ID: 1138366113

View in Genome Browser
Species Human (GRCh38)
Location 16:56479089-56479111
Sequence ATGTTCACCTGTAAAATATA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138366112_1138366113 -1 Left 1138366112 16:56479067-56479089 CCTCTTTCAGATAAAAGCTATGA 0: 1
1: 1
2: 1
3: 24
4: 220
Right 1138366113 16:56479089-56479111 ATGTTCACCTGTAAAATATATGG 0: 1
1: 0
2: 1
3: 28
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138366113 Original CRISPR ATGTTCACCTGTAAAATATA TGG Exonic
905594287 1:39192529-39192551 ATATACACCTGTAACATAGAAGG - Intronic
909233853 1:73126793-73126815 ATGTTCAAATGTGAAATAAATGG - Intergenic
909459139 1:75889236-75889258 ATATGATCCTGTAAAATATAAGG - Exonic
911167826 1:94740285-94740307 ATGTGCACAGGTAGAATATATGG - Intergenic
912263115 1:108128876-108128898 ATGTTCCCCCTTAAGATATAGGG - Intergenic
914751227 1:150536457-150536479 TTCTTCACCTGTAAAATGAAGGG + Intergenic
914848365 1:151295468-151295490 TTCTTCACCTGTAAAATGTGAGG - Intronic
914987042 1:152469648-152469670 TTTTTAACCTGTAAAATATAAGG + Intergenic
916308899 1:163372033-163372055 AAGTTCATTTTTAAAATATAAGG - Intergenic
918332847 1:183475786-183475808 ATGTCAAGCTATAAAATATAAGG - Intronic
919000894 1:191829477-191829499 ATGTTCTCTTGGAAAATATGAGG + Intergenic
919054538 1:192553087-192553109 ATGTTCAGCTGTCACATATGTGG - Intergenic
919712471 1:200740982-200741004 ATTTCCACATGTTAAATATAGGG + Intronic
920168766 1:204056107-204056129 CTGTTCACCTATAAAATGAAAGG - Intergenic
921311220 1:213845783-213845805 ATTTTCACATGTGAAAAATAGGG + Intergenic
921980532 1:221252422-221252444 ATATTCAGATGTAATATATATGG + Intergenic
923466627 1:234253366-234253388 CTGTTCACCTGTAAATAAAAGGG + Intronic
923675388 1:236076539-236076561 ATGTTTAGCTGTAAAATCTCTGG + Intergenic
924012638 1:239682326-239682348 ATGTACAACTCTAACATATAAGG - Intronic
924176191 1:241393632-241393654 ATGTTCAGCTTTAGAATATATGG - Intergenic
1064666294 10:17655535-17655557 TTATACACCTGTAAAATATTTGG + Intronic
1066814602 10:39389674-39389696 ATGTTCACATGAAAATTAGATGG - Intergenic
1067749232 10:48959078-48959100 TTTTCCACCTGTAAAATTTAAGG - Intronic
1068051751 10:51958891-51958913 ATAGTCATCTGTAAAATATTGGG - Intronic
1068349936 10:55830190-55830212 TTCTTCACCATTAAAATATAAGG - Intergenic
1069039573 10:63681235-63681257 ATTTTCTCATGTAAAAAATAGGG + Intergenic
1069209310 10:65735839-65735861 ATATTAACCATTAAAATATATGG - Intergenic
1071685136 10:87746887-87746909 TTGTTCACCTGTAAGATGAAAGG - Exonic
1072093842 10:92157258-92157280 ATGCTCATCTGTAAATTATGAGG - Intronic
1072925911 10:99616987-99617009 ATATTCACCTGTGAAAGATTAGG - Intronic
1073671509 10:105595700-105595722 ATGTTCACCTGACAAATACGTGG + Intergenic
1073693085 10:105833350-105833372 TTGTCCACATGTTAAATATATGG - Intergenic
1074254037 10:111782610-111782632 ATCTTCACCTGAATGATATATGG - Intergenic
1074759230 10:116653742-116653764 AAATTCACATGTAAAATATTAGG + Intergenic
1079340097 11:19604660-19604682 TTCTTCACCTGTAAAATAGAGGG - Intronic
1082140855 11:48607423-48607445 ATGTTTACTTGTAAAAAATAGGG - Intergenic
