529796 10:114289284-114289306 CACAGGCGGGAGAGGCGCAGAGG + Exonic
1075782183 10:125024217-125024239 CCCTGTCGGGAAGGGGGCAGGGG - Intronic
1076545917 10:131245756-131245778 AGTTGGCGGGAGGGGTGCAGTGG + Intronic
1076866271 10:133167883-133167905 GGCAGGCGGGACTGGCTCAGGGG - Intronic
1077034677 11:488875-488897 CCCTGGCCGGCCTGGCGCAGGGG + Intronic
1077298908 11:1838313-1838335 GGCAGGCGGGAGGGGCCCAGAGG + Intergenic
1079130571 11:17744703-17744725 TGCTGTGGGGAAGGGCGCAGGGG + Intronic
1079213889 11:18488836-18488858 TGATGGGGGGCCGGGCGCAGTGG + Intronic
1081870677 11:46381399-46381421 CGCGGGCGGGACGGGGCCCGGGG + Intronic
1081990705 11:47336000-47336022 CGCTGGGGGGACCTGGGCAGAGG + Exonic
1082046808 11:47736267-47736289 ATTTGGCGGGCCGGGCGCAGTGG + Intronic
1083678941 11:64342529-64342551 CGCTGTCGGGACAGGCCAAGCGG + Exonic
1084127437 11:67109223-67109245 AGCTAGGGGGCCGGGCGCAGTGG + Intergenic
1084374697 11:68768360-68768382 TGCTGGCAGGCCGGGCACAGTGG - Intronic
1085022280 11:73217361-73217383 CGCTGGCTGGACAAGTGCAGAGG - Intergenic
1086127297 11:83361785-83361807 AGCTGTCGGGCCGGGCACAGTGG - Intergenic
1088823752 11:113476742-113476764 CTCTGGAGGCACGGGAGCAGAGG + Intergenic
1088858043 11:113773714-113773736 GGCCGGCGGGACGGGAGCTGCGG - Exonic
1091614754 12:2041561-2041583 CCTTAGCGGGCCGGGCGCAGTGG - Intronic
1095583312 12:43824646-43824668 CCCTGTAGGGCCGGGCGCAGTGG + Intergenic
1095778315 12:46033116-46033138 TGCTGCCGGGCCGGGCGCGGTGG - Intergenic
1097267545 12:57755038-57755060 GGCGGGCGGGGCGGGCGCCGGGG - Intronic
1098982860 12:76976727-76976749 CTCTTGTGGGCCGGGCGCAGTGG - Intergenic
1100047646 12:90403064-90403086 CACTGGAGGGCCGGGCGCGGTGG + Intergenic
1100721977 12:97368935-97368957 TGCTGGAGGGACAGGGGCAGAGG - Intergenic
1102288802 12:111682232-111682254 AGCTGGCTGGCCGGGTGCAGTGG + Intronic
1102339212 12:112108600-112108622 CGCGGGCCGGGCAGGCGCAGGGG - Intronic
1104010037 12:124923892-124923914 GGCGGGCGGGAGGGGGGCAGGGG - Intergenic
1104440952 12:128792537-128792559 GGCTGGCGGGACAGACGGAGCGG + Intergenic
1104602879 12:130164693-130164715 GGCTGGAGGGAAGGGCACAGGGG + Exonic
1104707114 12:130955681-130955703 CTCTGGTGGGGCGGGGGCAGAGG - Intronic
1104938282 12:132379025-132379047 ACATGGCGGGCCGGGCGCAGTGG + Intergenic
1105725701 13:23160287-23160309 CGCTCGGGGGCCGGGCGCAGTGG + Intergenic
1106234039 13:27846380-27846402 CACTGAGGGGCCGGGCGCAGTGG + Intergenic
1109724158 13:66317008-66317030 AGCTAGCGGGCCGGGCACAGTGG - Intronic
1110705975 13:78602263-78602285 CGCGGGCGGCGCGGGCGCGGCGG - Exonic
1113647000 13:112005159-112005181 CAGTGGCAGGACCGGCGCAGAGG + Intergenic
1114272185 14:21107581-21107603 GGCTGGCGGGACAGTGGCAGTGG + Intergenic
1114483321 14:23048286-23048308 CGCGGGAGGGCCGGGCGCCGGGG + Exonic
1114632336 14:24167106-24167128 CTCTGGCCGGCTGGGCGCAGTGG + Exonic
1119129210 14:72156158-72156180 TGCTGGCTGGCTGGGCGCAGTGG + Intronic
