ID: 1138369159

View in Genome Browser
Species Human (GRCh38)
Location 16:56510952-56510974
Sequence TGGAGTAAATGGAGAAACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 286}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138369159_1138369163 3 Left 1138369159 16:56510952-56510974 CCATCGTTTCTCCATTTACTCCA 0: 1
1: 0
2: 0
3: 21
4: 286
Right 1138369163 16:56510978-56511000 ATATTAGCTACATGAAGGAGAGG 0: 1
1: 0
2: 1
3: 29
4: 268
1138369159_1138369162 -2 Left 1138369159 16:56510952-56510974 CCATCGTTTCTCCATTTACTCCA 0: 1
1: 0
2: 0
3: 21
4: 286
Right 1138369162 16:56510973-56510995 CAAATATATTAGCTACATGAAGG 0: 1
1: 0
2: 3
3: 32
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138369159 Original CRISPR TGGAGTAAATGGAGAAACGA TGG (reversed) Intronic
900471885 1:2859174-2859196 TAAAGTAAATGGAGGAAGGAAGG + Intergenic
901394934 1:8974246-8974268 AGGAGTGAATTGAGAAACCAAGG + Intronic
901588554 1:10319053-10319075 TGGAGTAGATGGAAAAATGAAGG + Intronic
902755695 1:18547947-18547969 TGGGGTAAATGGAGAAGCACAGG + Intergenic
902854493 1:19190993-19191015 TGGCTAAAATGGAGAAACCAAGG - Intronic
903800459 1:25963468-25963490 TGGAGTGAAGGGAGAAAGGAAGG + Intronic
903814351 1:26053846-26053868 TGGAATGAATGAAGGAACGAAGG + Intronic
904319574 1:29688142-29688164 TGGAGTAGATTGATAAACAAAGG - Intergenic
905483447 1:38277416-38277438 ATGAGTGAATGGATAAACGATGG - Intergenic
907923621 1:58935671-58935693 TGGAGGAAATGCAGAAAGGCTGG - Intergenic
908178131 1:61576616-61576638 TGGGGTAAATAGTGAAATGAAGG - Intergenic
908730070 1:67216966-67216988 TAGGGTAAAGGGAGAAACCAAGG + Intronic
909432947 1:75611048-75611070 TGGAGTTATTGAAGAAATGATGG - Exonic
909589260 1:77327686-77327708 TGGAGGGGAGGGAGAAACGAAGG - Intronic
909724419 1:78816810-78816832 TGGAGGAAAGGAAGAAATGAAGG - Intergenic
910440280 1:87244753-87244775 TGGAGGAACTGCAGAAACCATGG - Intergenic
911599087 1:99828498-99828520 TAGAGAAAATGAAGAAACAAAGG + Intergenic
911599244 1:99830457-99830479 TGGAGTAGCTGGAGAAACTGTGG - Intergenic
912459732 1:109822620-109822642 TTGAGAAAATGGAGAAGCGGAGG - Intergenic
915100797 1:153498341-153498363 TGGAAGAAAAGGAGAAACGCAGG - Intergenic
916218129 1:162416217-162416239 TAGAGAAAATGGGGAAATGAAGG + Intergenic
916374241 1:164134482-164134504 TGGAGAGAATGGATAAACTATGG - Intergenic
916665522 1:166963636-166963658 TGGAGGGAATGGGGAATCGATGG - Intronic
916900390 1:169215949-169215971 TGGAAGAAATGGAGAGATGATGG + Intronic
917726387 1:177831505-177831527 AGGAGTAATTGAAGAATCGAAGG - Intergenic
920230854 1:204468821-204468843 TGAAGGACATGGAGAAAGGAAGG + Intronic
920537496 1:206748203-206748225 TGGAGGAAAGGAAGAAACCAAGG - Intergenic
921671266 1:217926533-217926555 TAGACTAAATGGAGTAAGGAAGG - Intergenic
922131169 1:222780300-222780322 TGGAAAAAATGGAGAGATGATGG - Intergenic
