ID: 1138365707

View in Genome Browser
Species Human (GRCh38)
Location 16:56474937-56474959
Sequence CTGTGGCTGTGAAGGTAAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 393}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138365701_1138365707 16 Left 1138365701 16:56474898-56474920 CCATAGCAAGGCTGAATTTGCCC 0: 1
1: 0
2: 2
3: 7
4: 124
Right 1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG 0: 1
1: 0
2: 2
3: 33
4: 393
1138365702_1138365707 -4 Left 1138365702 16:56474918-56474940 CCCTAGACTTAATTCTGTACTGT 0: 1
1: 0
2: 3
3: 10
4: 247
Right 1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG 0: 1
1: 0
2: 2
3: 33
4: 393
1138365703_1138365707 -5 Left 1138365703 16:56474919-56474941 CCTAGACTTAATTCTGTACTGTG 0: 1
1: 0
2: 2
3: 14
4: 160
Right 1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG 0: 1
1: 0
2: 2
3: 33
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138365707 Original CRISPR CTGTGGCTGTGAAGGTAAGA GGG Exonic
900304898 1:2000947-2000969 CTGTGACAGTGAAGGGAAGGGGG - Intronic
904499391 1:30905413-30905435 CTGTGGTTGGGAAGGCAGGAGGG - Intronic
904563925 1:31415918-31415940 CTTTGGATGGGGAGGTAAGATGG + Intronic
904570547 1:31461061-31461083 CTGTGGATGTGAAGGTAAGGAGG + Intergenic
904896601 1:33822633-33822655 CTCAGGCTGGGAAAGTAAGATGG + Intronic
905743808 1:40395720-40395742 CTTTAGCTGTGTAGATAAGAAGG + Intronic
908116416 1:60944825-60944847 TTCTGGCTGTGAAGGAAAAATGG - Intronic
909482406 1:76140324-76140346 CTGTGCCTCTGAAGGAAGGAAGG + Intronic
911222531 1:95264011-95264033 TTGTTGCAGTGAAGGTGAGATGG + Intergenic
911232811 1:95378563-95378585 ATGGGGCTGTGAAGGTGACAGGG + Intergenic
911799922 1:102122977-102122999 CTGTGGCGGTGAAGAGAGGATGG + Intergenic
912239859 1:107894985-107895007 CTTTGGCAGTGGAGGTGAGAGGG - Intronic
913660683 1:121003882-121003904 CTTTGGATGTGAAGGAAACATGG + Intergenic
914012047 1:143787038-143787060 CTTTGGATGTGAAGGAAACATGG + Intergenic
914165785 1:145174096-145174118 CTTTGGATGTGAAGGAAACATGG - Intergenic
914650677 1:149695698-149695720 CTTTGGATGTGAAGGAAACATGG + Intergenic
915099398 1:153488092-153488114 CAGAGGCTGGGAAGGGAAGAGGG + Intergenic
915205773 1:154269461-154269483 CTGAGGCTGTGAAGGTGAAATGG - Intronic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
915853301 1:159351699-159351721 CTGGGGCTGTGATGGCAAGGAGG - Intergenic
915961304 1:160269147-160269169 CTGCTGCTGTGAATGTAAAATGG - Intergenic
917667519 1:177239700-177239722 CTGTGAATGTGAAGGCAAGTGGG - Intronic
918048660 1:180956051-180956073 CTCTGGCTTTGTAGGAAAGAGGG - Intergenic
921759826 1:218900017-218900039 CTTTGGAGGTAAAGGTAAGAGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923556904 1:235008216-235008238 CTGTTGGTGGGAATGTAAGAAGG + Intergenic
923656070 1:235918186-235918208 AGGTGGCTGTAAAGCTAAGAAGG + Intergenic
924421287 1:243912404-243912426 CTGTCTCTATGAAGGAAAGAAGG + Intergenic
924642393 1:245846640-245846662 CTCTGGCTGTGAGGATTAGAAGG + Intronic
924825201 1:247531560-247531582 CTGTGGCTCTGCAGGCAAGCTGG - Exonic
1062902176 10:1154753-1154775 CTGTGGCTGTGAGGATGGGAGGG - Intergenic
1062902766 10:1158308-1158330 CTGTGGCTGTGCAGGTCACGTGG - Intergenic
1063113935 10:3060093-3060115 CAGTGGCTGGCAAGGAAAGAAGG + Intergenic
1064176506 10:13080006-13080028 CTGTGGATGTAAAGATAAGGAGG + Intronic
1064510755 10:16088204-16088226 CTGTTGGTGGGAAGGTAAAAAGG + Intergenic
1065274154 10:24068273-24068295 CTGAGGGTGTGGAGCTAAGATGG - Intronic
1065997529 10:31072836-31072858 CTGTGGCAGTGAATCCAAGAGGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066487463 10:35860784-35860806 GTGTGTCTGTGAACGTGAGATGG - Intergenic
1066502896 10:36012003-36012025 GTGTGTCTGTGAACGTGAGATGG + Intergenic
1067268349 10:44767133-44767155 CTGTGGCTTTGGAGATAAGAGGG + Intergenic
1068502877 10:57862449-57862471 CTGTTGGTGTGAATGTAAAATGG - Intergenic