1082568026 11:54704197-54704219 ATGTTTACTTGTAAAAAATAGGG - Intergenic
1082618010 11:55385864-55385886 ATGTTTACTTGTAAAAAATAGGG - Intergenic
1082623690 11:55457587-55457609 ATGTTTACTTGTAAAAAATAGGG - Intergenic
1084862502 11:72029283-72029305 CTGTTCACCTGTAAATCAAAGGG + Exonic
1087062480 11:93993796-93993818 ATGTGAACCTGGAAAATATTTGG - Intergenic
1087449597 11:98302085-98302107 ATGTTCAACAGTAGAATATTTGG - Intergenic
1088927723 11:114319414-114319436 ATCTTCACCTCTAAAATAAAAGG - Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1091889506 12:4042028-4042050 TTATTCACCTGTAAAATGAATGG - Intergenic
1094412078 12:30177223-30177245 ATGATCACCTTTTAAATAAATGG + Intergenic
1094417031 12:30227947-30227969 ATCTTCAGCTATAAAATTTATGG - Intergenic
1095060153 12:37677738-37677760 ATCTTCACCTATAAACTAGACGG - Intergenic
1097471091 12:59992699-59992721 ATGCTCATCTGTGAAATACATGG + Intergenic
1097885199 12:64721967-64721989 ATGGGCACCTGTAAAATGTATGG + Intronic
1098037845 12:66323680-66323702 GTGTTAACCTTTAGAATATAAGG + Intronic
1098550510 12:71755958-71755980 TTCTTTACCTGTAAAATAAAAGG + Intronic
1098940179 12:76525243-76525265 ATATTATCCTGTAAAATATCAGG - Intronic
1099095862 12:78373504-78373526 GTGTTCATATGTAAAATATGTGG - Intergenic
1099453032 12:82830879-82830901 ATTTTTCCATGTAAAATATATGG - Intronic
1099659776 12:85542363-85542385 ACGTTCATCTGTAAACTGTATGG + Intergenic
1100444089 12:94645003-94645025 ATGTTCTCCTGTACAAGACAGGG + Intronic
1100567490 12:95811676-95811698 ATGTTCACCTGTCAATGAAAAGG + Intronic
1101655685 12:106718022-106718044 ATGTGCACTTTTAAAATCTAAGG - Intronic
1105447127 13:20467518-20467540 AGGTTCACTTTTAAAATATCTGG + Intronic
1106152518 13:27119456-27119478 ATCTTCACTTGCAAAATAAAAGG + Intronic
1106206135 13:27596977-27596999 ATTTTCCCCTCAAAAATATAAGG + Intronic
1107368348 13:39711671-39711693 AAGATCACATGTAAAATACATGG + Intronic
1107571935 13:41670907-41670929 ATGTGCACCTCTAAGAGATAAGG + Intronic
1108290929 13:48960037-48960059 ATGGACACTTGTAAAATAGATGG + Intergenic
1109020670 13:57087771-57087793 ATGTTTAACAGTAAAAAATAAGG + Intergenic
1109427892 13:62191618-62191640 AATTTAACCTGTAAAAAATAAGG + Intergenic
1109580480 13:64325747-64325769 ATGTTCTCTAGTAAATTATATGG + Intergenic
1109772065 13:66988280-66988302 AAGATTACCTGTAAAATACAAGG - Intronic
1111314150 13:86530133-86530155 ATATTCACATGGAAAAAATATGG - Intergenic
1111567477 13:90034249-90034271 AAGTTCACCAGTAATATTTATGG + Intergenic
1111957806 13:94777005-94777027 ATTTTCACCTTTAAAATATGAGG - Intergenic
1112726314 13:102308668-102308690 TTCTTCATCTGTAAAATAAAAGG + Intronic
1114841261 14:26265024-26265046 ATGTTCTCCTGTATAATAATAGG + Intergenic
1116621772 14:47213312-47213334 ATGCTCACATGTAAAAAATTAGG - Intronic
1117683080 14:58225378-58225400 AAGTTTCCTTGTAAAATATAAGG + Intronic
1117732664 14:58739479-58739501 CTGTTCATCTGTAAAATTGAGGG + Intergenic
1119883712 14:78122683-78122705 ATGTTCAACTTTAAAACAAATGG + Intergenic
1122028263 14:98893409-98893431 TTCTTCAACTGTAAAATAAACGG - Intergenic
