ID: 1138363536

View in Genome Browser
Species Human (GRCh38)
Location 16:56452917-56452939
Sequence ATGTGCTACCCAAAGTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138363533_1138363536 3 Left 1138363533 16:56452891-56452913 CCGACCAGTATTGCTACTCTCAT 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1138363536 16:56452917-56452939 ATGTGCTACCCAAAGTTTGAGGG 0: 1
1: 0
2: 1
3: 9
4: 107
1138363534_1138363536 -1 Left 1138363534 16:56452895-56452917 CCAGTATTGCTACTCTCATTTAA 0: 1
1: 0
2: 0
3: 17
4: 190
Right 1138363536 16:56452917-56452939 ATGTGCTACCCAAAGTTTGAGGG 0: 1
1: 0
2: 1
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138363536 Original CRISPR ATGTGCTACCCAAAGTTTGA GGG Intronic
906462129 1:46042616-46042638 ATGTGCTTCCCCAAGTTTAAAGG - Exonic
912138257 1:106688313-106688335 ATATACTACCAAAAGGTTGAAGG + Intergenic
917087032 1:171314024-171314046 ATGTGCTTCCCATAGCTTTAGGG + Intergenic
918757411 1:188355993-188356015 ATGTGGCACCCAAAGTCTGAAGG + Intergenic
919866829 1:201788806-201788828 ATGTGCCACCCAAGGTTTCTGGG - Intronic
1063874476 10:10458675-10458697 ATGTGATACCTGAAGTTTCATGG - Intergenic
1068148369 10:53099805-53099827 ATGTGATCCCCAATGTTGGAAGG - Intergenic
1083480907 11:62946100-62946122 AGGTGCTAGGAAAAGTTTGAAGG + Intronic
1085209884 11:74766812-74766834 ATGGGTTACCCAAATATTGAAGG + Intronic
1085315178 11:75540439-75540461 ATGTGCCACCCCAAATCTGAAGG - Intergenic
1085404367 11:76253107-76253129 ATGAGCTTCCCACAGTCTGAAGG - Intergenic
1087317879 11:96625522-96625544 TTGTTCTACCCAAATTTTAAAGG + Intergenic
1088544614 11:110947004-110947026 ATGTGCCAGGCAAAGTGTGAGGG - Intergenic
1088574980 11:111262591-111262613 ATGTGTTACCCAAAGTTTCATGG - Intronic
1089214317 11:116826648-116826670 ATTTACTTCCCAAAGTCTGAGGG + Intergenic
1092310068 12:7342821-7342843 ATTTTCTACCCAAAGCTTCATGG + Intergenic
1093353992 12:18140432-18140454 ATTTGCTACCCAAATTATGGTGG + Intronic
1093511247 12:19931281-19931303 ATGTACTACCCAAAGATTTGGGG - Intergenic
1094729324 12:33156810-33156832 ATGTGCTGTCCAATGTTGGAGGG + Intergenic
1096143448 12:49261996-49262018 ATGTGTGACTCAAAGTTTGTGGG - Intronic
1097236197 12:57541573-57541595 ATGACCTAGCCATAGTTTGATGG - Intronic
1097752853 12:63377443-63377465 ATGTGCTATCAAAAGTTTGCAGG + Intergenic
1099139233 12:78950122-78950144 ATGCACTACCAAAAGTCTGAAGG - Intronic
1101606801 12:106252995-106253017 ATGTGTTAGCCAAAATTTAAAGG - Intronic
1104763723 12:131313421-131313443 ATGTGCTCCCCAGGGTTTCATGG + Intergenic
1107563203 13:41576126-41576148 ATGTGTAACTCAAAGTTGGAGGG - Intronic
1110306787 13:73997161-73997183 TTGTGCTACTTAAAGTATGAGGG - Intronic
1111235889 13:85406649-85406671 ATGTGTTACGCAAATCTTGATGG - Intergenic
1119091783 14:71789601-71789623 ATGTGCTATCCAAAGGCTGAGGG - Intergenic
1119934292 14:78576728-78576750 CTGTCCTACCCATAGTTGGAAGG + Intronic
1122390298 14:101375674-101375696 ATGTACTACCCAAAGAAGGATGG + Intergenic
1129757405 15:78106716-78106738 ATGTGTGAGCCAAAATTTGAAGG - Intronic