1069302583 10:66927027-66927049 CTGTAGGTGTGAAGGCAAAATGG + Exonic
1069754219 10:70763509-70763531 CTGAGGCTGCGATGGAAAGAGGG - Intergenic
1070093264 10:73310616-73310638 CTGTGAGTGGGAATGTAAGAAGG - Intronic
1071699390 10:87914050-87914072 CTGTGCCTGAGAAGATCAGATGG - Intronic
1071968563 10:90878247-90878269 CTGTGCTTGAGCAGGTAAGAGGG - Intronic
1072430744 10:95368797-95368819 GGATGGATGTGAAGGTAAGAGGG - Intronic
1073618864 10:105026266-105026288 CTGTGGCTGTCCAGGGGAGAGGG - Intronic
1073638164 10:105220592-105220614 CAGTGACTTTGAAGGTAAAAGGG + Intronic
1073752483 10:106544489-106544511 CTGTGGCTGTCTGGGTAAGTAGG + Intergenic
1073780191 10:106829379-106829401 CAGCAGCTGTGAATGTAAGAGGG - Intronic
1075784871 10:125042249-125042271 CTGTGGCTGTCATTGGAAGATGG - Intronic
1076050636 10:127330475-127330497 CTGTTGCTGGGAATGTAAAATGG + Intronic
1076076014 10:127534439-127534461 CTGTGGATGGGAAGGGGAGACGG - Intergenic
1076261851 10:129072781-129072803 CTGAAGCTGTGAAGACAAGAAGG + Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1077483198 11:2826238-2826260 CTGTGACTTGGAAGGAAAGAGGG + Intronic
1077804225 11:5573872-5573894 CTGTTGGTGGGAAGGTAAAATGG + Intronic
1077870862 11:6260225-6260247 CTGTGGGGGTGAAGGTGTGAGGG - Intronic
1078049385 11:7948519-7948541 CTGTGGAAGGGAAGGAAAGAAGG - Intergenic
1078177482 11:8981075-8981097 TGGGGGCTGAGAAGGTAAGAAGG - Exonic
1078455624 11:11472290-11472312 CTGGGGCTGGAAGGGTAAGAGGG + Intronic
1078741050 11:14066707-14066729 ATGTGGCTGTAAAGGAAAGGTGG - Intronic
1079378680 11:19917519-19917541 CACTGTCTGTGAGGGTAAGAGGG - Intronic
1079531354 11:21458061-21458083 ATCTGGCTGTGAAGAGAAGAAGG + Intronic
1083057956 11:59841319-59841341 CTGTGTCTGTGAATGACAGAGGG + Exonic
1083420989 11:62553213-62553235 ATGAGGCTGTGAAGGAAGGAGGG + Intronic
1084932060 11:72563985-72564007 CTGTGTGTGTGATGGTAAGCAGG + Intergenic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085187995 11:74592606-74592628 CTGTGGCTGTGATTGAGAGAGGG + Exonic
1086225542 11:84503890-84503912 CAGTGCTTGTGAAGCTAAGAAGG - Intronic
1086516725 11:87622041-87622063 CTGTGTCTCTGCAGGTGAGATGG + Intergenic
1088553521 11:111038429-111038451 CTGTGGCAGTGATGATAAGAAGG - Intergenic
1088835934 11:113577996-113578018 CTGGGGCTGAGAAGGGAAAAGGG + Intergenic
1089200261 11:116720513-116720535 CTGGGACTGCGAAGGTAAGCAGG - Intergenic
1089777967 11:120852231-120852253 CTGCTGCTGAGGAGGTAAGAGGG + Intronic
1090484813 11:127103741-127103763 CTGTTGCTGTGAAGATAACAGGG + Intergenic
1091063581 11:132488013-132488035 CTGTGGCTGCAAAGGTAGGCTGG - Intronic
1093022855 12:14219325-14219347 CGGTGGCTCTGAAAGAAAGAAGG + Intergenic
1093549676 12:20392960-20392982 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
1093776578 12:23082635-23082657 CTGTTGCTGAGAAGTGAAGAAGG + Intergenic
1094074482 12:26457766-26457788 CTGTGGCTGTTCAGTTAACAAGG - Intronic
1098086263 12:66847315-66847337 CTGTGCCTGGGAAAGTAGGAAGG - Intergenic
1101219058 12:102617664-102617686 TTCTTGCTGAGAAGGTAAGATGG - Intergenic
1101272182 12:103159417-103159439 CTGAGGCTATGATGGTAAGTTGG + Intronic
1103284619 12:119790046-119790068 CTGTTGCTTTGAAAGTCAGAAGG - Intronic
1104223442 12:126808650-126808672 CTGTATCTGTGAGGTTAAGATGG + Intergenic
1104564326 12:129866663-129866685 CTGTGGGTGGGAATGTAAGTTGG + Intronic
1104759688 12:131289479-131289501 CTGAGGCTGTGCAGGGAGGAGGG - Intergenic
1104821025 12:131677734-131677756 CTGAGGCTGTGTAGGGAGGAGGG + Intergenic
1104950712 12:132438715-132438737 CTGTGGCTGTGCAGGAAACAGGG - Intergenic
1104967904 12:132517591-132517613 CTGTGCCTGGGAAGGAGAGAAGG + Intronic
1107461836 13:40611730-40611752 CTGTAGCTGTGATGGGAGGAGGG - Intronic
1108044262 13:46368033-46368055 CAGTGGCTATGAAGGCAAGTTGG - Exonic
1108068093 13:46599447-46599469 CTGTGGGTGGGAATGTAAAATGG - Intronic