1123228777 15:17080157-17080179 ATGTTCACATGAAAACTAGATGG - Intergenic
1125876995 15:43157711-43157733 ATATTTATCAGTAAAATATAAGG + Intronic
1126005179 15:44249641-44249663 ATGTTAACATGTGAAATAAAGGG + Intergenic
1126210584 15:46097157-46097179 GTGTTCACTTTTAAAAAATAAGG - Intergenic
1126444884 15:48731300-48731322 ATATTTACCAGAAAAATATATGG + Intronic
1126703622 15:51387927-51387949 ATCTTCATCTGGAAAAAATATGG - Intronic
1126794049 15:52245458-52245480 ATGTCCACCTGGAAAATCAAAGG + Exonic
1129646091 15:77434831-77434853 ATGATCACCTTTGGAATATACGG - Intronic
1133482176 16:6181526-6181548 AAGTTCACGTGAAAAATATTTGG - Intronic
1135654048 16:24232410-24232432 ATGTACCCCTGCCAAATATAAGG + Intergenic
1135825695 16:25726219-25726241 ATGTTCAACTGTATAACATCAGG - Intronic
1136494651 16:30634838-30634860 ATTTTCTCCTGTAAAATAGGAGG + Intergenic
1136915302 16:34186265-34186287 ATCTTCACCTACAAAGTATAAGG - Intergenic
1136915393 16:34187976-34187998 ATCTTCACCTACAAAGTATAAGG - Intergenic
1137964685 16:52918792-52918814 ATCTTCACTTATAAAATAAAAGG - Intergenic
1138366113 16:56479089-56479111 ATGTTCACCTGTAAAATATATGG + Exonic
1138958342 16:61999223-61999245 TTTTTCATCTGTAAAATATTTGG - Intronic
1139068360 16:63347877-63347899 ATGTGCACCTTTAAATCATATGG + Intergenic
1139837459 16:69850718-69850740 ATGTTGACATGTAAGATATTAGG + Intronic
1140887342 16:79256383-79256405 CTCCTTACCTGTAAAATATAGGG - Intergenic
1141029968 16:80579095-80579117 TTGCTCTCCTGTGAAATATAGGG - Intergenic
1141117236 16:81319558-81319580 GTGATCACTTGTAAAATTTAGGG + Intronic
1141759300 16:86017000-86017022 ATCCTCAACTGTAAAATAAAAGG + Intergenic
1142100448 16:88268147-88268169 AAGTTTACATTTAAAATATAGGG - Intergenic
1144182655 17:12767226-12767248 ATCTTCACCTGAATAATAGAGGG + Exonic
1145290330 17:21539797-21539819 ATGTGCAGATGTAAAATTTATGG + Intronic
1145417510 17:22732185-22732207 ATCTTCACATGAAAAGTATATGG + Intergenic
1147165409 17:38590639-38590661 TTCTTCACCTGTAAAATAGGGGG - Intronic
1148920958 17:51033382-51033404 ATGTGCACCTGTAAAGAAAAAGG + Intronic
1149154410 17:53609184-53609206 ATGATCAAGTGTAAAGTATAAGG - Intergenic
1149826809 17:59835956-59835978 ATTCCCACCTGTAATATATAAGG + Intronic
1150024762 17:61662290-61662312 TTGTTCAACTGAAGAATATACGG - Intergenic
1150253453 17:63724008-63724030 ATTTTTAACTGTAAAATATTGGG + Intronic
1151452836 17:74209576-74209598 CTGTTCCCCTGTAAAAAATGGGG - Intronic
1153236035 18:2989127-2989149 TTCTTCATCTGTAAAATATAGGG - Intronic
1157803478 18:50640020-50640042 ATGTTCCCTTGTAGAATAAAAGG - Intronic
1158007829 18:52693418-52693440 ATATTTACATATAAAATATATGG + Intronic
1158383328 18:56960146-56960168 ATGCAGACCTGTAATATATATGG + Intronic
1158813616 18:61067778-61067800 ATATTCACATGTAATATAAATGG - Intergenic
1159101820 18:63966861-63966883 ATCCTCTCCTGCAAAATATAAGG + Intronic
1159382993 18:67686910-67686932 ATATTTACCTGTAAAATTAAGGG - Intergenic
1159494593 18:69185748-69185770 ATATTCCCATTTAAAATATAAGG + Intergenic
1159759897 18:72411524-72411546 ATGTTCTCCTGTACAACAGAAGG + Intergenic