1119249458 14:73138994-73139016 GGCTGGGTGGCCGGGCGCAGCGG + Intronic
1120099131 14:80424219-80424241 CCCAGGCAGGCCGGGCGCAGTGG - Intergenic
1120834444 14:89027398-89027420 CGCTGGCGGGTCCCGCGCCGCGG - Intergenic
1120881307 14:89417034-89417056 CGCGGGCGGCAGGGGCGCGGGGG + Intronic
1121402219 14:93689774-93689796 CTCTGGTGGGCCGGGCGCGGTGG - Intronic
1122311169 14:100795843-100795865 CCCTGGCTGGCCGGGCGCGGTGG + Intergenic
1122664260 14:103317795-103317817 CAATAGTGGGACGGGCGCAGTGG + Intergenic
1122784828 14:104158784-104158806 CCCTGCCGGGAAGGGCCCAGTGG - Intronic
1123630737 15:22258194-22258216 CGCGGGCCGGGCGGGCGCCGGGG - Intergenic
1124005019 15:25788440-25788462 AGCGGGTGGGACGGGAGCAGAGG - Intronic
1125568405 15:40695186-40695208 CGCTGGCGGACCGCGCGCAGCGG + Exonic
1125579086 15:40773245-40773267 CCCTGGCAGGCTGGGCGCAGTGG - Intronic
1125937437 15:43649011-43649033 CGCTGGCGCGTCTGGCCCAGGGG - Intronic
1126109406 15:45166929-45166951 GGCTGGCGGGACGGGCCGCGGGG - Intergenic
1128582229 15:68818345-68818367 CGCGGCGGGGAGGGGCGCAGGGG + Intronic
1128936383 15:71749842-71749864 CGTTGGCGGGAGGGGGGCAGGGG - Intronic
1128949498 15:71861844-71861866 GGCTGGAGGGGCGGGCGCAGTGG + Intronic
1129697535 15:77749193-77749215 GGCTGGGGGGCCGGGCGCAGTGG - Intronic
1131215199 15:90530243-90530265 CGCGGGCGGGACCCGCGCGGCGG + Intronic
1131609954 15:93950288-93950310 CCCTGGTGAGCCGGGCGCAGTGG + Intergenic
1132609353 16:807555-807577 CGCTGGCGGGACGGCCACAGGGG - Exonic
1132718674 16:1305153-1305175 CTCTGGAGGGCCGGGCGCAGTGG - Intergenic
1132780112 16:1619466-1619488 CGCTGTTGTGCCGGGCGCAGTGG - Intronic
1132907033 16:2287990-2288012 CGGGGGCGGGACGGGGGCATCGG - Intronic
1133048679 16:3104091-3104113 AGCTGGGTGGCCGGGCGCAGTGG + Intergenic
1133234436 16:4381370-4381392 AGCAGGCGGGGCAGGCGCAGCGG - Exonic
1133936227 16:10271672-10271694 CACTGACTGGCCGGGCGCAGTGG - Intergenic
1134086832 16:11363064-11363086 GACTGGCTGGCCGGGCGCAGTGG - Intronic
1135875770 16:26198723-26198745 TGCTGGTGAGCCGGGCGCAGTGG + Intergenic
1138360800 16:56425578-56425600 CGCTGGCGGGACGGGCGCAGGGG + Intergenic
1139826624 16:69762400-69762422 CGCTGGCGCGGGGGGCGCGGTGG + Intronic
1140072354 16:71662142-71662164 CGGGTGCGGGCCGGGCGCAGTGG + Intronic
1140734787 16:77888682-77888704 CGCTGGCGGTACGGGAGTAGAGG - Intronic
1141972308 16:87492379-87492401 CGCGGGCCGGGCGGGCGCCGGGG + Intergenic
1142357561 16:89609484-89609506 GCCTGGCTGGCCGGGCGCAGTGG + Intergenic
1142360210 16:89622496-89622518 CGCACTCGGGCCGGGCGCAGTGG + Intronic
1142377850 16:89716035-89716057 CGCTGTCAGGCCAGGCGCAGTGG + Intronic
1142727392 17:1826203-1826225 CACTGGGGGGCCGGGCGCAGTGG + Intronic
1142874656 17:2844305-2844327 CGCTGGCCGGCCGGGCGCAGTGG - Intronic
1142875585 17:2850285-2850307 AGCAGGCGGGCCAGGCGCAGTGG - Intronic
1144834877 17:18151538-18151560 GGCTGGCGGGCTGGGGGCAGGGG - Intronic
