ID: 1138361295

View in Genome Browser
Species Human (GRCh38)
Location 16:56430598-56430620
Sequence CAGTATTAGAAGAGGGTATA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138361295 Original CRISPR CAGTATTAGAAGAGGGTATA AGG (reversed) Exonic
901540353 1:9911103-9911125 CTGTATTTGGAGAGGGTACAGGG + Intergenic
906001458 1:42429804-42429826 CAGTAATGGATGAGGCTATAGGG + Intergenic
906578323 1:46911359-46911381 CAGTATGAGAAGAGGGTTAGGGG - Intergenic
908458967 1:64330704-64330726 CAGTATTTGAAGTGGGGATGGGG + Intergenic
908882959 1:68753818-68753840 GAGTATTAGTAGAGGGTCTTAGG - Intergenic
915850490 1:159316613-159316635 CAGGAGTAGATGTGGGTATAAGG - Intergenic
917174153 1:172213338-172213360 CATTGTTAGAAGAGGGCACAAGG + Intronic
919249712 1:195037568-195037590 CAGTATAAGTAGTGGGTGTATGG + Intergenic
922628840 1:227083117-227083139 CAATATTTGAAGAGTGTTTATGG - Intronic
923149780 1:231222452-231222474 CATTTTTACAAGAGGGAATAGGG + Intergenic
923675195 1:236074818-236074840 CAATATTACAAGAAGGTATTAGG + Intergenic
923904665 1:238370548-238370570 CAGTATGGGAAGAGAGTAGAGGG - Intergenic
1063287151 10:4702506-4702528 CAGTACTAGAAGATTGTATGGGG + Intergenic
1065086540 10:22184367-22184389 CAGTGTTAGAAGTGGCAATAAGG + Intergenic
1066590383 10:36988117-36988139 CTGTATTAGAAGATGCTGTATGG - Intergenic
1066756135 10:38714732-38714754 GAGTATTAGAAGAGAGAATGGGG - Intergenic
1071320232 10:84448014-84448036 TAGTATGAGAAAAGGGTACACGG - Intronic
1074565417 10:114573129-114573151 CAGTATGGGCAGAGGATATAGGG - Intronic
1078167343 11:8899922-8899944 CAGCATGAGAAGGGGGGATATGG + Intronic
1083016353 11:59458097-59458119 CAGGAGAAGAAGAGGGTATAAGG + Intergenic
1092000895 12:5031276-5031298 CAGGATGAGAAGAGGGGAAAAGG + Intergenic
1092773588 12:11921108-11921130 TAGTTTTTGATGAGGGTATAAGG + Intergenic
1095100860 12:38182430-38182452 AAGTATTAGAACAGGTTATCTGG - Intergenic
1097539696 12:60924543-60924565 CATTATTAGAACTGGGAATATGG + Intergenic
1099238340 12:80109908-80109930 AAGTATTATAAGAGTGTGTAAGG - Intergenic
1099719613 12:86343560-86343582 CAGTATTAGAAATGGATTTATGG + Intronic
1101044777 12:100793827-100793849 CAATATTAGAATAGGGGAAAAGG + Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106744960 13:32692342-32692364 CAGTAGTAGAAGATGGTATCGGG + Intronic
1106961399 13:35002511-35002533 AACTATTAGAAGAGGGGACATGG - Intronic
1108290942 13:48960142-48960164 CAGCCTTAGAAGAGGGTACCTGG + Intergenic
1108769891 13:53687180-53687202 CAGTATTGGAAGATAGGATATGG - Intergenic
1110125339 13:71935214-71935236 CATTAAGGGAAGAGGGTATAAGG + Intergenic
1110967495 13:81718373-81718395 CAGTATTAAAAAAGTGTAGAAGG - Intergenic
1113299240 13:108998624-108998646 AAGTATTTGAACAGGGCATACGG + Intronic
1115250863 14:31345787-31345809 CAGTATGAGAAGTGTGTATGGGG + Intronic