1129850162 15:78789273-78789295 GTGTGCTTCCCATAGATTGAGGG - Intronic
1130252099 15:82306303-82306325 GTGTGCTTCCCATAGATTGAGGG + Intergenic
1133880192 16:9774322-9774344 ATGTGCTCCCCAAAATCTTAAGG - Intronic
1137539142 16:49350072-49350094 ATGAGCTACCCAAAGTGAAAAGG + Intergenic
1137977986 16:53047033-53047055 ATGGGCAACCCAAAGATGGATGG + Intergenic
1138363536 16:56452917-56452939 ATGTGCTACCCAAAGTTTGAGGG + Intronic
1139406450 16:66722749-66722771 ATGTGCCACGGAAAGTTTGGGGG - Exonic
1147668174 17:42161802-42161824 ATGTGCTTCCCAGAGTTTTAAGG - Intronic
1152167009 17:78715898-78715920 AAGAGCTGACCAAAGTTTGAGGG + Intronic
1156876443 18:42019431-42019453 ATGTGCAACCAAAAGTATTAAGG - Intronic
1157304455 18:46507108-46507130 ATGTGCTGCCCAAACCTTGCAGG - Intronic
1157633599 18:49126701-49126723 ATGTGTTACACACAGTTTTAAGG - Intronic
1164737324 19:30551524-30551546 ATCTGCTGCCCAAAGGCTGAAGG - Intronic
926082031 2:9995010-9995032 GTGTGGTACCCAAAGTGTGTTGG - Intronic
927723221 2:25400670-25400692 ATGTGCTACTCAGTGTTTTAAGG + Intronic
930790508 2:55322301-55322323 ATATGCTACCCAAATGCTGAGGG + Intronic
931774072 2:65524859-65524881 ATGTGCTACCCAAGAGGTGAGGG + Intergenic
933079878 2:77972610-77972632 GTGTGTTAACCAAAATTTGAAGG + Intergenic
933567272 2:83966266-83966288 AAGTTCTAGCCCAAGTTTGAAGG + Intergenic
936042708 2:109161841-109161863 ATGTGATCCCCAATGTTGGACGG - Intronic
936282713 2:111156568-111156590 ATGTTCTCCCAAAAGTCTGAGGG - Intronic
939823799 2:146989416-146989438 ATGACCTACTCAAAGTTTGGAGG - Intergenic
940135491 2:150431143-150431165 ATGTGCTTTCAAATGTTTGATGG + Intergenic
947175718 2:227365236-227365258 ATATGCTACACAAAATTTGAGGG + Intronic
1170586112 20:17735388-17735410 ATGTGCTTGTCAAAGTTTGAAGG + Intronic
1173261567 20:41440984-41441006 AGGTGCTACCTACAGCTTGAAGG - Intronic
1177485795 21:21754500-21754522 ATGTACTATCCAAAGTTCAATGG - Intergenic
1180858931 22:19065795-19065817 ATGAGGTACCCAACATTTGAAGG - Intronic
1182862450 22:33571735-33571757 ATTTAGTACCCAAAGTTTGGTGG + Intronic
952924467 3:38310930-38310952 ATGTGCCACCTGGAGTTTGAGGG - Intronic
956221660 3:66910523-66910545 ATGTGGTCCCCAAAGCATGAGGG - Intergenic
958770378 3:98418897-98418919 AAGTGTTCCCCAAAATTTGAAGG + Intergenic
959940447 3:112075552-112075574 ATCTGCTTCCCACAATTTGAGGG - Intronic
962104569 3:132377270-132377292 ATTTTCTACCAAAACTTTGAAGG + Intergenic
962587342 3:136855486-136855508 CTGTGCTAACCAAAGCTGGATGG - Exonic
964862769 3:161220741-161220763 CTGTGCTGCTCCAAGTTTGAGGG + Intronic
965367583 3:167819708-167819730 ATGTGCTTTTCAAAGCTTGAAGG + Intronic
966108450 3:176365064-176365086 AAGTGCTGCCCAAATTTTCAGGG + Intergenic
967950079 3:194833885-194833907 TTGTGCCACACAAAGTGTGATGG - Intergenic
968258436 3:197299005-197299027 AGGTGTTACCCAAACTCTGACGG + Intronic
969252514 4:5977479-5977501 ATGTGATACAAAAATTTTGATGG + Intronic
971062223 4:22985193-22985215 ATTTCCTAGCCAAAGTTTGAGGG + Intergenic
971297380 4:25408838-25408860 TTTTGCTACACAAAGTATGATGG - Intronic