1108427795 13:50322180-50322202 CTGTTGGTGTGAATGTAAAATGG - Intronic
1108682574 13:52792237-52792259 GGGTTGCTGTGAAGGTTAGATGG + Intergenic
1108757552 13:53522250-53522272 CTGTGGTTGTGAAAGTGAAAGGG + Intergenic
1109751999 13:66706662-66706684 TTGTGACTGAGAAGCTAAGAGGG + Intronic
1111453178 13:88446025-88446047 ATTTGGCTGTGAAGGTGAGAGGG - Intergenic
1111459979 13:88526507-88526529 CTGTACCTGTGAAGATAAGCTGG + Intergenic
1112300738 13:98227517-98227539 CTGTTGGTGAGAATGTAAGATGG + Intronic
1112849552 13:103688177-103688199 CCGTGGCTGGGAAGGCTAGAGGG - Intergenic
1113703832 13:112411596-112411618 CAGAGGCTGGGAAGGTAAAAGGG - Intronic
1113905966 13:113819320-113819342 CTGTGGCTTTGAAGGCCACAGGG - Intergenic
1113930417 13:113965311-113965333 CTGTGGCTCTGAGGGCAAAAGGG + Intergenic
1115653339 14:35419689-35419711 GTGTGGCTGTGCAGGAAGGAGGG + Intergenic
1117660701 14:58001502-58001524 CTGTGGGTGGGAATGTAAAATGG - Exonic
1118778785 14:68992229-68992251 TTGAGGCTGTGAAGGTCAAATGG + Intergenic
1119061393 14:71478708-71478730 CTGTGGCTGGAAAAGTAAAAAGG - Intronic
1119182532 14:72614462-72614484 CAGTAGCTGGGAAGGGAAGAGGG - Intergenic
1119900060 14:78251855-78251877 CTGTGGCTCACAAGGTAAGGGGG + Intronic
1120517351 14:85486571-85486593 CTCTGCCTGTGAAGATAATAAGG + Intergenic
1121594892 14:95154683-95154705 CTCTGGCATTGAAGGTAGGATGG + Intronic
1122743143 14:103883224-103883246 GGGTGGCTGTGAGGGTGAGATGG + Intergenic
1122917148 14:104864621-104864643 CTGTGGGCGTCCAGGTAAGACGG + Intergenic
1124872296 15:33555189-33555211 CTGTGGCTGCAAAGGTTAAAGGG - Intronic
1125796788 15:42409286-42409308 CTGTGGCTGTGGAGGCACAAAGG - Exonic
1126009618 15:44289660-44289682 GTGTGTCTTTGAAGGTAAGGGGG - Intronic
1126284350 15:46994673-46994695 GTGTGTCTTTGAAGGTGAGATGG + Intergenic
1127917397 15:63466601-63466623 CTGTGGAGGTGATGGCAAGAAGG - Intergenic
1128095412 15:64950195-64950217 CCGGGGCTGTGAAGGTCACAGGG - Intronic
1129111646 15:73340533-73340555 GAGGGGCTGTGAAGGAAAGATGG - Intronic
1129761139 15:78130068-78130090 CTTTGGCTGTGAAGGAAAGCAGG - Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130207433 15:81890125-81890147 CGATGGCTGTACAGGTAAGAGGG - Intergenic
1131937515 15:97522860-97522882 CTGTGGCTGGGAAGAAAAGCTGG + Intergenic
1132126825 15:99234885-99234907 CTGTTGCTGTAAATGTAAAATGG + Intronic
1132281186 15:100617357-100617379 CTGCAGCTGGAAAGGTAAGAGGG - Intronic
1132619392 16:857326-857348 CTGTTGCTGGGAGGGTAAAATGG - Intronic
1133660398 16:7910827-7910849 TTGTGGATGTGAAGGCAAAAGGG + Intergenic
1134078793 16:11310716-11310738 CTGCTGCTGTGAACGTAAGTTGG - Intronic
1136417476 16:30112794-30112816 CTGTGGGGGTGAAGGTCAGCGGG + Intronic
1136575993 16:31125728-31125750 CTGTAGCTGAGAAGGGAGGAAGG - Intronic
1136784735 16:32927594-32927616 CTATGGCTGTGTAGGAAAAAGGG - Intergenic
1136885048 16:33926212-33926234 CTATGGCTGTGTAGGAAAAAGGG + Intergenic
1137295291 16:47086682-47086704 CTGAGGGTGAGAATGTAAGATGG + Intronic
1138084174 16:54118736-54118758 CGGAGGCTGGGAAGGGAAGAAGG - Exonic
1138101501 16:54255538-54255560 CTGTGGCTGAGAAGCAAAGGGGG + Intronic
1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG + Exonic
1139599783 16:67979766-67979788 CTGGGGGTGTGAAGGTCAGATGG + Intronic
1140338124 16:74130854-74130876 CTGAGGCTGGGAAGGGTAGAGGG + Intergenic
1141022341 16:80509054-80509076 CAATGTCTGTGAAGGAAAGAAGG + Intergenic
1142357901 16:89612264-89612286 TTGAGGCTGTGAAGGAAAGTGGG - Intergenic
1203087393 16_KI270728v1_random:1191600-1191622 CTATGGCTGTGTAGGAAAAAGGG - Intergenic
1142678493 17:1531036-1531058 CTTTTGCTGTGAAGGAAAGGAGG - Intronic
1143136826 17:4716796-4716818 CTGGGGATGAGAAGGGAAGAAGG - Intronic
1143968355 17:10773728-10773750 CTGAAGGAGTGAAGGTAAGATGG - Intergenic
1144213088 17:13031690-13031712 CAGTGGCCAGGAAGGTAAGATGG + Intergenic
1144397916 17:14863169-14863191 CTGGGCAAGTGAAGGTAAGAAGG + Intergenic