1116225100 14:42140326-42140348 CACTGTTAGAAGAGGGAACAGGG - Intergenic
1116289274 14:43011357-43011379 TAGGATTAAAAGAGGTTATAAGG - Intergenic
1116381372 14:44273223-44273245 CAGTATTAACAGAGGGACTAAGG - Intergenic
1118011950 14:61618557-61618579 CAGTTTCAGAAGAGGCTAGAAGG - Intronic
1118931848 14:70249995-70250017 AGGTATAAGAAGAGAGTATAAGG - Intergenic
1119194746 14:72709098-72709120 TAGTATCAGAATAGGGTCTAGGG - Intronic
1120300968 14:82706114-82706136 CAGTCTTAAAATAGGGTATTAGG + Intergenic
1120728271 14:87971231-87971253 CAGGATCAGCAGATGGTATATGG + Intronic
1120885573 14:89449345-89449367 AAATATAAGAAGAGGATATAAGG - Intronic
1122699506 14:103578292-103578314 CAGTACTAGAAGAACGGATAAGG + Intronic
1125069466 15:35534446-35534468 CTGTATTTTAAGAGGATATAGGG + Intronic
1125384607 15:39124042-39124064 CAGAAGTAGAAGTGGGAATAAGG + Intergenic
1128010402 15:64289775-64289797 CACTTTTAGATGAGGTTATACGG - Intronic
1131956486 15:97741300-97741322 CAGTATTAGAAGAAGCAATGGGG + Intergenic
1133128052 16:3659058-3659080 CAGTATTAGAAAATGCTGTAAGG + Exonic
1138361295 16:56430598-56430620 CAGTATTAGAAGAGGGTATAAGG - Exonic
1138618225 16:58189423-58189445 TAGAATTAGAAGAGGGTTTTTGG - Intronic
1143756868 17:9073693-9073715 CAGTTTTTGAAGAGAGAATATGG + Intronic
1143771955 17:9174625-9174647 CCTTATTAGAAGAGGGCATCGGG - Intronic
1144775450 17:17782657-17782679 AAGCATTAGAAGAAGGGATAGGG + Intronic
1147732298 17:42611458-42611480 CACTGTTAGATAAGGGTATATGG + Intronic
1149010840 17:51854670-51854692 CTCTCCTAGAAGAGGGTATATGG + Intronic
1151029465 17:70719405-70719427 CAGTTTGAGAAAAGGCTATATGG + Intergenic
1157213102 18:45760452-45760474 CAGTCCTAGATGTGGGTATAGGG - Intergenic
1159985800 18:74839815-74839837 AAGGAATAGAAGAGGGAATAGGG + Intronic
1162877688 19:13632865-13632887 CAGGAACAGAAGAGGGTAGAAGG + Intergenic
1166235810 19:41455431-41455453 CAATTTTAAAAGAGGCTATATGG - Intergenic
928356026 2:30615327-30615349 CAGTAGTAGGAGAGTATATAGGG + Intronic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
932452616 2:71823861-71823883 CAGTATTAGTAGTGGGTGTGAGG + Intergenic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
932905888 2:75750843-75750865 TAGGATTAGATGAGGTTATAAGG + Intergenic
935458046 2:103293327-103293349 CCGTTTAAGAAGAGGGTTTAAGG - Intergenic
937021980 2:118665527-118665549 CAGTATGTGAGGAGGGTTTAGGG - Intergenic
939142634 2:138373865-138373887 CAGAAGTAGAAGAGAGTAGAAGG - Intergenic
939330250 2:140750188-140750210 CAGTATTAGATGAGGCATTAGGG - Intronic
939616831 2:144371005-144371027 CAGAATTAGAAGTGGAAATAAGG + Intergenic
941112913 2:161436476-161436498 CAGAATTAAAATATGGTATATGG - Intronic
941991457 2:171561242-171561264 CAGAATTAGAAGAAGGAAAAAGG - Intergenic
943879716 2:193125927-193125949 TAGTCTTATAAGAGGTTATAGGG + Intergenic
