ID: 1138366546

View in Genome Browser
Species Human (GRCh38)
Location 16:56483312-56483334
Sequence ATTTGACAAGGGCTGTCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138366546 Original CRISPR ATTTGACAAGGGCTGTCCTA GGG (reversed) Intronic
901441075 1:9278843-9278865 CTTTGTCAAGGGCTGTGCCAAGG + Intergenic
903892182 1:26577262-26577284 GTTTGAGAAGTGCTGTTCTAGGG + Intergenic
905485125 1:38290637-38290659 TTTTGAGAAGGGCTGGCTTATGG - Intergenic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
910606299 1:89088607-89088629 ATTTGAGTAGGGCTGTCACATGG + Intergenic
915622819 1:157096372-157096394 ATTTGCCAGGCACTGTCCTAGGG - Intronic
915791365 1:158675179-158675201 ATATGACAAGCACTGTCCTCTGG + Intronic
918895599 1:190339975-190339997 ATTTCACTAGTGCTGTCATAAGG - Intronic
920578146 1:207078430-207078452 ATTTGAGAAGCACTGTTCTAGGG + Intronic
922528333 1:226323727-226323749 GTTTGACAGTAGCTGTCCTAGGG + Intergenic
923613421 1:235515943-235515965 TTTTGACAATGGCTGGCCAAAGG - Intergenic
1062828186 10:587441-587463 ATTTCACATGGGGTGACCTATGG - Intronic
1063681692 10:8194271-8194293 ATTTGACAAGCTTTGTCCTCAGG + Intergenic
1065678437 10:28203906-28203928 ATGTGACAGGGACTGTTCTAAGG - Intronic
1066694259 10:38064035-38064057 ATTTGAAAATGTCTGTCGTAGGG - Intronic
1066998261 10:42583154-42583176 ATTTGAAAATGTCTGTCTTAGGG + Intronic
1069183885 10:65397726-65397748 ATATGACAGGCGCTGTCCTAAGG - Intergenic
1075189609 10:120294622-120294644 AGTTGACAAGGGCTGGACTGTGG + Intergenic
1082958858 11:58900306-58900328 ATTATTCAAGGGCTGTCCTTGGG + Intronic
1082965530 11:58963165-58963187 ATTATTCAAGGGCTGTCCTTGGG + Intronic
1083033194 11:59613233-59613255 AGTTGACTAGGGCAGGCCTATGG + Intronic
1085883110 11:80491115-80491137 ATCTAGGAAGGGCTGTCCTAAGG - Intergenic
1088518066 11:110660086-110660108 ATTTGACAACCACTGACCTAGGG - Intronic
1093115669 12:15207789-15207811 TTTTGTGAAGGGCTGTCATAAGG + Intronic
1094320485 12:29177528-29177550 AACTAACAAGGGCTATCCTAGGG + Intronic
1096765981 12:53890141-53890163 CTATTATAAGGGCTGTCCTAAGG + Intergenic
1098064301 12:66596386-66596408 ATTTTATAAGAGCTGTCCAATGG + Intronic
1100752361 12:97712765-97712787 TTTTAAAAAGGGCTATCCTAAGG + Intergenic
1107196252 13:37655830-37655852 ATTTGTCAATCTCTGTCCTAGGG + Intronic
1112833644 13:103485704-103485726 ATTTTACTAGGGATGTCCCATGG + Intergenic
1115415792 14:33131993-33132015 GATTGAGAAGGGCTGTCCTTAGG + Intronic
1116593581 14:46811082-46811104 ATTTGACAAGTCCTGTACAACGG + Intergenic
1117253942 14:53959554-53959576 CTTTGAAAAAGGCTGTCCCAAGG - Intergenic
1120078619 14:80188916-80188938 TTTTAACAAGGCCTGTCCTCAGG + Intergenic
1120489094 14:85153885-85153907 ATTTGATATGGTTTGTCCTAAGG - Intergenic
1126151998 15:45531669-45531691 ACTTCACAAGGGTTGTACTAAGG + Intergenic
1126693001 15:51302425-51302447 ATTTGACAAGGGCCCTCTGAGGG - Intronic