1147145037 17:38479736-38479758 CTATGGCTGTGTAGGAAAAAGGG - Exonic
1149900228 17:60469974-60469996 CTGTTGCTGGGAATGTAAAATGG - Intronic
1150530605 17:65977552-65977574 ATGTGGCAGAGAAGGGAAGATGG + Intronic
1150963551 17:69940876-69940898 CTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1151078071 17:71297052-71297074 CTGTGTCTCTGAAAGTCAGAGGG + Intergenic
1151093847 17:71473408-71473430 CTCTAGCTGAGAACGTAAGAGGG - Intergenic
1151164173 17:72189971-72189993 CTGTGGATGTGAGAGTCAGAGGG - Intergenic
1151737443 17:75953044-75953066 CTGTGGCTATGAATGCAAAAGGG + Intronic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1151915597 17:77115562-77115584 CTGTGGCTGTGAAGGGGTGGAGG + Intronic
1152130145 17:78471693-78471715 GTGTGGCTGTGAAAGCCAGACGG - Intronic
1152531665 17:80922687-80922709 ATGGGGGTGTGAAGGTCAGACGG - Intronic
1152574704 17:81134865-81134887 CTGGGGCTGGGAAGGGAACATGG + Intronic
1152986607 18:327186-327208 GTGTGTGTGTGAATGTAAGATGG + Intronic
1153804231 18:8698092-8698114 CTGTGGATGGGAATGTAAAATGG - Intergenic
1154982056 18:21510786-21510808 CTGTTGGTGGGAAGGTAAAATGG - Intronic
1156956118 18:42965886-42965908 CTGTTTCTGTGAAGGTGAGTAGG - Intronic
1157340245 18:46771754-46771776 CTGCTGCTGTGAAGGTTTGAGGG - Intergenic
1158188659 18:54800688-54800710 TTGGGGCTGGGAAGGTAAGCAGG - Intronic
1158613384 18:58963394-58963416 CAGTGGCAGTGAAGGAAAGTGGG + Intronic
1158667350 18:59444450-59444472 CTGTTGGTGTGAATGTAAAATGG - Intronic
1159784689 18:72698814-72698836 CTGTGACTCTGGAGGCAAGAAGG + Intergenic
1160433950 18:78831967-78831989 CAGTGGCTGAGAAGGGAAGGAGG - Intergenic
1161220458 19:3115864-3115886 CTGAGGCTGTGAGGGGAGGAGGG + Intronic
1161686264 19:5704162-5704184 CTGTGGCTGTGAAGGAGGAAGGG + Intronic
1163314384 19:16532255-16532277 CCGTGGCTGAGAAGGCAACAAGG + Intronic
1163375051 19:16924996-16925018 CTGTGGCTGTTAGGATGAGATGG - Intronic
1163448356 19:17360827-17360849 CTGCGACTGTGAAAGAAAGATGG + Exonic
1163709120 19:18835100-18835122 CAGGGGCTGTGGAGGTAGGACGG - Intronic
1164195310 19:22951772-22951794 CTGTGTCTTTGCATGTAAGATGG - Intergenic
1164420750 19:28089886-28089908 CTGTGTCTCTGCAGGTGAGATGG - Intergenic
1164971108 19:32533265-32533287 GTGTGGCTCCGGAGGTAAGAGGG - Intergenic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1167084249 19:47298301-47298323 CTGAGGCTGAGAAGGGAAGGTGG - Intronic
1167280851 19:48567590-48567612 CATTGGCTTTGAAGGTAGGAAGG + Intronic
1167858466 19:52262652-52262674 CTGTGGCTGGAAATGTAAGATGG - Intergenic
1168683412 19:58332901-58332923 CTGCTGCTGGGAATGTAAGATGG - Intronic
926689751 2:15725150-15725172 TTGTGGCTGTAAAGGAAGGAGGG + Intronic
927555822 2:24031097-24031119 GTGTGGCTGTGAAGGTTAACGGG + Exonic
928217375 2:29372972-29372994 ATGTGGCTGTGAAGCAAACAGGG - Intronic
928845759 2:35669862-35669884 CTGTGGCTGGGAAGGGTAGTTGG - Intergenic
932894452 2:75625553-75625575 GTGTTGCTGAGAAGATAAGAAGG + Intergenic
933089654 2:78104809-78104831 CTGTGGTTGAGAATGTAAAATGG + Intergenic
933141937 2:78801934-78801956 CTGAGTCTTTGAAGATAAGATGG - Intergenic
933692955 2:85193987-85194009 CTGTGGCTGAGGTGGTAGGAGGG + Intronic
933711597 2:85330170-85330192 CAGAGGCTGGGAAGGGAAGATGG + Intergenic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
935580618 2:104753067-104753089 CTGTGGCTGGGAAGGGTAGAGGG + Intergenic
936444691 2:112586352-112586374 CTGCAACTGTGGAGGTAAGAGGG + Exonic
936744575 2:115559716-115559738 CTTTGGCTGTAAAGTTAAAAGGG - Intronic
937104108 2:119294382-119294404 ATTTGGCTGTGAAGGGAAGATGG + Intergenic
937579761 2:123470531-123470553 CTGTGTATGTCAAAGTAAGAGGG + Intergenic
938100231 2:128493349-128493371 TGGTGGCTGTGAAGGTTACATGG - Intergenic
938659218 2:133468898-133468920 GTGTGTCTCTGAACGTAAGATGG + Intronic
938894721 2:135738591-135738613 CAGTGAGTGTGAAGGTGAGAAGG - Intergenic