923850824 1:237792515-237792537 TGGGGCAAATGGAGGAAGGATGG + Intronic
924357732 1:243200797-243200819 TGTAGTACAAGGAGAAATGAGGG - Exonic
924884530 1:248199987-248200009 TGGTGGAAATGGATAAATGATGG + Intergenic
1063036735 10:2293687-2293709 TAGAGAAAATGGAAAAGCGAAGG - Intergenic
1065447248 10:25815629-25815651 TGAAGTAAATGCAGACACTATGG - Intergenic
1065556129 10:26917339-26917361 AGGAGAAAATGGAGAAATGGGGG + Intergenic
1065634821 10:27720784-27720806 TGCAATAAATGGAGAGAGGAAGG + Intronic
1065969712 10:30796651-30796673 TGCACTGAATGGAGAAATGATGG - Intergenic
1067555368 10:47265822-47265844 TGGACTAAATAGAGAAAATATGG + Intergenic
1068292328 10:55020337-55020359 TGTAGTAAATGCTGAAAAGATGG + Intronic
1068509461 10:57945822-57945844 TGGTGTAGATGGAGAAATCAAGG - Intergenic
1070484928 10:76921067-76921089 TAGAATAGATGGAGAAATGAAGG + Intronic
1072359291 10:94643573-94643595 TTGAGAAAATGAATAAACGAAGG - Intergenic
1073121533 10:101125112-101125134 TGGAGCCAAGGGAGACACGAAGG + Intronic
1073906966 10:108293016-108293038 TGGAATAAATGAAGAAAAGAAGG - Intergenic
1075185514 10:120252750-120252772 TGGAGGAAATGAAGAAAGGTGGG - Intergenic
1075623544 10:123945604-123945626 TGGAGTAATTGGAGACAGGGAGG + Intergenic
1076296944 10:129392901-129392923 TGGAGGGAATGGAATAACGACGG - Intergenic
1077772498 11:5235427-5235449 AGGAAGAAATGGAGAAAGGAAGG + Intergenic
1078441749 11:11373882-11373904 GGGAATAAAAGGAGAAATGAAGG + Intronic
1078706265 11:13746981-13747003 TGCAGTAAATCCAGAAATGAGGG + Intergenic
1086390217 11:86355979-86356001 TGAAGTAGAAGGAGAAACCAAGG - Intergenic
1086867832 11:92001686-92001708 TGGAGAAAATGAAGGAAGGAGGG + Intergenic
1087754270 11:102038443-102038465 TGAAGTACAAGGAGAAACAAAGG + Intergenic
1087890716 11:103534794-103534816 TGGAGGTAATGGGGAAATGATGG + Intergenic
1090941877 11:131394244-131394266 TGGAGTAGAGAGAGAAATGAGGG - Intronic
1090949563 11:131461547-131461569 TGGAGGAAATGGGGAGATGATGG + Intronic
1091610745 12:2005981-2006003 TGGAGTATATGAAGAAACTCTGG - Intronic
1092811198 12:12272867-12272889 TGCAGTGAATTGAGAAATGAAGG + Intergenic
1093985589 12:25528803-25528825 TGGTGTTAAAGGAGAAAGGAAGG - Intronic
1094397408 12:30022925-30022947 TTGATTAAATGGAGAAAACAGGG + Intergenic
1096269627 12:50154473-50154495 TGAAGTATATGAAGAAAAGATGG - Intronic
1097002809 12:55892404-55892426 AGGAGTAAATGAAGACACCAAGG + Intergenic
1097531340 12:60803916-60803938 TGGAATAAATGCATAAACTATGG - Intergenic
1098079519 12:66769295-66769317 TGGAGGAAATGGAGATACTGAGG + Intronic
1099791261 12:87337312-87337334 TAGTGTAAATGGAGAATTGAGGG - Intergenic
1102198116 12:111038810-111038832 TGTAGAAAATGGAGAAACCACGG + Intronic
1102898772 12:116619916-116619938 GGGAGTAAAGGGAGGAACAAAGG + Intergenic
1103010602 12:117455586-117455608 TGGAAAAAATGGAGAAAAGTGGG - Exonic
1103870745 12:124089862-124089884 ATGAGCAAATGGAGAAAAGAGGG - Intronic