974510040 4:62827519-62827541 ATGTACTACCAAAATTTTGGTGG + Intergenic
974601931 4:64094561-64094583 ATGTGATATTCTAAGTTTGAAGG - Intergenic
976865285 4:89718166-89718188 AGCAGCTAGCCAAAGTTTGAGGG - Intergenic
983031960 4:162814065-162814087 ATGTGTTCCACAAAGTGTGATGG + Intergenic
986822598 5:11483772-11483794 ATGTGCTCAACAAAGTTTAAAGG + Intronic
987937677 5:24488279-24488301 TTGTGCTTCCCACAGTTTGGGGG + Intronic
990387209 5:55277583-55277605 GGGTGCAACCCTAAGTTTGAGGG + Intronic
992064675 5:73095348-73095370 ATGTGCTGCCCAAAGATTTCAGG - Intergenic
992647357 5:78823936-78823958 ATGTGATCCCCAATGTTGGAGGG + Intronic
993785187 5:92123676-92123698 ATGTGTTTCACAAAGTTTGCTGG + Intergenic
994410865 5:99405566-99405588 ATGTACTACACAAGGTTTTAAGG + Intergenic
994482967 5:100359719-100359741 ATGTACTACACAAGGTTTTAAGG - Intergenic
999773714 5:154794117-154794139 TTTGGCTACCGAAAGTTTGATGG + Exonic
1000684221 5:164226931-164226953 CTGTGCTAGCCACAGTGTGAGGG + Intergenic
1002272138 5:178079663-178079685 ATGTGCTACATAAAATTTGCTGG + Intergenic
1010785499 6:79994949-79994971 ATGTGATACCTAATGTTGGAAGG + Intergenic
1013746184 6:113349374-113349396 TTGGGCTACACAAAGTTTTAAGG - Intergenic
1020454693 7:8358641-8358663 AGGTGCTACTCAAAGTGTGGAGG - Intergenic
1021361211 7:19714809-19714831 ATGTGGTACGGAAAGTTTGAGGG + Intergenic
1024478506 7:49839652-49839674 ATGTGGTACCCATGGTTAGAAGG + Intronic
1027221147 7:76214673-76214695 ATGTGTTTCCCAAGGTGTGAGGG - Intronic
1031906375 7:127464516-127464538 AGGTGACACCCAAAGTCTGATGG + Intergenic
1033215348 7:139489446-139489468 ATGTGTCAACCAAAGATTGAGGG - Intergenic
1033218431 7:139511183-139511205 ATGTGCTAGCCAAGGATAGAAGG - Intergenic
1036198075 8:6739314-6739336 AATTTCTACCCAAAGTTTGTGGG + Intronic
1037264189 8:17039732-17039754 ATTTTCTACCCAAAGATTAAAGG + Intronic
1038252717 8:25920898-25920920 ATGTGCTACCTAAAAGTTGGTGG + Intronic
1040007333 8:42631472-42631494 ATAGGCCACCCAAGGTTTGAGGG + Intergenic
1040949596 8:52924027-52924049 CAGTGATTCCCAAAGTTTGAGGG - Intergenic
1043730688 8:83676226-83676248 ATATGCTAACCTAAGTTTGTAGG - Intergenic
1047394419 8:124481999-124482021 AATTCCTACCCAAAGTTTGTAGG - Intronic
1050197235 9:3099058-3099080 ATGTGATACACAAAGTGTTACGG - Intergenic
1051253047 9:15181495-15181517 AGGTGTTACCCAGAGTCTGATGG + Intronic
1052786441 9:32832393-32832415 ATGTGCCAAGCAGAGTTTGAAGG + Intergenic
1054898609 9:70342509-70342531 TTGTGCCAACCAGAGTTTGAGGG + Intronic
1057547934 9:96031992-96032014 ACGTGCCACCCACAGGTTGAGGG - Intergenic
1061641579 9:131961724-131961746 CTGTGCTACCCTAAGTGGGAAGG - Intronic
1189607797 X:42698442-42698464 ATTTGTTACCCAAGATTTGAGGG - Intergenic
1190961785 X:55257458-55257480 ATGTGCCTCACAAGGTTTGAAGG + Intronic
1194050898 X:89067580-89067602 AAATGCTACCTAAATTTTGATGG + Intergenic
1198805686 X:140491876-140491898 GTTTGCTGGCCAAAGTTTGAGGG + Intergenic
1201777657 Y:17684062-17684084 ATGGGCTACCAAATGTTTGTTGG + Intergenic
1201823901 Y:18221930-18221952 ATGGGCTACCAAATGTTTGTTGG - Intergenic