ID: 1138363115

View in Genome Browser
Species Human (GRCh38)
Location 16:56450147-56450169
Sequence GTACCCTGACTGGCATAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138363109_1138363115 24 Left 1138363109 16:56450100-56450122 CCTAAACTGCCTTACGAAAACAT 0: 1
1: 0
2: 0
3: 7
4: 187
Right 1138363115 16:56450147-56450169 GTACCCTGACTGGCATAAACTGG 0: 1
1: 0
2: 0
3: 5
4: 55
1138363112_1138363115 -7 Left 1138363112 16:56450131-56450153 CCAAATCCTTGCACTTGTACCCT 0: 1
1: 0
2: 0
3: 3
4: 162
Right 1138363115 16:56450147-56450169 GTACCCTGACTGGCATAAACTGG 0: 1
1: 0
2: 0
3: 5
4: 55
1138363111_1138363115 -4 Left 1138363111 16:56450128-56450150 CCACCAAATCCTTGCACTTGTAC 0: 1
1: 0
2: 1
3: 19
4: 171
Right 1138363115 16:56450147-56450169 GTACCCTGACTGGCATAAACTGG 0: 1
1: 0
2: 0
3: 5
4: 55
1138363110_1138363115 15 Left 1138363110 16:56450109-56450131 CCTTACGAAAACATCAATACCAC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1138363115 16:56450147-56450169 GTACCCTGACTGGCATAAACTGG 0: 1
1: 0
2: 0
3: 5
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138363115 Original CRISPR GTACCCTGACTGGCATAAAC TGG Intronic
904101621 1:28034462-28034484 GTACCCTGGCTGGTACTAACAGG + Intronic
905242575 1:36590356-36590378 GTACACTGACTGGCCGCAACAGG - Intergenic
909116283 1:71541250-71541272 GCACAGTGACTGGCATATACAGG + Intronic
909447446 1:75764020-75764042 GTACCCTTTCTGATATAAACAGG - Intronic
911795463 1:102070480-102070502 GGACAATGACTGGCATCAACTGG - Intergenic
916475912 1:165168839-165168861 GTACACTGACTGGCAAACACTGG + Intergenic
917758308 1:178126398-178126420 CAATCCTGACTGGCATAATCAGG + Intronic
924388556 1:243524946-243524968 TTACCCTAAATGGCATAAGCTGG - Intronic
1072305114 10:94099917-94099939 AAACCCTCACTGGCATTAACTGG - Intronic
1089215488 11:116832191-116832213 TCACCCTGACTGGCATTAGCTGG + Intronic
1090713422 11:129408722-129408744 GTACCATGAAAGGAATAAACAGG - Intronic
1095242834 12:39881028-39881050 TTACAATGACAGGCATAAACAGG - Intronic
1100072791 12:90741641-90741663 TAACCCTGACTGACCTAAACAGG - Intergenic
1108822699 13:54373113-54373135 GTACCTTGACACGCATAGACTGG + Intergenic
1122534489 14:102452657-102452679 GTGCCCTGACTGCCCTAAACCGG + Intronic
1125021040 15:34987329-34987351 CTAACCTGACTCTCATAAACAGG - Intronic
1138363115 16:56450147-56450169 GTACCCTGACTGGCATAAACTGG + Intronic
1155210010 18:23592608-23592630 AATCCCTGACTGGCAGAAACTGG - Intergenic
1157135658 18:45052092-45052114 GTACAGTGCCTGGCACAAACTGG + Intronic
1162879123 19:13644835-13644857 GTATGCTGATTGGCCTAAACTGG + Intergenic
1166087173 19:40484570-40484592 TTCCCCTGACTCCCATAAACTGG - Intronic
926408658 2:12579620-12579642 AGACCCTGACTGGGATGAACGGG + Intergenic
932527381 2:72485517-72485539 GTACCCTGACTGGGGTGAAATGG - Intronic
935113230 2:100110915-100110937 AAATCCTGACTGACATAAACGGG - Intronic
936691456 2:114894253-114894275 GTAGTCTGACAGGCATAAATTGG - Intronic
939296599 2:140273753-140273775 CTAACCTCAGTGGCATAAACTGG + Intronic
941683171 2:168420857-168420879 TTACCCTGAATGGTCTAAACTGG + Intergenic
943442711 2:187945517-187945539 ATTCCCTGACTGCCTTAAACTGG + Intergenic
945701936 2:213181692-213181714 GTATCTTGACTGGCAGATACAGG - Intergenic
1175125778 20:56750618-56750640 GCACCCTGATTGGCTTAGACAGG + Intergenic
1180879800 22:19195776-19195798 GTAGCCTAACTGGGCTAAACCGG - Intronic
950524656 3:13516788-13516810 GTACCGGTACTGGGATAAACTGG + Intergenic
952685833 3:36147298-36147320 GTACCCACACTGGCATTTACAGG + Intergenic
953776212 3:45819571-45819593 GAACCTGGACTGGCAGAAACTGG + Intergenic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
963563406 3:146896791-146896813 GTGCCCTGAGTGGCAGAATCAGG + Intergenic
972171522 4:36351215-36351237 TCAGGCTGACTGGCATAAACAGG - Intergenic
980185121 4:129451512-129451534 CTATCCTGACTGGCATGAAATGG - Intergenic
980885334 4:138756420-138756442 ATACCCTGACTGCCATAAAAAGG - Intergenic
981350159 4:143720275-143720297 GTGACCTGACTGACATATACTGG + Intergenic
982707275 4:158723755-158723777 GTACAATGCCTGGCATAAACTGG + Intergenic
983113560 4:163783321-163783343 CTATCCTGACTAGCTTAAACAGG + Intronic
983857113 4:172659974-172659996 GTACCCTGACTGATACAGACAGG + Intronic
986641452 5:9875786-9875808 TTACAGTGATTGGCATAAACTGG + Intergenic
994711772 5:103274081-103274103 GTAACCTGACTGGCAGCTACAGG - Intronic
998672756 5:144372379-144372401 GTACAGTGACTGGCATAAATAGG - Intronic
1001500316 5:172227164-172227186 CTACCCAGAATGGCATAAAAAGG + Intronic
1009764020 6:68045049-68045071 TTAAGCTGACTGGCATAAAGAGG + Intergenic
1015104464 6:129519968-129519990 GGACACTGAGTGGGATAAACAGG + Intergenic
1016161881 6:140893203-140893225 GTACCATGACAGGCACAAATAGG + Intergenic
1025109955 7:56205988-56206010 TTACCCTTACTGGGATGAACTGG - Intergenic
1026501793 7:70948940-70948962 GTACCCTGAGTGGGACAGACTGG + Intergenic
1026714346 7:72774190-72774212 CTAGTCTGACTGGCAGAAACAGG - Intronic
1031238356 7:119206612-119206634 ATTCCCTGACTTGCATGAACTGG - Intergenic
1045546836 8:103137138-103137160 GTAGCTTGACTGGCATGAATTGG - Intronic
1046184601 8:110696492-110696514 CTAGCCTGACTGTCAGAAACAGG - Intergenic
1056803972 9:89713623-89713645 GATCCCTGACTTGCAGAAACTGG - Intergenic
1062531016 9:137000327-137000349 GACCCCTGACAGGCAGAAACAGG + Intergenic
1188502694 X:30845842-30845864 ATACAATAACTGGCATAAACAGG + Intronic
1192202418 X:69074998-69075020 GCAGCCTGACTGGCTCAAACTGG + Intergenic
1199439240 X:147849380-147849402 GAACCCTGATTGGCATGAAAGGG - Intergenic