1159826425 18:73217911-73217933 GTGTGCACATGTAATATATAGGG + Intronic
1160099814 18:75909544-75909566 TTCTTCACCTGTAAAATAGGAGG + Intergenic
1162059145 19:8084275-8084297 ATGTTCATCTGTGAAGTAGAAGG - Intronic
1164876146 19:31691757-31691779 ATGTTCACCTTTAAACTCAAGGG + Intergenic
1165801398 19:38552934-38552956 ATGTTGAGCTGTAAAATGTCAGG - Intronic
1167979927 19:53266860-53266882 GTGTTCACCAGTAAACTATTGGG + Exonic
1167985959 19:53315921-53315943 GTGTTCACCAGTAAACTATTGGG - Intergenic
925161035 2:1684452-1684474 ATTTTCACTTCCAAAATATATGG + Intronic
926586051 2:14686830-14686852 CTGTTAATCTCTAAAATATAGGG + Intergenic
927040419 2:19224696-19224718 ATGTGCACTTGTAAAATGCATGG + Intergenic
927071814 2:19538524-19538546 GTGTCCACCTGTGCAATATATGG + Intergenic
927863845 2:26576519-26576541 ATACTCACCTACAAAATATATGG - Intronic
928480408 2:31677042-31677064 ATCTTCATCTGTAAAATAAGAGG + Intergenic
929722954 2:44389498-44389520 AACTTCAGCTGTAAATTATATGG + Intronic
930623775 2:53672508-53672530 ATGTTCAACTATCAAGTATAAGG + Intronic
931866520 2:66418272-66418294 ATGTTCAGCTGTTAAACATTTGG + Intergenic
933031037 2:77328984-77329006 TTTCTCATCTGTAAAATATAAGG + Intronic
933271819 2:80240896-80240918 ATATTCACATGTAAAGTAAAGGG - Intronic
935515942 2:104038932-104038954 ATGTTCACAAGAATAATATAGGG - Intergenic
935875100 2:107497934-107497956 ATGTTAACATGCAAAATACAAGG + Intergenic
935903420 2:107817123-107817145 AAGGTCCCCAGTAAAATATATGG - Intergenic
936694859 2:114934045-114934067 AAGTTCACCATTAAAATGTAGGG + Intronic
937706128 2:124922781-124922803 ATTTTTATCTGCAAAATATAAGG - Intergenic
939052431 2:137323784-137323806 ATATTCATCTGTAAAATTTATGG - Intronic
939706783 2:145464617-145464639 CTGTTAACCTTTAAAATGTATGG + Intergenic
940522272 2:154766355-154766377 ATTGTGACCTGTAGAATATATGG + Intronic
941645207 2:168032932-168032954 ATGTTCATTTGAAAAATAAAAGG + Intronic
943045648 2:182858670-182858692 AAGTTTACTTGTAAAATGTAGGG + Intronic
943813402 2:192219799-192219821 CTGTTCATCTTTAAAATATTAGG + Intergenic
944071974 2:195681165-195681187 ATGTTTACCTATGAAATATCAGG + Intronic
944979439 2:205098384-205098406 ATGATCACCTGTAAATCAGAGGG + Intronic
946273451 2:218612964-218612986 TTTTTCATCTGTAAAATATAGGG + Intronic
946606693 2:221412670-221412692 ATTTTCATCTGTAAAATAAGAGG - Intergenic
1169940155 20:10928249-10928271 ATGATCATTTCTAAAATATAAGG - Intergenic
1169944730 20:10976581-10976603 ATTTTCAACAATAAAATATAAGG + Intergenic
1171030135 20:21669560-21669582 GTGTTCACCTGTGGAATATCAGG - Intergenic
1172904890 20:38361988-38362010 TTGTTCAACTTTAAAATATGAGG + Intronic
1174091225 20:48049812-48049834 GTGGTCTCCTGGAAAATATATGG + Intergenic
1174262909 20:49310140-49310162 ATCTTCACGTTCAAAATATACGG - Intergenic
1175013227 20:55761417-55761439 ATTTTCATCTGTAAAACAGAAGG - Intergenic
1176961457 21:15163718-15163740 ATGTTACAATGTAAAATATAGGG - Intergenic
1177663274 21:24115850-24115872 ATGTGTACCTCTAATATATATGG + Intergenic
1177745821 21:25211929-25211951 AAATTCATCTGTAAAGTATATGG - Intergenic