1145188766 17:20820293-20820315 TGCTGGCAGGCAGGGCGCAGTGG + Intergenic
1145370816 17:22304804-22304826 GGCTGCGGGGACTGGCGCAGCGG - Intergenic
1145963774 17:28902770-28902792 AGCTGGCGGGGCGCGCGGAGAGG - Intronic
1146084886 17:29818533-29818555 CCTTGGCGGGCTGGGCGCAGTGG - Intronic
1146167423 17:30600815-30600837 GGCGGGCGGGACGGGGACAGGGG - Intergenic
1146256126 17:31392204-31392226 CGCTCGGGGCACGGGCGCCGGGG - Intronic
1146398695 17:32487398-32487420 CGCGGGGCGGAGGGGCGCAGGGG + Intronic
1146827542 17:36036228-36036250 CGATGGCTGGTTGGGCGCAGTGG - Intergenic
1147189251 17:38729499-38729521 AGGGGGCGGGACGGGAGCAGGGG - Exonic
1147360591 17:39927380-39927402 GGCTGGAGAGACGGGGGCAGAGG - Intronic
1147944154 17:44070837-44070859 CGCTGGCGGGGCGGGGCCTGGGG + Exonic
1148156890 17:45429818-45429840 CGCGGGCCGCACGGGCGCCGCGG + Intronic
1148178392 17:45586231-45586253 AGCGGGCAGGACGGCCGCAGCGG - Intergenic
1148270769 17:46260236-46260258 AGCGGGCAGGACGGCCGCAGCGG + Intergenic
1148437419 17:47694687-47694709 CGCCAGCGGGGTGGGCGCAGAGG + Intronic
1148843200 17:50512339-50512361 TGCTGGGGGGCCGGGCGCGGTGG - Intronic
1148851783 17:50559127-50559149 CGGTGGCGGGAGGTGCGCGGGGG + Intergenic
1149249828 17:54755242-54755264 CTCTGGCGGGCCGGGCACCGTGG - Intergenic
1149679303 17:58494025-58494047 CACTGTTGGGCCGGGCGCAGTGG + Intronic
1150388594 17:64778592-64778614 CGCGGGCCGCACGGGCGCCGTGG + Intergenic
1150533773 17:66014047-66014069 CGCTGGCAGCAATGGCGCAGTGG + Intronic
1151516712 17:74601176-74601198 CGGTGGCTGGCCGGGCGCGGTGG + Intergenic
1151853055 17:76702560-76702582 CTCTTGAGGGCCGGGCGCAGTGG + Intronic
1152319423 17:79599853-79599875 CGATGGCGGGCAGGGGGCAGGGG + Intergenic
1152550958 17:81029960-81029982 CACTGGCAGACCGGGCGCAGTGG - Intergenic
1152808760 17:82371483-82371505 CACGGGCGTGAGGGGCGCAGGGG + Intergenic
1155007252 18:21740708-21740730 CGATGGAGGGGCGGGCCCAGGGG - Intronic
1158953790 18:62522329-62522351 CGCGGCCGGGAGGTGCGCAGCGG - Intergenic
1159471887 18:68867645-68867667 GGCTAGCTGGCCGGGCGCAGTGG + Intronic
1160243033 18:77136555-77136577 CCCTGGAGGGAGGGGCTCAGAGG + Intergenic
1160696946 19:489415-489437 CGAGGGCGGGTCGGGCGTAGAGG - Intronic
1160698547 19:495844-495866 TGCAGGCGGGCCGGGCGCGGTGG + Intronic
1160788703 19:913059-913081 CGCGGGCGGGCGGGGCGCGGCGG - Intronic
1160972579 19:1776029-1776051 CGCTGGCAGGACGGCCCCTGCGG + Exonic
1161107806 19:2453331-2453353 GGCTGGCAGGATGGGGGCAGGGG - Intronic
1161126665 19:2561588-2561610 CACTGGTTGGCCGGGCGCAGTGG + Intronic
1161180556 19:2878381-2878403 AGCAGGAGGGCCGGGCGCAGTGG + Exonic
1161181157 19:2883476-2883498 TGATAGCGGGCCGGGCGCAGTGG + Intergenic
1161204104 19:3031615-3031637 AGCTGGCTGGCCGGGTGCAGTGG - Intronic
1161833704 19:6629973-6629995 AACTGCCGGGCCGGGCGCAGTGG - Intergenic
1162114279 19:8419071-8419093 CTCTGCCGGGCCGGGTGCAGTGG + Intronic