944308391 2:198203964-198203986 CAGAATGAGAAGGGGGTTTAGGG + Intronic
947355062 2:229283901-229283923 TATTATTAGAGGATGGTATAAGG - Intergenic
948549727 2:238762615-238762637 CAGTATTATATCAGGGTAAATGG + Intergenic
1168917973 20:1506856-1506878 AAGTATCAGAAGAGAGTATGTGG + Intergenic
1169527331 20:6443768-6443790 AAGTATTAGAACAGGTTATCTGG - Intergenic
1169731446 20:8789561-8789583 CAGTATATCAAGAGGGTATGTGG + Exonic
1170380243 20:15751569-15751591 CATTCTTAGAAGAGGATAAAAGG - Intronic
1174250936 20:49219175-49219197 CAGTATTTGAGGAGGGTGGAAGG - Intergenic
1174681439 20:52412555-52412577 CAGGATTAGATGAGGTTATCAGG + Intergenic
1177168175 21:17626428-17626450 CAGAATTAGAAGGGGGTAGATGG + Intergenic
1179488686 21:41726955-41726977 CAGGAGTAGAAGAGGTTAGAAGG + Intergenic
1180679183 22:17612551-17612573 CAGTAGTACATGAGGGTACAGGG - Intronic
1181955822 22:26587264-26587286 CAGTATTAGGAGGGGGTGAAAGG - Intronic
949528277 3:4928003-4928025 CAGTATTAGAAGCAGGTAAAAGG + Intergenic
951926328 3:27912555-27912577 CAGTATTAGAAGATTGTCAAAGG - Intergenic
956258154 3:67306563-67306585 ATGTGGTAGAAGAGGGTATAAGG + Intergenic
957036723 3:75300314-75300336 CAGTATTAGGGGAAGTTATAAGG + Intergenic
957114161 3:76003191-76003213 CAGGATTAAGAGAGGGCATAGGG - Intronic
959546056 3:107598016-107598038 CAGTTTTAGGAGAGGGTACTTGG + Intronic
961080469 3:124022779-124022801 CAGTATTAGGGGAAGTTATAAGG + Intergenic
963664892 3:148170309-148170331 AAGTATAAGAGGAGGGTGTATGG + Intergenic
964159274 3:153627187-153627209 CAAAATTAGAAGAGGAAATAAGG - Intergenic
964968158 3:162524883-162524905 CAGTGTTAGAAGAGGCAATCTGG + Intergenic
968219279 3:196923053-196923075 TAGTATTAGAAAATGGTATAAGG - Intronic
970081990 4:12297962-12297984 CAGTATGAAAAAAGGGTCTAGGG - Intergenic
970244870 4:14050361-14050383 TAGTATTATAAGAGGATAAATGG + Intergenic
972635821 4:40883192-40883214 GTGTATTATAAAAGGGTATAGGG - Intronic
974480024 4:62431260-62431282 TAGTGTTAGAAAAGGCTATAAGG + Intergenic
974666334 4:64967517-64967539 CAGTAATAGCAGAGGGTGAAAGG - Intergenic
974941624 4:68476318-68476340 CAGAAGTAGAAGAGGGTGAATGG + Exonic
975446073 4:74467043-74467065 CAGTATTCGAAGAGAGTTCATGG - Intergenic
976321652 4:83723832-83723854 CAGTTTTAGAACTGGGTGTATGG - Intergenic
979834652 4:125349338-125349360 CAGTATCACATGAGGGTAAATGG + Intronic
981087476 4:140698849-140698871 CAGAATTAGAGGAGGTTATCTGG - Intronic
982093006 4:151896691-151896713 CAGAAGTACAAGAGGGAATAGGG + Intergenic
982983545 4:162173393-162173415 CAGTACGAGATGAGGATATAGGG - Intergenic
983498738 4:168475791-168475813 TAGGATTAGAGGAGGCTATAAGG + Intronic
989429766 5:41339078-41339100 CAGTATTAGAGGAAGGGGTAGGG + Intronic
994562168 5:101388961-101388983 GAGTAATAGAAGAGGACATAGGG - Intergenic
994911169 5:105910179-105910201 CAGTATGTGAATAGGGAATAGGG - Intergenic