939118465 2:138088435-138088457 CTCTGGCTGGGAAGGAAAGCAGG + Intergenic
940877658 2:158914200-158914222 TTGTGGCTGAGAAGGGGAGAAGG + Intergenic
942848159 2:180451056-180451078 CTGAGGCTGGGAAGGGTAGAAGG - Intergenic
945377753 2:209099132-209099154 CTGTTGATGTGATGGTAAGGTGG - Intergenic
945935712 2:215900952-215900974 TTCTGGCTGTGAAAGTAAGAAGG - Intergenic
946325617 2:218983357-218983379 CAGTGGCTGAAAAAGTAAGAGGG - Intronic
946848876 2:223885805-223885827 CTGTGGCTGGGAAGGGAAGGGGG - Intronic
947305168 2:228737898-228737920 CTGTGGATGTGAAAGGAAGGTGG + Intergenic
947900843 2:233720190-233720212 GTGGGGCTGTGAAGGTGGGATGG + Intronic
948476960 2:238226605-238226627 CTCTGCCTCTGATGGTAAGAAGG + Intronic
1168983501 20:2027275-2027297 CTGAGCCTGTGGGGGTAAGAGGG + Intergenic
1169219017 20:3810489-3810511 CTGTGGGTGGGAAGGTAACGTGG - Intergenic
1169262868 20:4150209-4150231 GTTTTGCTGTGAAGGGAAGAAGG - Intronic
1169304617 20:4477679-4477701 CTGAGGCTGTGGAGGAAGGAGGG + Intergenic
1169748669 20:8968936-8968958 CTGCTGCTGTGAAGATAGGATGG - Intergenic
1171017874 20:21557967-21557989 CTGTGGCTGTGCAGGAAGGTGGG + Intergenic
1171431868 20:25087964-25087986 CTGTGGCTGTGGAATAAAGATGG - Intergenic
1174596944 20:51691641-51691663 CTGTTGCTGGGAACGCAAGATGG + Intronic
1174989294 20:55491402-55491424 CTGTTGCTGGGAATGTAAAATGG - Intergenic
1175897294 20:62344426-62344448 CTGTGGCTGTGACTGTATGCTGG + Intronic
1176094344 20:63333096-63333118 CTGTGGCCGTAAAGGCAGGAGGG - Intronic
1176723673 21:10413094-10413116 GTGTGGCTGGAAAGGTAGGAAGG - Intergenic
1178689483 21:34739349-34739371 CTGGCCCTGTGAAGGTCAGAGGG - Intergenic
1178797521 21:35758630-35758652 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1180047721 21:45317507-45317529 CTGGTGCTGTGAAGGTACCACGG - Intergenic
1180119408 21:45736874-45736896 CAGTGGCTGTGGAGGAAACAGGG + Intronic
1180304829 22:11065871-11065893 GTGTGGCTGGAAAGGTAGGAAGG - Intergenic
1180594580 22:16964857-16964879 GTGTGGCTGTCATGGGAAGAAGG + Exonic
1181503812 22:23337486-23337508 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1181654653 22:24287021-24287043 CTGTGGCCAGAAAGGTAAGAGGG + Intronic
1181708808 22:24667706-24667728 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1182957511 22:34440955-34440977 ATGTGGGTGGGAACGTAAGATGG + Intergenic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184658318 22:45953134-45953156 CGGTGGCTGTGAGGGGAAGCCGG - Intronic
1184658327 22:45953166-45953188 CGGTGGCTGTGAGGGGAAGCCGG - Intronic
1184658366 22:45953342-45953364 CGGTGGCTGTGAGGGGAAGCTGG - Intronic
1184786248 22:46673359-46673381 CTGTGACTGTGAATGAAATATGG - Intronic
1185192781 22:49449547-49449569 CTGTGGCTGCGCTGGTAATAAGG + Intronic
1185200731 22:49502854-49502876 GAGTGACTGTGGAGGTAAGAGGG + Intronic
949115498 3:316144-316166 ATGTGGCTGGGAAGGGAAGATGG + Intronic
949474622 3:4431662-4431684 CTGTGCCGGTGAAGGGCAGAGGG - Intronic
949482800 3:4510106-4510128 CTGGGGCTGTGAAGGTGAGTGGG + Intronic
950999364 3:17539941-17539963 CTGTTGGTGGGAAGGTAAAATGG - Intronic
951124434 3:18967361-18967383 CAGTGGCTGGGAAAGTAATAGGG - Intergenic
951961856 3:28334483-28334505 GTGAGGCTGTGAAGTTAAAAAGG - Intronic
953057238 3:39397857-39397879 CTGTGGCTGAGAATGGAAAATGG - Intergenic
955525087 3:59811872-59811894 CTGTGATTGTGAAGGTGACAAGG + Intronic
956871005 3:73418122-73418144 CTGTGCCTGTGAAGTCGAGAGGG - Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957725494 3:84060297-84060319 ATGTGGCTGTGATGATAAAAGGG - Intergenic
958023480 3:88024037-88024059 CAGAGGCTGTAAAGGTAAGTGGG + Intergenic
958099243 3:88988001-88988023 TTGTGGCAGTGAAGCTATGAAGG + Intergenic
959205616 3:103303076-103303098 GTGTGTCTTTGCAGGTAAGATGG + Intergenic
960069769 3:113416249-113416271 GTGTGTCTTTGCAGGTAAGATGG + Intronic
961142587 3:124567601-124567623 CTGCTGCTGTGAAAGTGAGAGGG - Intronic