1162566889 19:11449407-11449429 CTCTAGCTGGATGGGCGCAGAGG + Exonic
1163314970 19:16535539-16535561 GGCCGGCGGGATGGGCGCGGCGG + Exonic
1163503234 19:17688240-17688262 CTCTGTCGGGTCGGGCTCAGCGG + Intronic
1163558828 19:18007316-18007338 CTGTGGCGGGACGGGGGCTGAGG + Intronic
1163594302 19:18211871-18211893 CACTGGCGGTACAGGGGCAGCGG + Exonic
1165506542 19:36234682-36234704 TGCTGGCTGGCCGGGCGCAGTGG - Intronic
1165599566 19:37042282-37042304 CCCTGGAGGGCCAGGCGCAGTGG - Intronic
1166014641 19:39970978-39971000 CGAGGGCGGGACGGGAGCTGTGG - Intergenic
1166097939 19:40553190-40553212 CGTTGGCTGGCCGGGCACAGTGG + Intronic
1166222634 19:41375563-41375585 GGCTCACGGGCCGGGCGCAGTGG - Intronic
1166707181 19:44914557-44914579 CGCTCACGGGACAGGGGCAGAGG + Intronic
1166852841 19:45768673-45768695 CGGGGCCGGGGCGGGCGCAGCGG - Exonic
1167449190 19:49557025-49557047 CGCGGGCTGGGCGGGCCCAGGGG - Intronic
1167961778 19:53111628-53111650 CATAGGCGGGCCGGGCGCAGTGG - Intronic
1168259823 19:55187056-55187078 AGGTGGGGGGCCGGGCGCAGTGG + Intronic
1168307314 19:55442647-55442669 CGCGGGCGGGGCGGGCGCGGCGG - Exonic
1168596397 19:57681456-57681478 GTCGGGCGGGCCGGGCGCAGTGG - Intergenic
925134410 2:1516333-1516355 CCCTGGGGGGACGGGGGCACGGG - Intronic
927764824 2:25797157-25797179 GGCGGGCTGGATGGGCGCAGTGG + Intronic
928576868 2:32663968-32663990 TAGTGGGGGGACGGGCGCAGTGG - Intronic
929498543 2:42469129-42469151 GGATGGCAGGCCGGGCGCAGTGG + Intronic
931348865 2:61470916-61470938 CGCAGGCCGGAGGGGCGCCGAGG + Intergenic
931517801 2:63059856-63059878 CGCTGCCGGGCCGGGGGCGGCGG + Intergenic
931681215 2:64751197-64751219 CGCGAGCGGGGCGGGGGCAGTGG + Intergenic
932636278 2:73391059-73391081 CACTGTTGGGCCGGGCGCAGTGG - Intronic
933737794 2:85509252-85509274 TGGTGGCTGGCCGGGCGCAGTGG + Intergenic
934107494 2:88709041-88709063 AGCTGGCTGGCCGGGCGCGGTGG - Intronic
934557836 2:95296811-95296833 GGCAGGCGGGACTGGGGCAGTGG + Intergenic
934650505 2:96088903-96088925 AGCTGGCAGGACGGTGGCAGTGG + Intergenic
935444687 2:103143788-103143810 TGCTGCCGGGCGGGGCGCAGTGG + Intergenic
936962253 2:118088436-118088458 CGTTGGCCGCACAGGCGCAGTGG + Intronic
937100533 2:119264798-119264820 CCCTGGCGGGGGGGGGGCAGGGG - Exonic
937103456 2:119289398-119289420 CGCAGGGTGGCCGGGCGCAGTGG + Intergenic
939580105 2:143937335-143937357 CGCTGGCCGCTCAGGCGCAGCGG + Intergenic
942282159 2:174376508-174376530 GGCTGGAGGGCCGGGCGCGGTGG + Intronic
943366686 2:186973291-186973313 CCCTTGAGGGCCGGGCGCAGTGG - Intergenic
944064260 2:195602429-195602451 GGCTGGCAGGTCAGGCGCAGTGG - Intronic
944606761 2:201358702-201358724 AGCTGGGCGGCCGGGCGCAGTGG - Intergenic
944612411 2:201424892-201424914 AGGTGGCAGGCCGGGCGCAGTGG - Intronic
946311440 2:218884327-218884349 AGCTGGGGGGACGGGTGGAGGGG + Intronic
946855222 2:223944616-223944638 CCCGGGCTGGAGGGGCGCAGTGG + Intronic