1177902241 21:26931438-26931460 ATGCTCACTTGTGAAAAATAAGG + Intronic
1178527644 21:33345576-33345598 TTCTTCACTTGTAAAATAGATGG + Intronic
1178545586 21:33490809-33490831 CTTTCCACTTGTAAAATATACGG - Intronic
1178575100 21:33780159-33780181 ATATTCTCCTGGAAAATTTAGGG + Intronic
1178994723 21:37388444-37388466 ATGTGTATCTGTAAAAGATAAGG + Intronic
1180399650 22:12399753-12399775 ATGTTCACATAAAAACTATAAGG + Intergenic
1180517506 22:16160483-16160505 ATATTCATCTTTAAAAAATAAGG - Intergenic
1180725315 22:17942519-17942541 ATGATCATATGTAAAATCTAAGG + Intronic
1183224925 22:36543146-36543168 TTCTTCATCTGTAAAATAGATGG + Intergenic
1183370891 22:37431582-37431604 TTGTTCACCTTGAAAATAAAGGG - Intergenic
1184675745 22:46042089-46042111 ATGTTCACCTTTAAGAGACAGGG - Intergenic
950379554 3:12599902-12599924 ATGTTTATCTTTAAAAGATATGG - Intronic
951603256 3:24400339-24400361 ATGTTTACATTTAAAATATCAGG - Intronic
951698942 3:25475351-25475373 ATGTTTACCTGTATTATATCGGG + Intronic
955013035 3:55038257-55038279 ATGTTCACCTTAATAATCTAAGG - Intronic
955567654 3:60265945-60265967 ATGATCACCTGCAAGATGTAAGG - Intronic
956656124 3:71553220-71553242 ATGATGACCTATAAAATATTTGG - Intronic
957420758 3:79966358-79966380 TTGTTTATCTCTAAAATATAAGG - Intergenic
958426636 3:93986210-93986232 TTTTTCATCTCTAAAATATAAGG - Intronic
958503153 3:94940349-94940371 ATGTTAACCTATAAAATTCATGG + Intergenic
958812535 3:98878393-98878415 ATGTTCACATTTGAAGTATATGG - Intronic
959003386 3:100990875-100990897 ATCTTCATTTGTAAAATAAATGG + Intronic
959967384 3:112372443-112372465 TTCTTCATCTGTAAAATATAGGG - Intergenic
960040381 3:113144328-113144350 ATGTTTACCTGCAAAGAATATGG + Intergenic
961602615 3:128073023-128073045 TTCTTCACCTGTAAAATGGACGG - Intronic
961917641 3:130393642-130393664 ATCCACACCTGTAAAATAAATGG + Intronic
962294462 3:134169011-134169033 ATGATCACCTAGAAAATAAAAGG - Intronic
962966210 3:140356955-140356977 TTCTTCACCTGTAAAATGGAGGG - Intronic
963785864 3:149533750-149533772 TTGTTCACCTGAAAAAAAAAAGG + Intronic
964802616 3:160572204-160572226 ATTTTTTCCTGTAAAGTATAAGG - Intergenic
965049158 3:163622340-163622362 ATATCCAGCTGGAAAATATAAGG - Intergenic
965482375 3:169234712-169234734 AGGTTGACATGTAAAATATATGG - Intronic
965770083 3:172172803-172172825 ATGGTCACCATTTAAATATAAGG + Intronic
966434317 3:179866444-179866466 ATTTTCATCTGTAAAGCATACGG + Intronic
969909433 4:10429622-10429644 TTTTTAACCTGTAGAATATAGGG - Intergenic
970039897 4:11784686-11784708 ATGTACATCTGCAAAATGTAAGG + Intergenic
970748061 4:19323698-19323720 ATTTTTACCTTTAAAACATATGG + Intergenic
971374433 4:26045445-26045467 ATATTAACCTCTAAAATATTGGG + Intergenic
971940257 4:33206000-33206022 ATGATCATCTGAAAAGTATAGGG + Intergenic
972558331 4:40202872-40202894 ATTTTGACCTGAAAAAAATAGGG + Intronic
972699594 4:41481441-41481463 TTCCTCATCTGTAAAATATAGGG + Intronic
973208930 4:47593101-47593123 ATGTTCACTTGTAAATAAAAAGG + Exonic
973663105 4:53128394-53128416 ATGTTCATCTCTAAAATTAAAGG + Intronic
973895507 4:55408647-55408669 CTGTTCCTCTGTAAAATGTAGGG - Intronic