961673074 3:128548944-128548966 CTGTGGGTGTCAAGGAAGGAGGG - Intergenic
961836933 3:129669653-129669675 CTCTGCGTGTGAAGGTAACAAGG + Intronic
962343338 3:134602828-134602850 CTGTGGCTGTGCAGGTGGGAGGG - Intronic
963955650 3:151250865-151250887 CTGTTGGTGGGAACGTAAGATGG - Intronic
964148310 3:153493172-153493194 CAGAGGCTGTGAAGGGTAGAAGG + Intronic
965483108 3:169244447-169244469 CTGTGGCTGAGAAGCTGAGGGGG - Intronic
968789905 4:2652460-2652482 CTGTGGCTGTGTAGGAAGCATGG + Intronic
969571015 4:8008428-8008450 CAGTGGCTGTGTCCGTAAGATGG - Intronic
970120185 4:12745180-12745202 CTCTGGTTGGGAAGGGAAGAAGG - Intergenic
970270586 4:14342742-14342764 CTGTTGCTGTGTTGGTCAGAAGG - Intergenic
972640021 4:40916894-40916916 CTGTGGTGGGGAAGGTCAGAGGG + Intronic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
973173695 4:47177223-47177245 CTGTGGCTTTGAAGATAAAAAGG - Intronic
973773195 4:54225149-54225171 CTGTGGCTGGGAGGGGAAGGAGG - Intronic
975507223 4:75150821-75150843 CAGAGGCTGGGAAGGAAAGAAGG - Intergenic
976297891 4:83489917-83489939 CTGTGGCAGGGAAGGTTAGAGGG - Intronic
976830234 4:89307377-89307399 CTCTGGCTTTGAAGGTAAATGGG - Intronic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
978292817 4:107165591-107165613 CAGTGGCTGAGAAGGAAGGAGGG + Intronic
979077188 4:116287193-116287215 CTCTGGCTCTGATAGTAAGAAGG + Intergenic
980587896 4:134841920-134841942 CTGTGTATGTGAAAGTAAAAGGG - Intergenic
981202375 4:141995773-141995795 ATGTTGCTGTGAAGGGAGGAGGG - Intergenic
981631648 4:146825997-146826019 GTGTGTCTCTGCAGGTAAGATGG + Intronic
982176814 4:152713443-152713465 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
982339578 4:154282566-154282588 CTGTTGCTGGGAATGTAAAATGG + Intronic
983827313 4:172279613-172279635 CTGTTGCTGGGAATGTAAAATGG + Intronic
983868731 4:172799657-172799679 CTGTTGCTGGGAATGTAAAATGG + Intronic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
985864481 5:2503526-2503548 TTGCAGCTGTGAAGGGAAGAGGG + Intergenic
986017611 5:3771317-3771339 CTGTGGCTGTGCAGGAATGTCGG - Intergenic
986603063 5:9493093-9493115 AGGAGGCTGTGAATGTAAGAGGG + Intronic
987503513 5:18743195-18743217 CAGTGGCTCTGAAAGAAAGAAGG - Intergenic
987710490 5:21496924-21496946 CTCTGACAGAGAAGGTAAGAAGG - Intergenic
990625282 5:57603871-57603893 CTGAGGCAGTGAAGGATAGAGGG + Intergenic
991499495 5:67262956-67262978 CTCTGGGGCTGAAGGTAAGAAGG + Intergenic
991737375 5:69640442-69640464 CTCTGACAGAGAAGGTAAGAAGG + Intergenic
991760818 5:69915983-69916005 CTCTGACAGAGAAGGTAAGAAGG - Intergenic
991786513 5:70202118-70202140 CTCTGACAGAGAAGGTAAGAAGG + Intergenic
991788950 5:70220168-70220190 CTCTGACAGAGAAGGTAAGAAGG + Intergenic
991813701 5:70495274-70495296 CTCTGACAGAGAAGGTAAGAAGG + Intergenic
991816831 5:70516558-70516580 CTCTGACAGAGAAGGTAAGAAGG + Intergenic
991840047 5:70791034-70791056 CTCTGACAGAGAAGGTAAGAAGG - Intergenic
991878957 5:71202503-71202525 CTCTGACAGAGAAGGTAAGAAGG + Intergenic
991881397 5:71220532-71220554 CTCTGACAGAGAAGGTAAGAAGG + Intergenic
992365338 5:76084257-76084279 CCGAGGCTGTGAAGCTCAGAGGG + Intronic
992675225 5:79099779-79099801 GTGTGTCTCTGAACGTAAGATGG + Intronic
993453810 5:88104459-88104481 ATGAAGCTGTGAAGGAAAGAAGG + Intergenic
995947970 5:117672906-117672928 CTTTGGCTGTGAAGGGAAAAGGG - Intergenic
997262837 5:132477327-132477349 TTGTTGCTTTGAAGGAAAGAAGG + Intergenic
998932179 5:147193633-147193655 CTGTACCTGTGAAGATAAGCTGG + Intergenic
999089261 5:148921052-148921074 CTGGGGATGTGAAGGTAAGGAGG + Intergenic
999186040 5:149709699-149709721 CTGTGGCAGTGGAGGTAAGTGGG + Intergenic
999328712 5:150658836-150658858 CTGCTGCTGTGAAGATGAGAAGG + Intronic
1001071802 5:168592118-168592140 CAGTGGCTGTGAAGGTAAACAGG - Intergenic
1001953925 5:175835047-175835069 CTGAGGCTGTGAAGGCAAGCAGG + Intronic
1003513207 6:6798852-6798874 CTGTGGCTGGCAAAGGAAGATGG + Intergenic