946855241 2:223944680-223944702 CCCGGGATGGACGGGCGCAGTGG + Intronic
947501147 2:230672127-230672149 CAGTGGCGGGCCGGGCGCGGTGG + Intergenic
947523357 2:230864841-230864863 CGCAGGCGCGGCGGGCGCCGGGG + Intronic
947575147 2:231267516-231267538 TGCTGCCGGGCCGGGTGCAGTGG - Intronic
948046078 2:234946371-234946393 AGCTGGGGGGCCGGGCGCCGTGG - Intergenic
948560586 2:238848774-238848796 GGCGGGCGGCAGGGGCGCAGGGG + Intronic
949066813 2:241995987-241996009 GGCTGGTGGGCTGGGCGCAGTGG - Intergenic
1168801502 20:646243-646265 CTCTGGGGGGCCGGGGGCAGTGG + Intergenic
1170622506 20:18007653-18007675 GGCTGGGGGGATGGGCTCAGTGG + Intronic
1171122600 20:22579484-22579506 TGGTGGCGGGAGGGGGGCAGTGG + Intergenic
1173548129 20:43914739-43914761 CGCGGGCGGGGCGGGGGCGGGGG + Intergenic
1173966484 20:47116463-47116485 GGATGGTGGGCCGGGCGCAGTGG - Intronic
1174204306 20:48827945-48827967 CGCCGGCGGGCCGGGCTCAGCGG + Intergenic
1175148050 20:56911512-56911534 AGCTGGCTGGCCGGGCGCGGTGG - Intergenic
1175760424 20:61559029-61559051 CACTGCTGGGCCGGGCGCAGTGG + Intronic
1176052507 20:63127638-63127660 CTCTGGAGGGAGGGACGCAGAGG - Intergenic
1176099292 20:63357653-63357675 CCCTGGTGGGACGGGCAGAGTGG + Intronic
1176238025 20:64063273-64063295 GGCGGGCGCGACGGGCGCGGGGG + Exonic
1176284503 21:5012369-5012391 TGCTGGAGGGACAGGGGCAGGGG + Intergenic
1179872678 21:44251106-44251128 TGCTGGAGGGACAGGGGCAGGGG - Intronic
1179993226 21:44959459-44959481 TGCTGGGGGGACAGGGGCAGGGG - Intronic
1179998655 21:44985302-44985324 CTCTGGCAGGTGGGGCGCAGGGG + Intergenic
1180626113 22:17194503-17194525 CGCTGCCTGGGCAGGCGCAGTGG + Intronic
1180866280 22:19121879-19121901 CGCTCCCGGGAAGGGCCCAGAGG + Intronic
1180965326 22:19785105-19785127 GGATGGTGGGCCGGGCGCAGTGG + Exonic
1182829926 22:33296854-33296876 AACTGGCGGGCTGGGCGCAGTGG - Intronic
1183031702 22:35111258-35111280 GGCTGGTGGGAAGGGAGCAGTGG + Intergenic
1183092414 22:35531831-35531853 AGCTGGGGAGACGGGGGCAGAGG - Intergenic
1183982498 22:41549868-41549890 CACAAGCGGGCCGGGCGCAGTGG + Intergenic
1184017682 22:41798590-41798612 AGCTTGGGGGCCGGGCGCAGTGG + Intronic
1184129882 22:42511528-42511550 CACTGGCGTGATGGGTGCAGAGG - Exonic
1184269230 22:43369219-43369241 AGCTTGGGGGTCGGGCGCAGTGG - Intergenic
1185317406 22:50185088-50185110 CCCGGGCAGGACGGGCGCGGCGG + Intergenic
1185338278 22:50280437-50280459 CACGGGCGGGGCGGCCGCAGGGG - Intronic
1185363967 22:50426899-50426921 AGCTGGCCGGCCGGGCGCAGTGG + Intronic
950730069 3:14948539-14948561 CCCTGGCGGGGCGGGAGTAGAGG + Intronic
951560780 3:23964362-23964384 CACTGCCTGGCCGGGCGCAGTGG - Intronic
951887401 3:27537735-27537757 CCCTGGTGGGCCAGGCGCAGTGG - Intergenic
954147129 3:48640052-48640074 CGCTGGGGAGACAGGGGCAGAGG + Exonic
954717568 3:52534012-52534034 CGCCGGCGTGACGGCCGAAGGGG - Intronic
955263639 3:57420620-57420642 TGCTTGTGGGCCGGGCGCAGTGG + Intronic