1104116144 12:125750545-125750567 TGGAGGAAATGGAGATGCTATGG - Intergenic
1106322239 13:28652260-28652282 AGGAGTAAGTGGAGAAAGTAGGG - Intergenic
1107710884 13:43149610-43149632 TGGAATAAAGGGAGAACAGAAGG - Intergenic
1109568343 13:64150322-64150344 TGGAGGAAATGGAGAGAGAATGG - Intergenic
1110345969 13:74448231-74448253 TGGAGTAAAGGAAGGAAGGAAGG - Intergenic
1110931314 13:81221869-81221891 TGGGGTAAATGGGGAAATGTCGG - Intergenic
1111210152 13:85067645-85067667 TGGAAGAAATGGAGAAAGAAAGG + Intergenic
1111446650 13:88354767-88354789 TTGAGTAAATGGGGAAATGAAGG + Intergenic
1112045479 13:95592082-95592104 TTAAATAAATGGAGAAACTATGG + Intronic
1112048769 13:95624156-95624178 TGGGGAAAACGGAGAAAGGAAGG - Intronic
1112927355 13:104693035-104693057 TGGAGTAGAGGGAGAAACCTAGG - Intergenic
1114602163 14:23965811-23965833 TGCCAGAAATGGAGAAACGAGGG + Exonic
1114606332 14:24000912-24000934 TGCCAGAAATGGAGAAACGAGGG + Exonic
1114611884 14:24048205-24048227 TGCCAGAAATGGAGAAACGAGGG + Intergenic
1115865051 14:37736584-37736606 TTGACTAAATGGAGAAACTGTGG + Intronic
1116798039 14:49412881-49412903 AGGAGTAAGAGGAGAAATGATGG + Intergenic
1116909083 14:50438778-50438800 TTGGGGAAATGGAGAAAGGAAGG - Intronic
1117025773 14:51618539-51618561 TGGAGTAAATGGAGTTAGGAGGG + Intronic
1117667452 14:58071605-58071627 AGGAGTAAATGTAGAAATAAGGG + Intronic
1118930594 14:70236708-70236730 AGGATTATATGGAGAAACTAGGG - Intergenic
1120019537 14:79512769-79512791 TGGAGTAAATGGAGGTATAATGG - Intronic
1120157358 14:81108507-81108529 TGGAATAAATGGAGACATTAAGG + Intronic
1121766898 14:96495515-96495537 TGAAATAAGTGGAGAAATGAAGG + Intergenic
1122340358 14:101024099-101024121 TGGAGTAATTGAAGAAACGGTGG + Intergenic
1123453720 15:20395677-20395699 TGGAGGAAAAGGAGAAAAGGAGG - Intergenic
1124485432 15:30110726-30110748 TAGTGCAGATGGAGAAACGATGG - Intergenic
1124518144 15:30386541-30386563 TAGTGCAGATGGAGAAACGATGG + Intronic
1124540509 15:30579712-30579734 TAGTGCAGATGGAGAAACGATGG - Intergenic
1124758144 15:32427869-32427891 TAGTGCAGATGGAGAAACGATGG + Intergenic
1125281443 15:38046048-38046070 TACACTAAATGAAGAAACGAAGG + Intergenic
1125360239 15:38857287-38857309 TGGAGGAAATGGAGACTTGAAGG + Intergenic
1127244483 15:57157105-57157127 TGGAGTAAGTGGAGTAAATAGGG + Intronic
1127919348 15:63481142-63481164 GGGAGTAAATGGAGGAAGGAAGG + Intergenic
1130366328 15:83242922-83242944 AGGGGAAAATGGAGAAATGATGG + Intergenic
1131138432 15:89957477-89957499 TTGAATCAATGGAGAAAAGATGG + Intergenic
1131937769 15:97525723-97525745 TGAAGGAAATGAAGAAAGGATGG + Intergenic
1134018363 16:10904972-10904994 TGGAGTGAATGGTGAAATGATGG - Intronic
1138369159 16:56510952-56510974 TGGAGTAAATGGAGAAACGATGG - Intronic
1139152340 16:64397639-64397661 TGGAAGAAATGGAGAAAACAGGG + Intergenic