1004094705 6:12541376-12541398 ATCTGTCTTTGAAGGTAAGAAGG - Intergenic
1004164962 6:13249004-13249026 CTGTGGCTGGCAAGGGAGGACGG - Intronic
1004410086 6:15373077-15373099 CTGTAGCTGTTAATCTAAGAAGG - Intronic
1004698270 6:18054469-18054491 CTGTTGCTGTGAATGTAAACTGG + Intergenic
1005475747 6:26205955-26205977 CTGTGGCAGTGAAGGGGAGCTGG - Intergenic
1005547202 6:26883593-26883615 CTCTGACAGAGAAGGTAAGAAGG + Intergenic
1006143166 6:31943202-31943224 CTGTGGGTGTGAGGATCAGATGG - Intronic
1006425818 6:33962330-33962352 CTGTGTCTGAGAAGGAAGGAAGG - Intergenic
1006444295 6:34070177-34070199 CAGTGGCTGTGCATGTAAGGAGG - Intronic
1007260530 6:40559913-40559935 CTGTGCCTGGGAACGGAAGAGGG - Intronic
1008773368 6:55006924-55006946 GTGTGCCTTTGAATGTAAGATGG + Intergenic
1009017963 6:57924667-57924689 CTCTGACAGAGAAGGTAAGAAGG + Intergenic
1010328018 6:74587746-74587768 CTGTGGCTGAGCAGGTATGCAGG - Intergenic
1010986598 6:82432390-82432412 CTCTGGGTTTGATGGTAAGAAGG + Intergenic
1011926780 6:92655033-92655055 GTGTGTCTGTGCAGGTGAGATGG + Intergenic
1013335774 6:109159089-109159111 TTGTGGCTGAAAAGGTGAGAGGG + Exonic
1013544870 6:111146334-111146356 CTGTGGATGGGAATGTAAAATGG + Intronic
1014639996 6:123897801-123897823 CAGAGGCAGTGAAGGGAAGAGGG - Intronic
1015760311 6:136652339-136652361 CTCTAGCTGTGAAAATAAGATGG + Intronic
1018663640 6:166113474-166113496 CTGAGGCTGTGCAGAAAAGAGGG - Intergenic
1018704823 6:166456035-166456057 CTGTGTCTGTCAAGTTAACATGG - Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019900989 7:4020498-4020520 CTGGGGAGGTGAAGGGAAGACGG + Intronic
1021097981 7:16554711-16554733 CGGTGTTTGTGAAGGTAAGGGGG - Intronic
1022360084 7:29649361-29649383 CTGGGGCTGTGAACGTATGAGGG + Intergenic
1023392364 7:39722362-39722384 GTCTGGCTGAGAAGGGAAGATGG + Intergenic
1024127721 7:46317730-46317752 CTGTGGCTGGAAACGTAGGATGG + Intergenic
1024314112 7:47998169-47998191 CTGTGGGTGAGAATGTAACATGG - Intronic
1025926950 7:65967983-65968005 CTCTGGCAGAGAAGGTAAGGGGG + Intronic
1027413945 7:77953951-77953973 CTGTGCATGTGAGGGTAAAATGG - Intronic
1028108679 7:86912044-86912066 TTCTGGCTGTCAAGGTGAGATGG - Intronic
1028213758 7:88106887-88106909 ATGTGCCTGGAAAGGTAAGAAGG - Intronic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1028931179 7:96414791-96414813 GTGTGGGTGTCAAGGTGAGAGGG + Intergenic
1029106657 7:98182625-98182647 CTGTTGGTGGGAAGGTAAAATGG + Intronic
1030029997 7:105360268-105360290 GTGTGTCTCTGAAGGTAAGATGG + Intronic
1031147617 7:118014446-118014468 CTGTGCCTGGGAAGGTTAGCGGG - Intergenic
1032084369 7:128876311-128876333 GTGTGGCTGTGAAGGCAGGCAGG + Intronic
1032853423 7:135814539-135814561 CTGCGGCTGTGAAAGCAAGAGGG - Intergenic
1033273476 7:139953687-139953709 CTGGGTCTGTGGAGGTCAGAGGG - Intronic
1033475560 7:141688787-141688809 CTGTGGCAGGGCAGGGAAGATGG - Intronic
1033632194 7:143169732-143169754 CTGTTGTTGAGAAGGTAAAATGG + Intergenic
1034236014 7:149570147-149570169 CTACGGATGTGAAGGTAAGGAGG + Intergenic
1034276854 7:149827656-149827678 CTGTGGCTGAGAAGGCAAGATGG + Intergenic
1034545817 7:151788198-151788220 CTGTGGGTGGGAAAGTAAAATGG - Intronic
1035057136 7:156043267-156043289 CTGTGGCTGGGAAGTTTGGAAGG - Intergenic
1035732453 8:1862511-1862533 CTGAGTCTGTCAAGGTCAGAAGG - Intronic
1035837419 8:2769684-2769706 CTGAGGCTGGGAAGGCAAGCTGG + Intergenic
1035981852 8:4381368-4381390 CTGTGGCTGTAAGAGTAAGCAGG + Intronic
1036218918 8:6904074-6904096 CTGTTGCTGTGGAGGTCAAATGG + Intergenic
1036447782 8:8837817-8837839 CTGTGGGTGGGAATGTAAAATGG + Intronic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1037576477 8:20209311-20209333 CTGTGTCTGTGAAGAGTAGAGGG + Intronic
1038705144 8:29886439-29886461 CTGGGGCTGGGGAGGTGAGATGG + Intergenic
1039899187 8:41738799-41738821 AAGTGGCTGTGAAGGTGAGATGG - Intronic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1042380804 8:68112106-68112128 CTTTGGCTCTGAAGCTAAGTAGG - Intronic