956896661 3:73667655-73667677 CTCTGACGGGCCGGGTGCAGTGG - Intergenic
958741624 3:98080412-98080434 TACTGGCAGGACAGGCGCAGTGG - Intergenic
960882212 3:122356431-122356453 CAGTGGCTGGCCGGGCGCAGTGG - Intergenic
962791896 3:138819059-138819081 CACTACCGGGCCGGGCGCAGTGG + Intronic
963888892 3:150611772-150611794 GGCTGAGGGGCCGGGCGCAGGGG - Intronic
964630192 3:158801968-158801990 CGCTGGGAGGACGGACCCAGCGG - Exonic
965612069 3:170554879-170554901 TGCTTGTGGGACGGGCGCGGTGG + Intronic
967206823 3:187131188-187131210 CTCTGGAGGGCCGGGCACAGTGG + Intronic
967864077 3:194175901-194175923 TGCTGACGGGCCGGGCGCGGGGG + Intergenic
968361213 3:198148160-198148182 CCCTGGCAGGGAGGGCGCAGGGG + Intergenic
968551036 4:1223472-1223494 CGCTGGCGGGACAAGGACAGCGG + Intronic
968618739 4:1594060-1594082 CGCTGCAGGGAGGGGCGCCGCGG + Intergenic
968700988 4:2058419-2058441 CGCGGGCGGGACGGGGCCAGGGG - Intergenic
970202858 4:13627455-13627477 CGCGGGCGGGGCGGGCGGCGCGG - Exonic
972997346 4:44897246-44897268 TGATTGCGGGCCGGGCGCAGTGG + Intergenic
978680646 4:111377592-111377614 CACTGTTGGGCCGGGCGCAGTGG + Intergenic
979621811 4:122806505-122806527 AGCAGGGGGGCCGGGCGCAGTGG + Intergenic
980119134 4:128709645-128709667 AACTGGAGGGCCGGGCGCAGTGG + Intergenic
982000275 4:151015589-151015611 TGCTGGCGCTACGGGCGCCGCGG + Intronic
982172847 4:152678528-152678550 CGGTGGGGGGAGGGGGGCAGTGG + Intronic
982608444 4:157542449-157542471 CACTGGGGGGCTGGGCGCAGTGG - Intergenic
983276876 4:165628467-165628489 GGCTGGTTGGCCGGGCGCAGTGG - Intergenic
987044187 5:14091049-14091071 CAGTGGCAGGCCGGGCGCAGTGG + Intergenic
987088216 5:14488294-14488316 AGCTGGCGGGACAGAGGCAGGGG - Intronic
988796285 5:34656284-34656306 GGCCGGCGGGGCGGGGGCAGCGG - Intronic
989011373 5:36876567-36876589 CCCTGAGGGGACGGGCGTAGAGG + Intergenic
991975315 5:72179136-72179158 GGGTGGCGGGGCGGGGGCAGTGG - Intronic
992105635 5:73447580-73447602 CGCGGGCGGGAAGAGCGCGGCGG + Exonic
992894284 5:81233266-81233288 CCCTGGCGGGGCGGGGCCAGAGG - Intronic
992939746 5:81750773-81750795 CGCTGGGCGGGCGGCCGCAGGGG - Intronic
993905710 5:93621236-93621258 CGCAGGCGGGAGGGGCGGGGAGG - Intronic
995894853 5:117000956-117000978 CACTGCTGGGCCGGGCGCAGTGG - Intergenic
998266741 5:140672663-140672685 AGCGGGCAGGACGGCCGCAGCGG + Exonic
1000318968 5:160118948-160118970 CGCCGGCGGCACGAGCGCCGGGG + Exonic
1001241075 5:170070174-170070196 AGCTGGCGGGAGGTGAGCAGTGG + Intronic
1002612749 5:180432170-180432192 CGCTGGCGGGAGGCGCGAACAGG + Intergenic
1002662850 5:180803071-180803093 CGCTGGAGGGCCGAGGGCAGGGG - Intronic
1002691329 5:181052874-181052896 CGCAGGCGGGAGGGTCCCAGGGG - Intronic
1002771337 6:292663-292685 CGCGGTGGGGACGGGCGCGGAGG + Intronic
1002921113 6:1574194-1574216 GGCTGGCGTGAGGGGCGCTGAGG - Intergenic
1003644670 6:7904878-7904900 CTCTGGAGGGATGGGAGCAGGGG - Intronic
1003787748 6:9505999-9506021 TTCTGGCTGGGCGGGCGCAGTGG - Intergenic