974461340 4:62192576-62192598 TTGTATACATGTAAAATATACGG + Intergenic
975134217 4:70858431-70858453 ATGTTCACCTCTAAGAATTAAGG - Intergenic
976047428 4:80967722-80967744 ATGTTCATCTGTTAGAGATACGG - Intergenic
976625260 4:87173543-87173565 ATTTTCACATGTGAAATATCTGG - Intronic
977613513 4:99061631-99061653 ATGTTCACCTGGAAAGCAGATGG - Exonic
977731303 4:100355950-100355972 ATGTACAATTATAAAATATAAGG - Intergenic
978161061 4:105548923-105548945 TTCTTCATTTGTAAAATATAAGG - Intergenic
980251429 4:130320554-130320576 ACATTCCCCTGTAAAATATAAGG - Intergenic
983156871 4:164358941-164358963 ATGTTTTTCTTTAAAATATATGG + Intronic
984693037 4:182750655-182750677 ATGTTCACAAATAAAATAAATGG + Intronic
985339061 4:188928853-188928875 ATGTGCACATTTAAAAAATAAGG + Intergenic
987057033 5:14203541-14203563 ATGTTCACCTGTGAGTTTTATGG + Intronic
987194573 5:15513167-15513189 ATATTGACCTGTAATATTTATGG + Intronic
988490646 5:31702434-31702456 ATGGGCACCTTTAAAATAAAGGG - Intronic
988853348 5:35200766-35200788 ATCTTCCCCTGTAAGATATCAGG + Intronic
989762684 5:45037513-45037535 AATTTCACCTTTAAAATATGGGG - Intergenic
989879298 5:46752173-46752195 ATCTTCACCTGAAAAATAGACGG + Intergenic
991641594 5:68759877-68759899 ATTTTATCCTGTAAAATAAAAGG - Intergenic
991651114 5:68854870-68854892 ATGTGCACCTCTAAGAGATAAGG + Intergenic
992752335 5:79872903-79872925 ATTTTCTCCTGTTAAAAATAAGG + Intergenic
992821546 5:80502567-80502589 ATGTTCATCTGTATAATGAAGGG - Intronic
993737720 5:91497834-91497856 GTGTTCAGATGCAAAATATAAGG + Intergenic
993927810 5:93892943-93892965 ATTTACACCTTTAAAAAATATGG + Intronic
994179412 5:96747562-96747584 AAGATCATCTTTAAAATATATGG - Intronic
995598322 5:113770620-113770642 AAGTTCACCTGAAAAAAGTAAGG + Intergenic
995768817 5:115647820-115647842 ATGTTTACCAGTGAAATATGAGG - Intergenic
996894933 5:128469671-128469693 CTGTTCACCTGTACAATTTCTGG - Intronic
997919039 5:137960030-137960052 CTGTTTAACTGTAAAATATTTGG + Intronic
998948782 5:147370407-147370429 GTGTTCAACTTTAAAATTTATGG + Intronic
1000040630 5:157482003-157482025 ATTTTAACCTGTAAGATATCAGG - Intronic
1000521747 5:162303275-162303297 ATATCCATCAGTAAAATATATGG + Intergenic
1000696284 5:164388697-164388719 ATGTACACCTGTAAACAATTTGG - Intergenic
1001456538 5:171865849-171865871 ATACTCACCCGTAAAATATCAGG - Intronic
1002589087 5:180276000-180276022 ATTTTCACCTGTAAAATGAGTGG - Intronic
1004637704 6:17484823-17484845 ATCTTCATCTGTAAAAGAAATGG - Intronic
1005208369 6:23431325-23431347 AAGTTCTCCTGGAAAATATCCGG + Intergenic
1005605180 6:27469809-27469831 ATGTACACCTGAAAAAAAGAAGG + Intronic
1005725500 6:28643771-28643793 ATGATCACTTGTAAAATAGAAGG - Intergenic
1006384223 6:33720239-33720261 ATCTTCAACTGTAAATGATAGGG + Intergenic
1008017586 6:46539126-46539148 ATGTGCACCTTTGAAACATAGGG + Intergenic
1008111643 6:47501484-47501506 ATCTTCGCCTGTAAAGTACAGGG + Intronic
1009404355 6:63293456-63293478 CTGTTCATCTGGAAAATAGAGGG - Intronic
1009444196 6:63721150-63721172 ATTTTCAACTGCAAAATTTATGG - Exonic
1010622745 6:78097165-78097187 ATGTTCATTAGGAAAATATATGG - Intergenic