1126892175 15:53218325-53218347 ATTGGCTAAGGGCTGTCCCATGG + Intergenic
1127899343 15:63329711-63329733 ACTTGACCAGGGCTCTCCCAGGG - Intronic
1130990430 15:88872705-88872727 ATCTGATCAGGGCTGTTCTAGGG - Intronic
1131892839 15:96992266-96992288 TTTTGACAAGGCCTGCCCTCAGG - Intergenic
1132321227 15:100927068-100927090 ATTTGAGAAGTGCTGCTCTATGG - Intronic
1134054279 16:11159558-11159580 GTTTGAAAAGGGCTGTCATAGGG + Intronic
1137560725 16:49500443-49500465 ATTTGAGATGAGCTGTCCCACGG - Intronic
1138135634 16:54519080-54519102 ATGTGACAAGGGCTGTCCAAAGG - Intergenic
1138366546 16:56483312-56483334 ATTTGACAAGGGCTGTCCTAGGG - Intronic
1140320147 16:73942711-73942733 ATTTGAAAAGTGCTGCTCTATGG + Intergenic
1140692276 16:77495966-77495988 ATTAGACAACTGGTGTCCTATGG + Intergenic
1143566973 17:7728166-7728188 ATTAGACAAGGGTAGACCTAGGG + Intronic
1146115927 17:30138858-30138880 ATTTGATAATAGCTATCCTAAGG + Intronic
1149418532 17:56485780-56485802 ATTTGAGAAGCACTGTTCTAGGG - Intronic
1149797350 17:59533016-59533038 ATTTGAGAGGGGCCTTCCTAGGG - Intergenic
1153212509 18:2783316-2783338 CTTTGAGAAGGGCTGTCCCAGGG + Intronic
1153719676 18:7889172-7889194 ATTTGATAAGGAGTGTCTTAAGG + Intronic
1157107752 18:44790773-44790795 AGTTGAGAAGCACTGTCCTAGGG + Intronic
1157127833 18:44973923-44973945 GTCTGACAAGCCCTGTCCTAAGG - Intronic
1158360242 18:56664594-56664616 ATGTGCCAAGGGCTGTATTAAGG - Intronic
1158518591 18:58151264-58151286 ATTTGAGAATGGCTCTCCAAGGG + Intronic
1158638910 18:59185588-59185610 ATGTGATAGGGGCTGTGCTAAGG - Intergenic
1161585395 19:5102748-5102770 AGTGGACCAGGGCTCTCCTATGG - Intronic
1162162792 19:8731232-8731254 GTTTGACATTGGCTGTCCCATGG + Exonic
1166211722 19:41310675-41310697 ATTTGAGAAGGGCTGGTCTGAGG - Intronic
925052390 2:827085-827107 CTTTGACTATGGCTGCCCTAAGG + Intergenic
936559651 2:113526142-113526164 ATTTGAGAAGGGGTGTCTAAGGG + Intergenic
938675724 2:133632046-133632068 ATTTTAAAAAGGCTGTCCCAAGG + Intergenic
939681171 2:145135114-145135136 ATTTGACAAAGTCTGGGCTATGG - Intergenic
944658720 2:201902322-201902344 ACTTGACAAGTGCTGTCACAGGG - Intergenic
945749293 2:213760830-213760852 ATTTGGCAAGGGACATCCTATGG + Intronic
947767226 2:232645455-232645477 TTTTGATCAGGGCTGTCCCAAGG - Intronic
948072042 2:235135592-235135614 ATTGGAGGAGGGCTGTCCAAGGG - Intergenic
1170149371 20:13213505-13213527 ATTAGAGGAGGGCTGTCCTCAGG - Intergenic
1170149652 20:13216391-13216413 GTTTGTCAACCGCTGTCCTAAGG - Intergenic
1172518770 20:35554058-35554080 CTTTGCAAAGGGCTGTCCTAAGG - Intronic
1173285922 20:41671384-41671406 ACTTGTTAAGGGCTGTCCCAGGG + Intergenic
1174215413 20:48912505-48912527 ATTGCATAAGGGCTGTTCTAGGG - Intergenic
1175438517 20:58973104-58973126 ATTGGTCAAGGACTGCCCTACGG - Intergenic
1175493388 20:59394399-59394421 ATTTTTCTAGGGCTGTCCAAAGG + Intergenic
1177960099 21:27653595-27653617 ATTGGTCAAGAGTTGTCCTACGG + Intergenic