1004076347 6:12347344-12347366 CCCAGGCAGGCCGGGCGCAGTGG - Intergenic
1004405719 6:15331576-15331598 CGGTGGGGGGCCGGGTGCAGTGG + Intronic
1005666552 6:28063365-28063387 AGCTCCCGGGCCGGGCGCAGTGG + Intergenic
1005871096 6:29974918-29974940 GGCAGGAGGGACGGGAGCAGGGG + Intergenic
1006725381 6:36196457-36196479 CGGTGGCGGTGCGGGCGCGGCGG - Intergenic
1006796228 6:36734175-36734197 AGCTGGAGGGCCGGGCGCGGTGG - Intergenic
1006927467 6:37665104-37665126 CCCTGGCTGGATGGGCCCAGTGG + Intronic
1007392024 6:41554963-41554985 TGATGGTGGGATGGGCGCAGTGG + Intronic
1011254912 6:85410193-85410215 CGCTGTGGGGCTGGGCGCAGTGG - Intergenic
1011495297 6:87931402-87931424 CTCTTGTGGGCCGGGCGCAGTGG - Intergenic
1012184517 6:96196424-96196446 CAAAGGAGGGACGGGCGCAGTGG + Intronic
1012467190 6:99529242-99529264 CGGTGTCAGGCCGGGCGCAGTGG + Intergenic
1012993447 6:105949138-105949160 CACTGCAGGGCCGGGCGCAGTGG + Intergenic
1013225715 6:108118403-108118425 CGCCGGCGAGGCAGGCGCAGCGG - Intronic
1015244682 6:131063007-131063029 CGGTGGCGGGACGGTCCCACCGG - Intronic
1016386757 6:143537070-143537092 CGCCGGCGGGGCGGGCGCCTCGG - Intronic
1017617584 6:156261500-156261522 GCCTGGCCGGCCGGGCGCAGTGG + Intergenic
1017725638 6:157274579-157274601 CGTGGGCGGGACGGGCTCCGTGG + Intergenic
1018393396 6:163358237-163358259 AGCTGTCTGGCCGGGCGCAGTGG - Intergenic
1018613282 6:165662842-165662864 CGCGGGCGGGAGGGGCGCGGCGG + Intronic
1018631607 6:165826911-165826933 CGCAGGCGGGATGAGCCCAGGGG + Intronic
1018892290 6:167990606-167990628 CGGGGGCGAGCCGGGCGCAGCGG - Intergenic
1019135978 6:169907924-169907946 GGCTGGGGAGACGGGAGCAGGGG + Intergenic
1019368899 7:650569-650591 CAATGGCGGGACGTGTGCAGGGG - Intronic
1019539802 7:1546523-1546545 AGCTGGAGGGAGGGGCGCCGGGG - Exonic
1019640469 7:2100865-2100887 TCCTGTCGGGAGGGGCGCAGGGG + Intronic
1019713146 7:2526464-2526486 GGCTGCCGAGAGGGGCGCAGTGG + Intronic
1020137512 7:5595034-5595056 CGCTGGAGGGAGGGGCGTGGGGG + Intronic
1020254278 7:6493706-6493728 CACTGGCCGGCCTGGCGCAGTGG + Intergenic
1020274366 7:6615684-6615706 CGGGGGCGGGGCGGGCGCCGCGG - Exonic
1021514142 7:21464381-21464403 CCCTGACTGGCCGGGCGCAGTGG - Intronic
1023881938 7:44325671-44325693 GGCGGGCGGGGCGGGCGCGGCGG - Intronic
1026073364 7:67142717-67142739 CACTGGCTGGCCAGGCGCAGTGG - Intronic
1026703521 7:72669476-72669498 CACTGGCTGGCCAGGCGCAGTGG + Intronic
1027125493 7:75554030-75554052 CTCTGTTGGGCCGGGCGCAGTGG - Intronic
1029019079 7:97345524-97345546 CGCTGTGGGGCCGGGCGCAGTGG + Intergenic
1033212677 7:139471771-139471793 AGCTGGCAGGACAGGCCCAGTGG + Intronic
1036488376 8:9200479-9200501 CACTGGTGGGCCGGGTGCAGTGG - Intergenic
1037807150 8:22064743-22064765 CTCTGGCAGGCCGGGCGCGGTGG - Intronic
1038187461 8:25288171-25288193 CACGGGCTGGCCGGGCGCAGTGG - Intronic
1039541591 8:38376722-38376744 AGCTGCCTGGCCGGGCGCAGTGG - Intronic