1042983556 8:74557641-74557663 CAGAGGCTGGGAAGGAAAGAAGG + Intergenic
1044363228 8:91312550-91312572 CTGTTGCTGGGAATGTAAAATGG - Intronic
1044510934 8:93077681-93077703 CAGAGGCTGTGAAGGGAAGAGGG + Intergenic
1044948591 8:97414328-97414350 ATGTGGCTGGGTAGGAAAGATGG + Intergenic
1045180063 8:99771049-99771071 CTCTAGGGGTGAAGGTAAGAGGG - Intronic
1046768598 8:118097003-118097025 CTGAGGCTCTGAAGGTATAATGG + Intronic
1046804066 8:118460897-118460919 ATGTAGCTGAGAAGGTAAGTTGG - Intronic
1048032636 8:130647197-130647219 ATGGGGCTGGGAAGGTAAGTTGG + Intergenic
1048279750 8:133096360-133096382 CAAAGGCTGTGAAGGTAAGCAGG + Exonic
1048397710 8:134030456-134030478 CTGTGGCAGTGAAGCTCACATGG - Intergenic
1049748834 8:144274125-144274147 CAGTGGCTGTGATGCTGAGAAGG - Intronic
1050971777 9:11886459-11886481 CTGTGGATGAGAATGTAAAATGG + Intergenic
1051176303 9:14364156-14364178 CTGTGGCTGTGAGTGTAAATGGG - Intronic
1051327704 9:15990679-15990701 GTGTGGCTCTGCATGTAAGATGG - Intronic
1051674926 9:19549248-19549270 TTGTCTCTGAGAAGGTAAGAAGG - Intronic
1053136016 9:35650638-35650660 CTGTGGATGTGAAAGGAAGGGGG + Intronic
1053559184 9:39171598-39171620 CTGTGGCTGTGGACATGAGAAGG + Exonic
1053823302 9:41991839-41991861 CTGTGGCTGTGGACATGAGAAGG + Exonic
1054137927 9:61447348-61447370 CTGTGGCTGTGGACATGAGAAGG - Intergenic
1054607271 9:67195526-67195548 CTGTGGCTGTGGACATGAGAAGG - Intergenic
1054799484 9:69333218-69333240 ATGTGGCTGTGTAGGTGAGGGGG + Intronic
1056021248 9:82440640-82440662 CTGAGGCTGTGCAGGGAAGCTGG - Intergenic
1056040061 9:82656128-82656150 CAGAGGCTGGGAAGGGAAGAAGG + Intergenic
1056198659 9:84253279-84253301 ATGAGGCTGTGTAGGGAAGAGGG - Intergenic
1056251266 9:84750712-84750734 CTTTTGCTGTAAAGGTCAGATGG - Intronic
1056672657 9:88644188-88644210 TTGTGGGTGGGAATGTAAGATGG - Intergenic
1057067230 9:92066705-92066727 CTCTGGCTGTGATGTTAAAAAGG + Intronic
1057836852 9:98452100-98452122 GTGTGGATGCCAAGGTAAGATGG - Intronic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058879094 9:109271240-109271262 CTGTGGCTGAGCAGGAAGGATGG - Intronic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1061229509 9:129306558-129306580 CTGTGCCTGTGAAGGAGAGCAGG - Intergenic
1061659354 9:132118380-132118402 CTGTTGTTATGAAGGGAAGATGG - Intergenic
1061855214 9:133438248-133438270 ATTTGGCTGTGATGGTAGGATGG + Exonic
1062227438 9:135460734-135460756 CTGGGGCTGGGAGGGTAAGGAGG - Intergenic
1062307688 9:135918930-135918952 CTGTTGCTGGGAATGTAAAATGG + Intergenic
1185474114 X:403463-403485 CTGTGGCAGAGAAGGGAAAATGG - Intergenic
1186264750 X:7820100-7820122 CTGTTGGTGGGAATGTAAGATGG - Intergenic
1187178770 X:16922322-16922344 CAGAGGCTGGGAAGGGAAGAGGG + Intergenic
1188938697 X:36210303-36210325 CTGTTGGTGGGAATGTAAGATGG - Intergenic
1189847308 X:45149343-45149365 CTGTGACTGTGCAGGTGAGAAGG + Exonic
1190158341 X:48011694-48011716 TTGTGGCCTTGAAGGTATGAGGG - Intronic
1190174112 X:48134576-48134598 TTGTGGCCTTGAAGGTATGAGGG - Intergenic
1190605563 X:52139081-52139103 CTGTGGCTGTGAGGGTCATCTGG - Intergenic
1192185626 X:68945003-68945025 CAGTGGCTGTGGAGTAAAGACGG + Intergenic
1192268728 X:69558337-69558359 CTTTGGGTCTGAAGGCAAGATGG + Intergenic
1193233638 X:79078527-79078549 ATGTGCCTGTGAAGGAAAGCTGG + Intergenic
1193719286 X:84969545-84969567 GTGTGTCTTTGCAGGTAAGATGG + Intergenic
1194009683 X:88545818-88545840 CTGTGGCTGGGAATGTAAAATGG + Intergenic
1195735398 X:108007733-108007755 GTTTGGCTGTGAAGGGGAGAAGG + Intergenic
1196883187 X:120218995-120219017 CAGAGGCTGTGAAGGGTAGAGGG + Intergenic
1199336946 X:146629437-146629459 CTGTGGCAGTGTAGGAAACATGG + Intergenic
1201584823 Y:15548863-15548885 CTTTGGCTGTGTTGGGAAGAGGG + Intergenic
1201988091 Y:19991753-19991775 CTGTGTCTCTGAAGGTGAGTTGG + Intergenic