1139196759 16:64928512-64928534 TGGAGTAAATAGAGAAAATATGG + Intergenic
1139818761 16:69701481-69701503 GGGAAGAAATGGAGAAAAGAAGG - Intronic
1140734740 16:77888186-77888208 TGGAGTAAAGGGAGACAGAATGG - Intronic
1141813179 16:86390216-86390238 TGGAGGAAGTGGAGGAACCAAGG + Intergenic
1141827349 16:86489945-86489967 TGGTGAAAATGAACAAACGATGG + Intergenic
1142710059 17:1718081-1718103 TGGAGTAAATGGGCAAAAGCAGG - Intronic
1143459577 17:7093068-7093090 TGGAGTCAATGGTGCAATGATGG - Intergenic
1144183250 17:12772039-12772061 TGGTGGAAATGGAGAGACAAAGG + Intergenic
1144670533 17:17130338-17130360 AGGAGAAAATGAAGAAAGGAGGG - Intronic
1144672917 17:17143090-17143112 TGGGCTGAGTGGAGAAACGAGGG - Intronic
1146390377 17:32416817-32416839 TAGTGTAAATGGAGAAAGGGAGG - Intergenic
1148825676 17:50392222-50392244 TAAAGTAAATGCAGAAACAAAGG + Intronic
1148922384 17:51050354-51050376 AGGATTAAATGGAGAAAAAATGG - Intronic
1149066814 17:52490359-52490381 ATGAGTATATGTAGAAACGAGGG + Intergenic
1150918560 17:69460264-69460286 TGGGGTACATGGAGAAAGGGTGG + Intronic
1203192380 17_KI270729v1_random:200780-200802 TGGATTAAATGGACTACCGAGGG - Intergenic
1203201745 17_KI270730v1_random:217-239 TGGATTAAATGGACTACCGAGGG - Intergenic
1155247715 18:23925723-23925745 TGGAGTAAATGTAGAACTGTAGG + Intronic
1155683890 18:28522709-28522731 TTGAGTAAAGGGAGCAAGGAAGG - Intergenic
1155727446 18:29105763-29105785 TGGATTAAATGGAGAAGAGTTGG + Intergenic
1155897325 18:31346490-31346512 AGGAGTAATTGGAGATAAGAGGG - Intronic
1157196704 18:45625740-45625762 AGGAGTAAAAGGAAAGACGACGG + Exonic
1157268490 18:46249761-46249783 TGGAGGAAAAGGAGATAGGATGG - Intronic
1158008098 18:52696316-52696338 TGGTTGAAATGGAGAAATGAAGG - Intronic
1158297984 18:56020350-56020372 TGGAGTAAATGAAGAATCTCAGG - Intergenic
1161827950 19:6581964-6581986 GGGAGAAACTGGACAAACGAAGG + Intergenic
1163172494 19:15542049-15542071 TGGTATAAATGGAGAAACTGAGG - Intronic
1164425959 19:28142205-28142227 TAGAGTAAATGGATAAAAGGAGG + Intergenic
1165594134 19:36997708-36997730 AGGAGTGAATGAAGAAATGAGGG + Intronic
1165962536 19:39547314-39547336 TGGAATAAATGCAGCAATGATGG - Intergenic
924963903 2:58137-58159 AGGAGAAAATGGAGAGATGATGG + Intergenic
926481575 2:13403581-13403603 TGGAGGAAAAGGAGAAAAGGAGG + Intergenic
928648694 2:33382691-33382713 TGCAATAAATGGAGAAACTAAGG + Intronic
928919608 2:36512950-36512972 TGGGGTAAAGGCAGAAACGGCGG - Intronic
931083709 2:58805013-58805035 TGAAGTAAATGGAGAATCATTGG + Intergenic
933698989 2:85241006-85241028 TTAAGGAAATGGAGAAAGGAAGG + Intronic
934966103 2:98723939-98723961 TTCTGTAAATGGAGAAACCAAGG - Intronic
935383567 2:102478535-102478557 TGAGGGAAAAGGAGAAACGAGGG - Intronic
936688915 2:114862704-114862726 AGGAGTAAAAGGAGAAATGTAGG + Intronic
936771293 2:115916749-115916771 TGGAGTAAAATGAGAAAACAAGG - Intergenic