1041021356 8:53642341-53642363 CCCTAGCGGGAGGGGCTCAGCGG - Intergenic
1041281034 8:56211410-56211432 CGCGCGGGGGGCGGGCGCAGCGG - Intergenic
1042582128 8:70291810-70291832 AGTTGGCCGGGCGGGCGCAGTGG + Intronic
1042856919 8:73277092-73277114 GACTGCCGGGATGGGCGCAGTGG - Intergenic
1043147174 8:76673487-76673509 GGCTGGCGGGGCGGGGGGAGCGG + Intergenic
1044772082 8:95646811-95646833 CCCTGGTGGGCCGGGTGCAGTGG - Intergenic
1047735048 8:127757801-127757823 CACTGGGGGGCCTGGCGCAGTGG - Intergenic
1048300066 8:133244965-133244987 CGCTGACGGCAAGGGAGCAGGGG + Intronic
1049214172 8:141400178-141400200 CAGTGGTGGGCCGGGCGCAGTGG - Intronic
1049521550 8:143094042-143094064 AGCTGGCTGGCCGGGTGCAGTGG - Intergenic
1049572647 8:143376443-143376465 AGCTGGCAGGACGGCTGCAGTGG + Intronic
1050360670 9:4827897-4827919 TGATGGCCGGCCGGGCGCAGTGG + Intronic
1053391021 9:37736286-37736308 CTCTGGTGGGCCGGGCGCGGTGG - Intronic
1056648047 9:88432164-88432186 GGGGGGCGGGACGGGCACAGGGG - Intronic
1056799540 9:89681489-89681511 CGGTGGCGGGGCGGGGGCAGCGG - Intergenic
1059061420 9:111038312-111038334 CCCCGGCGGGGTGGGCGCAGGGG - Intronic
1060485763 9:124045402-124045424 CGCGGAGGGGAGGGGCGCAGGGG + Intergenic
1061373140 9:130209139-130209161 CGCAGCGGGGATGGGCGCAGCGG - Intronic
1061540784 9:131277106-131277128 CACTGACGGGGCGGGCGCGGGGG - Intergenic
1062363644 9:136198874-136198896 CGCGGGCGGGAGGGAAGCAGGGG + Intronic
1062400648 9:136371266-136371288 CGCTGGCGGGGAGCGGGCAGTGG - Intronic
1062532802 9:137009220-137009242 GGCTGGGGGGACTGGGGCAGTGG - Intronic
1062644410 9:137540069-137540091 TGCTGCCGGGCCGGGCGCAGTGG - Intronic
1203774530 EBV:65371-65393 CTCTGGCGGTGCGGGCACAGCGG + Intergenic
1203776707 EBV:77313-77335 CGTTGGCGGGACTGGCACGGTGG + Intergenic
1203790024 EBV:146280-146302 CGCTGGAGGCACGGGGGCAAAGG - Intergenic
1185479178 X:433488-433510 AGCTGTTGGGCCGGGCGCAGTGG - Intergenic
1185675933 X:1849544-1849566 CTCTGGTGGGCCGGGCGCGGTGG - Intergenic
1186587721 X:10894055-10894077 CTCTGAGGGGCCGGGCGCAGTGG - Intergenic
1188915943 X:35911085-35911107 CTCTGACTGGCCGGGCGCAGTGG + Intergenic
1189776162 X:44471663-44471685 TGCTGTCTGGCCGGGCGCAGTGG + Intergenic
1190226533 X:48550272-48550294 TGCTGGCAGGCCGGGCGCAGTGG - Intronic
1191252157 X:58264891-58264913 CCCTGGAGGGCCGGGCGCAGGGG - Intergenic
1195922040 X:109993675-109993697 AGCTGGCAGGCTGGGCGCAGTGG + Intergenic
1196436606 X:115680474-115680496 TGCAGGCGGGCCGGGCGCGGTGG + Intergenic
1197627910 X:128823739-128823761 TGCTTCCGGGCCGGGCGCAGCGG + Intergenic
1197691028 X:129501581-129501603 GTTTGGCGGGCCGGGCGCAGTGG - Intronic
1199736842 X:150693477-150693499 CGCCGTCGGGACGGGAGCGGCGG - Exonic
1199760824 X:150902682-150902704 GGCTGGGGGGAGGGGCGCATGGG + Intergenic
1200073727 X:153541224-153541246 CGCTGGCCAGACGGCCCCAGAGG + Intronic
1200481124 Y:3704023-3704045 GGCTCTCGGGCCGGGCGCAGTGG - Intergenic