996224370 5:120972546-120972568 GAGTAGTAGAAGATAGTATAAGG - Intergenic
1002911816 6:1496650-1496672 CATTATTAGAAGAGGAGATGAGG - Intergenic
1003357824 6:5391143-5391165 CAGTATTAAAAGGGGCAATAGGG - Intronic
1008017611 6:46539608-46539630 GAGTCTTAGAAGAGGGGGTATGG - Intergenic
1010719992 6:79272153-79272175 TAGGATTAGATGAGGTTATAAGG + Intergenic
1011846562 6:91570917-91570939 CAGTATTAGAAAACTGTAAAAGG - Intergenic
1012187181 6:96233395-96233417 CTGGATTAGAAGAAGGTAGATGG - Intergenic
1016355385 6:143212491-143212513 CACTCTTAGAACAGGGTCTAAGG + Intronic
1016686914 6:146892095-146892117 CACTATTAGAAGAGGATTCATGG + Intergenic
1017365134 6:153627232-153627254 CAACATTAGAATAGGGTACAGGG + Intergenic
1017740618 6:157403548-157403570 AAGCATTAGAAAAGGGTTTAGGG + Intronic
1020014905 7:4825184-4825206 CAGTTCTAGAAGAGGGCAGAGGG + Intronic
1020798473 7:12704332-12704354 TATTTTTAAAAGAGGGTATAAGG + Intergenic
1023481345 7:40637982-40638004 AATTTTTAGAAGAGGCTATAGGG + Intronic
1027729468 7:81851909-81851931 CAGTTTTTGCAGAGGATATAAGG - Intergenic
1029788965 7:102822519-102822541 CAGATTTAGAAGAGGTCATAAGG - Intronic
1030695995 7:112586341-112586363 AAGTATTAGAAGAAAATATAGGG - Intergenic
1031466893 7:122124066-122124088 CAGTATAATTAGAGTGTATATGG - Intronic
1032254343 7:130285084-130285106 CAGTTTCAGAAGAGTGGATAAGG + Intronic
1032274327 7:130441057-130441079 CAATCGGAGAAGAGGGTATAGGG - Exonic
1034327086 7:150246404-150246426 CATTAATAGAACAGGGCATAAGG + Intronic
1034864782 7:154631777-154631799 CAGAATTAGAAGAAGTAATAGGG + Intronic
1035692075 8:1566758-1566780 ATGTATTGGAAGAGGTTATATGG - Intronic
1037217598 8:16476665-16476687 CAGAATAAGAAGAGGGAAAAGGG - Intronic
1038253443 8:25927645-25927667 GAGTGTTAGAAGAGGGGACAGGG + Intronic
1039197070 8:35044413-35044435 CAGGATTAGATGAGGTCATAAGG - Intergenic
1040048579 8:42989119-42989141 CAATATTAGAAGAGGGTGGAGGG + Intronic
1041128987 8:54676328-54676350 CAGTAATAGGAGAGGGTAGTAGG + Intergenic
1042702592 8:71632649-71632671 CTTTATTTGAAGAGGGTATGAGG - Intergenic
1043217699 8:77615881-77615903 CAGTATTAGAAAAATGTTTAAGG - Intergenic
1045687681 8:104728437-104728459 CAGTGTTAAATGAGGTTATAAGG - Intronic
1046617643 8:116495080-116495102 CAGTGGGAGAAGAGGGTACAAGG - Intergenic
1048513024 8:135079440-135079462 CAGTAGTATTAGAGGGTAAAGGG + Intergenic
1050132887 9:2430927-2430949 GAGTATGAGAATATGGTATAAGG - Intergenic
1051101194 9:13523907-13523929 TATTATTAGAAGAAAGTATAAGG - Intergenic
1056191689 9:84190541-84190563 CAGTATGAGATGAGGGTGGAAGG - Intergenic
1057530019 9:95836968-95836990 CCCTATTAGAAGAGGATATGAGG - Intergenic
1057595581 9:96413572-96413594 CAGTCTTAGTAGAGGGCACAGGG + Intronic
1060579038 9:124726962-124726984 CAATATTAGAAGAGGGTATAAGG + Intronic
1187996756 X:24935075-24935097 CAGTATAAGAAGAGGAGATTAGG - Intronic