1179525734 21:41974751-41974773 ATTTGGGAAGTCCTGTCCTAGGG + Intergenic
1184251838 22:43264928-43264950 AATTTCCTAGGGCTGTCCTATGG + Intronic
1184958479 22:47909563-47909585 CTTTGACAAGAGCTGTTTTAAGG - Intergenic
950626453 3:14250966-14250988 ATTTGTCCAGTGCTGTCCAAGGG - Intergenic
950797732 3:15523934-15523956 AGGTGACAAGGACTGTCCTGGGG - Intergenic
951606354 3:24439116-24439138 ACTGGTCAAGGGCTGTCCTGTGG + Intronic
953805058 3:46061630-46061652 ATTTTAAAAGGACTGTCCTAAGG - Intergenic
955722814 3:61901719-61901741 ATTTGCCAACTGCTTTCCTAGGG + Intronic
959637659 3:108593212-108593234 ATGTGCCAAGCACTGTCCTAAGG + Intronic
960270200 3:115665602-115665624 ATTTGCCAAGGGCTGTGGTGGGG - Intronic
962869987 3:139480383-139480405 ATTTCAAAAGTTCTGTCCTAGGG + Intronic
965446336 3:168779406-168779428 CTTTGACAAGGCCTGCCCTCAGG + Intergenic
965861329 3:173154448-173154470 TTTTGTTAAGGGCAGTCCTAGGG + Intergenic
967039910 3:185682158-185682180 ATTTGATAAGGGGTTTGCTATGG + Intronic
967824660 3:193868870-193868892 ATTTGCAAAGGTCTGTCATAGGG - Intergenic
971705433 4:30036251-30036273 ATTTGACAAGTGATTTCCAAAGG + Intergenic
974488852 4:62537946-62537968 ACTTAACAAGGGATGGCCTAGGG + Intergenic
975083156 4:70304614-70304636 ATTGGACCAGGCCTTTCCTAGGG + Intergenic
975889740 4:79013172-79013194 AATTGAACAGGGCTGTCTTATGG + Intergenic
976799791 4:88975997-88976019 ATTTAACAAAGGATGACCTAAGG - Intronic
977725343 4:100290233-100290255 TTTTGCCAAGGGCTGTTCCATGG + Intergenic
978731529 4:112032888-112032910 ATTGGTCAAGGTCTGTCCCATGG + Intergenic
980824256 4:138054553-138054575 ATTTTACAAGGGCTCTTCTCAGG + Intergenic
981054236 4:140343555-140343577 ATTTAACAAGGGCGGTCACATGG + Intronic
983510984 4:168609498-168609520 ATTGGGCAAGGGCTGCCCTGTGG + Intronic
985426024 4:189831333-189831355 ATTTCTTAAGGGCTGTCCTGTGG + Intergenic
985654216 5:1121660-1121682 ATGGGACAAGGAATGTCCTAAGG - Intergenic
986252918 5:6077361-6077383 ACTTGAGCATGGCTGTCCTAGGG - Intergenic
986366449 5:7037328-7037350 ATTTGGCAAGGGGTGGACTATGG + Intergenic
987557611 5:19474764-19474786 ATTTAGCAAGAGCTATCCTAAGG - Intronic
987837898 5:23185624-23185646 AGTTGACACAGACTGTCCTATGG + Intergenic
988209427 5:28184173-28184195 ATTTGCCAATGGCTGTCTTCCGG - Intergenic
990479607 5:56196851-56196873 TTTTGACAATCACTGTCCTAGGG - Intronic
992352590 5:75945679-75945701 ATTTGTCAAGGTTTGTTCTATGG - Intergenic
994206261 5:97039321-97039343 ATTGAACATGGGCTGCCCTATGG + Intergenic
994617748 5:102127627-102127649 TCTTAACAAGGGCTGTCCTCAGG - Intergenic
995089754 5:108160609-108160631 ATATGAAAAGGGCTTCCCTATGG - Intronic
995104073 5:108353574-108353596 TTTTAACAAGGCCTGTCCTCAGG + Intronic
995980691 5:118099418-118099440 AGGTCACAAGGGCTGTCCTGAGG + Intergenic
999052778 5:148541778-148541800 AGTTAACAAGGGCTTTCCTATGG + Intronic
999416021 5:151396735-151396757 ATGTGACAAGCACTGTGCTAAGG + Intergenic