1010905936 6:81488758-81488780 ATGCTAACCTGTATAAAATAAGG + Intergenic
1010972348 6:82276274-82276296 ATGTTCTCCTTTATAAAATAGGG - Intergenic
1011005925 6:82645597-82645619 ATGTTCACCTGTAATAGTTCTGG - Intergenic
1015023731 6:128508110-128508132 ATGGTCAGTTATAAAATATATGG + Intronic
1015151120 6:130039251-130039273 ATTTGTACCTGTAAAATATAAGG + Intronic
1016793859 6:148096384-148096406 ATGCTCACCTGTCCAATATCAGG + Intergenic
1016826419 6:148392526-148392548 ATGTTCACTTGCACAATATAGGG - Intronic
1016867661 6:148783886-148783908 ATCTTCACCTGTAAAATGCGGGG - Intronic
1016916731 6:149250867-149250889 ATATTCACCTGTTTAATACATGG + Intronic
1017257225 6:152347545-152347567 TTATTAACCTGAAAAATATAGGG - Intronic
1018401684 6:163428090-163428112 ATGTTCTCCTTTAAATTGTAAGG + Intronic
1020158192 7:5745085-5745107 ATCTCCACCTGTAAGATCTACGG + Intronic
1020703056 7:11507830-11507852 AGCTTAACATGTAAAATATAAGG + Intronic
1020720319 7:11736647-11736669 ATGTTGAAATGTAAAATAAAGGG + Intronic
1023592550 7:41795045-41795067 ATGTTCAGCTGTGAAAAATAAGG - Intergenic
1025491702 7:61134651-61134673 ATCTTCACCTGAAAACTAAATGG + Intergenic
1025505712 7:61426123-61426145 ATCTTCACCTGGAAACTAAATGG + Intergenic
1025506051 7:61431762-61431784 ATCTTCACCTGAAAACTAAATGG + Intergenic
1025511550 7:61524750-61524772 ATCTTCACCTGAAAACTAAATGG + Intergenic
1028356469 7:89916358-89916380 CTCTTCACTTGTAAAACATATGG - Intergenic
1030498195 7:110326482-110326504 TTTTTCATCTGTAAAAAATATGG - Intergenic
1031611236 7:123830092-123830114 ATGGTCACTTGTAATATTTAGGG - Intronic
1031832596 7:126645908-126645930 ATTTTCCCTGGTAAAATATAGGG - Intronic
1033577820 7:142703050-142703072 ATGAACACCTGTTAAATATCAGG - Intergenic
1033666106 7:143442253-143442275 TTCTTCACCTATAAAAAATATGG - Intergenic
1034328713 7:150263161-150263183 ATGTTCACCTGTACAATTTGTGG - Intronic
1034764503 7:153706224-153706246 ATGTTCACCTGTACAATTTGTGG + Intergenic
1035457770 7:159020182-159020204 ATGTGCACTTGAAAAAAATATGG + Intergenic
1035725383 8:1822073-1822095 AGGTTCACCTTTCAAATATATGG - Intergenic
1036220015 8:6913664-6913686 ATCTTTATCTGTAAAATTTAAGG - Intergenic
1036982184 8:13482193-13482215 ATGTCCACCTGTGAAAGATGGGG - Intronic
1037018277 8:13935490-13935512 TTCTTCACCTGCAAAATATAAGG - Intergenic
1037274183 8:17159665-17159687 ATGTGTATATGTAAAATATATGG + Intronic
1037278039 8:17202800-17202822 ATATTAAACTCTAAAATATATGG + Intronic
1037308920 8:17534787-17534809 ATTTTTATCTGTAAACTATATGG + Intronic
1037728335 8:21502750-21502772 ATTTTCACCTGGGAAATTTAAGG - Intergenic
1037869061 8:22474401-22474423 ATGTTTATGTGTAAAACATAGGG + Intronic
1039202349 8:35109898-35109920 ATGTTCACCTGTTAATAGTAAGG - Intergenic
1039220974 8:35330379-35330401 TTCTTCATCTGTAAAATAAAGGG + Intronic
1040016307 8:42702998-42703020 ATCTTCACCTGTAAAACAAGGGG + Intronic
1040541757 8:48363661-48363683 GTGTTCATCTCTAAAAAATATGG + Intergenic
1041573742 8:59369312-59369334 ATCTTAACTTGGAAAATATATGG + Intergenic
1042045966 8:64652047-64652069 ATGTTCACCTGTTAATTTTCAGG - Intronic