937962059 2:127467658-127467680 TGGAGTAACTGGGAAAATGAAGG - Intronic
938136553 2:128763453-128763475 TGGAGTAAATAAAGAAATTAAGG - Intergenic
938218853 2:129548416-129548438 TTAAGTAAATGAAGAAAGGAAGG - Intergenic
940470743 2:154096637-154096659 TGGACTATATGGTGAAAGGATGG - Intronic
941006532 2:160252960-160252982 TGGAGAAAATGGAGAGAAAAGGG - Intronic
941697910 2:168573084-168573106 TGGACCAAATGGAGAAAAAAGGG + Intronic
942763800 2:179430146-179430168 TGGAGGGAATGGGGAGACGATGG + Intergenic
942812176 2:180012375-180012397 TGAATTAAATGGAGATATGATGG + Intergenic
942906908 2:181193984-181194006 TTAAGTAAATGGATAAACTATGG + Intergenic
943657126 2:190521631-190521653 TGGATTAAAGGGAGAATGGAAGG - Intronic
943812691 2:192209287-192209309 ATGAGTAAATGAAGAAAAGAAGG - Intergenic
943931698 2:193862478-193862500 TGGAGTTAATGGAGAAATAGTGG + Intergenic
943967727 2:194358927-194358949 TGGAGTACAAGAAGAAAGGAAGG + Intergenic
944684679 2:202107686-202107708 GGGAGTAAATGCAGAAAGAAAGG + Intronic
945943638 2:215973554-215973576 TGGAGCAAATGGATAAACGCAGG + Intronic
946424510 2:219586022-219586044 TGGACTAGAGGGAGAAAGGACGG + Intergenic
947944994 2:234093641-234093663 TGGAGAAAATGGACAGAGGACGG - Intergenic
948326108 2:237122705-237122727 GGGAGTAAAAGGAAAAAAGAAGG + Intergenic
1170115534 20:12854897-12854919 TGGAGTAAATGGACACACATAGG + Intergenic
1170345953 20:15387420-15387442 AGGAATAAAAGGAGAAAGGATGG - Intronic
1170418732 20:16171365-16171387 TGGAGGAAAGGGAGGAAGGAAGG + Intergenic
1173184558 20:40830691-40830713 TGGAGGAAATGGAGCAACATGGG + Intergenic
1173371364 20:42439426-42439448 TGGAGTAATTGAAGAAACATAGG - Intronic
1174399526 20:50268461-50268483 GGGAGAAAATGGAGAGAGGAGGG - Intergenic
1174596864 20:51691042-51691064 CTGAGTAAACAGAGAAACGAGGG - Intronic
1175109617 20:56637985-56638007 TGGAGAAAATGGAGAAACACAGG + Exonic
1175486172 20:59348163-59348185 TGAAGTAAATGGACAGAAGATGG - Intergenic
1175562551 20:59942875-59942897 TTGAATAAATGAAGAAATGAAGG - Intronic
1178188074 21:30247246-30247268 TGGAGTAATTAGAGTAATGAAGG + Intergenic
1178194802 21:30332371-30332393 GGAAGTAAATGGTGGAACGAGGG - Intergenic
1178666514 21:34551895-34551917 TCCAGTCAATGGAGAAAGGAAGG + Intronic
1181327660 22:22062770-22062792 TTGAGCAAATGGAGAAATAATGG - Intergenic
1181992676 22:26849441-26849463 AGGAGTAAGTGCAGAAAAGAGGG - Intergenic
1183625699 22:39000011-39000033 TGGAGGAAATGGAGAGAGGATGG - Intergenic
1183982954 22:41553253-41553275 TGGAGTTGATGGAGAAAGGTTGG - Intergenic
949769604 3:7565249-7565271 TGGATTAAATGGATAAATGATGG - Intronic
955848405 3:63193172-63193194 TAGAGGAAATGGAGGAAGGAGGG - Intergenic
956551966 3:70471259-70471281 TGGAGGAAAGGTAGAAACAAAGG - Intergenic
957465928 3:80590811-80590833 AGCAGTAAATGGACAAACAATGG + Intergenic
957542532 3:81592276-81592298 TGGAGGAAATGGAGAGATGTTGG - Intronic