999812936 5:155145048-155145070 TTTTGACTGGGGCTATCCTAAGG - Intergenic
999835387 5:155364728-155364750 GTTTGAGAAGCACTGTCCTAGGG + Intergenic
1000831229 5:166103260-166103282 ATTGGAAAAGCGCAGTCCTAGGG + Intergenic
1001058034 5:168465354-168465376 CTTTGGCAAGGGCTGCCCTGTGG - Intronic
1008650313 6:53554429-53554451 ATTTGACAATGGCTGTGCATGGG + Intronic
1009807655 6:68623228-68623250 ATTTATCAAGTGCTGTCCAAAGG + Intergenic
1010085576 6:71913809-71913831 ATTTGCCCAGGGGTGTCCTCAGG - Intronic
1016079378 6:139837093-139837115 ATGTGACAAGGGCCGTCATAAGG + Intergenic
1017031297 6:150225113-150225135 ATTTAACAAGATCTGTCCTGAGG - Intronic
1017538000 6:155369253-155369275 ATTTAAGAAGAGCTGTCCCAGGG - Intergenic
1021035640 7:15795008-15795030 CTTTTACAAGGGTTGTCCTTTGG + Intergenic
1029781173 7:102735355-102735377 ATTTGTTAAGGGCTGTTTTATGG + Intergenic
1031210999 7:118825950-118825972 GTTTGAGAAGCCCTGTCCTAGGG + Intergenic
1032266119 7:130371145-130371167 ATTGGACAAGAACTGGCCTAGGG + Intergenic
1033554265 7:142474692-142474714 ATTGGACATCGGCTGTCCTTTGG + Intergenic
1034307357 7:150055417-150055439 ATTGGACAAGGATTCTCCTAAGG + Intergenic
1034799490 7:154045270-154045292 ATTGGACAAGGATTCTCCTAAGG - Intronic
1038961300 8:32523185-32523207 AGTTGGAAAGGGATGTCCTAAGG - Intronic
1039722361 8:40177941-40177963 TTTTGTCAAGGGCTGCCCTGAGG + Intergenic
1040639537 8:49317124-49317146 ATTTGGAATGGGTTGTCCTATGG + Intergenic
1044761513 8:95522502-95522524 ATTTGTCAAAGGGTGTCCCATGG - Intergenic
1046460985 8:114535703-114535725 AGTTTACAAGGCCAGTCCTATGG - Intergenic
1048179960 8:132185390-132185412 AGTTGACCAGTGCTGTCCTGTGG + Intronic
1049008841 8:139874111-139874133 AACTGACCAGGGCTGTCGTAAGG + Intronic
1049339592 8:142105009-142105031 ATTTGCCCTGGGCTGTCCTGGGG + Intergenic
1049893218 9:90230-90252 ATTTGAGAAGGGGTGTCTAAGGG - Intergenic
1053734429 9:41090284-41090306 ATTTGAGAAGGGGTGTCTAAGGG - Intergenic
1054693957 9:68341289-68341311 ATTTGAGAAGGGGTGTCTAAGGG + Intronic
1057915356 9:99051213-99051235 ATTTGTCAAGTGCTGTTCTGTGG - Intronic
1061489235 9:130936114-130936136 ATTTCACAAGGGCTGTTATGGGG - Intronic
1061841638 9:133361836-133361858 ATTTGATGGGGGCTGTCATACGG + Exonic
1202803288 9_KI270720v1_random:22306-22328 GTTTGTCAAAGGCTGTGCTATGG - Intergenic
1186105986 X:6206391-6206413 ATTTGACAAAGACTGTAATATGG - Intronic
1187562922 X:20419287-20419309 AGTTGAGAAGCGCTGCCCTAGGG - Intergenic
1188745021 X:33830736-33830758 ATTTGTTAAGGGCCGTCCTTGGG + Intergenic
1193902004 X:87191761-87191783 AGATGACTAGGGCTGTCTTATGG + Intergenic
1195913069 X:109908484-109908506 ATTTGGCAAGGGTTATCCCATGG - Intergenic
1199542090 X:148968468-148968490 ATTTGAGAACGACTGTCCTAGGG + Intronic
1199790528 X:151151133-151151155 ATCTGACATGGGCTCTCCTTAGG - Intergenic
1201726535 Y:17158157-17158179 ATTTCACAAAGGATGTCCTTAGG - Intergenic