1042321788 8:67483252-67483274 ATAATCACCTTTAAAATAAAAGG - Intronic
1042582968 8:70302552-70302574 ATGTTTACCTGTAAGTTATCAGG - Intronic
1042724153 8:71854151-71854173 ATCTTTATCTGTAAAATATGGGG - Intronic
1042776466 8:72437437-72437459 GTTTTCCCCTGTAAAAGATAAGG + Intergenic
1043766607 8:84142013-84142035 ATATTCACATGTTAAAAATATGG - Intergenic
1043821992 8:84878083-84878105 ATATTCCCCTGGAAAATAAATGG + Intronic
1047243775 8:123119764-123119786 ATATCCATCTGTAAAATGTAAGG + Intronic
1047398279 8:124523893-124523915 CTGTTCTGCTGTAGAATATAAGG + Intronic
1051181961 9:14420547-14420569 ATCTTCATCAGTAAAAGATAAGG - Intergenic
1051496205 9:17726135-17726157 ATTTTCACCAGTTAAATAAATGG + Intronic
1052111751 9:24594267-24594289 ATATGCACTTATAAAATATAAGG + Intergenic
1053127393 9:35593540-35593562 ATGAACACCTACAAAATATAAGG + Intergenic
1053244819 9:36526197-36526219 ATGTTCCCCTGTAAGTGATAGGG + Intergenic
1053704811 9:40740801-40740823 ATATTCATCTTTAAAAAATAAGG + Intergenic
1054414890 9:64864409-64864431 ATATTCATCTTTAAAAAATAAGG + Intergenic
1054850522 9:69842626-69842648 ATTTTCACATGTATAATATGAGG - Intronic
1054978934 9:71181208-71181230 ATGTTCACTTTTAAATTGTATGG + Intronic
1055040213 9:71862600-71862622 TTCTGCACCTGTAAAATAAAGGG + Exonic
1055085143 9:72306135-72306157 ATGTTCACCTGAATAATTTAGGG - Intergenic
1055362153 9:75503735-75503757 ATGTTTACATTCAAAATATATGG - Intergenic
1056074295 9:83022511-83022533 CTCTTCATCTGTAATATATAGGG - Intronic
1058135395 9:101302141-101302163 TTCCTCACCTGTAAAATGTAGGG + Intronic
1058439027 9:104990854-104990876 ATCTTCAACTGTAAAACATGAGG - Intergenic
1059937322 9:119323957-119323979 ATTTTCACCTGAAAAAATTATGG + Intronic
1059943458 9:119381090-119381112 ATGTTCACCTTAAAAATATCAGG + Intergenic
1203382335 Un_KI270435v1:67203-67225 ATCTTCACTTGAAAAATAGACGG + Intergenic
1186074339 X:5861204-5861226 ATGATCACCTTTAAAAAATTAGG + Intronic
1186631177 X:11350440-11350462 ATATTCATCTTTAAAATATTGGG - Intronic
1186736617 X:12472098-12472120 ATGTTGATCTATACAATATAGGG - Intronic
1187664809 X:21594570-21594592 ATGTTCAGATGTAAAATATAGGG - Intronic
1188655308 X:32686977-32686999 GTCTTCACCTGTAAAATGAAAGG + Intronic
1192050639 X:67721046-67721068 ATTATCACCTATAAATTATATGG - Intronic
1193385429 X:80865452-80865474 ATCTTCATCTGTAAAATGTGAGG - Intergenic
1193718619 X:84961086-84961108 ATATTCACCTCTATAACATATGG - Intergenic
1196904949 X:120422044-120422066 ATGTTCAACTGGCAAATATAAGG + Intergenic
1196916862 X:120545899-120545921 ATTTTAATCTGTAGAATATAAGG + Intronic
1197341523 X:125280321-125280343 ATATTCATATGTAATATATAGGG + Intergenic
1197349251 X:125362735-125362757 ATATTAACAGGTAAAATATAAGG + Intergenic
1198623484 X:138541045-138541067 AATTTCAGCTGTAAAATATGTGG + Intergenic
1198635428 X:138694193-138694215 ATGTTTACCTGTCAAATGCAGGG - Intronic
1200921412 Y:8616696-8616718 AAGTTCACCTGCAAAAAAAATGG + Intergenic
1201258269 Y:12131979-12132001 ATGTTTACATGTATTATATATGG + Intergenic
1201913350 Y:19156182-19156204 ATCTTCACCTGTAAGTTTTATGG - Intergenic