958184381 3:90101604-90101626 TGGAGTCAATGGGGAAATAATGG - Intergenic
958419767 3:93917192-93917214 TGGAGGAAATGGAGACAGAAAGG - Intronic
959422161 3:106142357-106142379 TGGAGTAAATGGGGATCCGAAGG + Intergenic
960166141 3:114403805-114403827 TGGAGAAACTGAAGAAATGAAGG + Intronic
960385220 3:117014560-117014582 TGGAGAAAATGGTGAGAAGAGGG - Intronic
963307132 3:143665236-143665258 TGGGGTAAATAAAGAAATGAAGG + Intronic
963487823 3:145958663-145958685 TGGAAAAAATGGCGAAAGGAAGG + Intergenic
964296714 3:155241011-155241033 AGGAGGAAAGGAAGAAACGAAGG - Intergenic
966095682 3:176198986-176199008 TTGAAAAAATGGAGAAATGAGGG + Intergenic
966692694 3:182758083-182758105 AGGAGAAAAGGGAGAAAGGAAGG + Intergenic
970488038 4:16544193-16544215 AGGAGCAATTGGAGAAAAGACGG + Intronic
972152892 4:36117087-36117109 TGAAGTATATGTAGAAAGGAAGG - Exonic
972231126 4:37073810-37073832 TGGAGAAAGTGGAGAAGTGAGGG - Intergenic
974295979 4:59999489-59999511 AGGAGAAAATGGGGAAAAGAAGG + Intergenic
974801147 4:66819714-66819736 TGGGATAAATGGAGAGACGTTGG + Intergenic
975237261 4:72013818-72013840 TGGAGGAACTGGAGCAATGAAGG - Intergenic
975763378 4:77640552-77640574 TGAATTAAATGGAGATATGATGG - Intergenic
978384404 4:108166625-108166647 TAGAGTAAATAGAGACACGTGGG - Intronic
978404539 4:108365083-108365105 TGGAGGAAAGGGTGAAAAGAAGG + Intergenic
979185369 4:117784075-117784097 TGGACTGAATGGACAAAGGAAGG - Intergenic
979244074 4:118478683-118478705 TGTAGTACAAGGAGAAATGAGGG + Intergenic
979943619 4:126795983-126796005 TGGAGAAAATGGAGAGATGTTGG - Intergenic
981246093 4:142540512-142540534 TGGAGAAAACAGAGAAATGAGGG - Intronic
981985591 4:150850836-150850858 TGCAGTTAATGGACAAAGGAGGG - Exonic
982213395 4:153059467-153059489 TGGAGTGAAGGGAGAAGGGAAGG - Intergenic
984883487 4:184430078-184430100 TGGAGGAAATGAACAAAAGAAGG - Intronic
988192747 5:27961006-27961028 TGGGGTAAATGTAGAAATTAAGG - Intergenic
992689333 5:79227876-79227898 TGGAGTAAATGGAAAGAAGAGGG - Intronic
997113976 5:131105591-131105613 TGGAATAAATGGAAAACCAAAGG - Intergenic
997733507 5:136197240-136197262 TGGGGTAACTGGAGAGACGATGG + Intergenic
998928195 5:147151046-147151068 TGGAGAAAACTGAGATACGAAGG + Intergenic
999017613 5:148125432-148125454 TGGGGAAAATGGGGAAAGGAAGG + Intronic
999082413 5:148856732-148856754 GGGAGTAAAAGGTGAAAGGAGGG + Intergenic
999535050 5:152506981-152507003 TGGAGTAAATGGAACAGCCAGGG + Intergenic
999597967 5:153226555-153226577 TGGACTAAATAAAGAAATGATGG - Intergenic
1001200997 5:169716669-169716691 TGGAGGAAATGGGGAGAAGAAGG - Intronic
1001242474 5:170081034-170081056 TGGAGTAAATGAAATAAAGAAGG - Intronic
1001853119 5:174986790-174986812 TGGAGGAAATGGAGAAGTGGTGG - Intergenic
1001870164 5:175147162-175147184 TGGAGTATATGGAAAGACCATGG - Intergenic
1002006855 5:176241431-176241453 TAGAGAAAATTTAGAAACGAAGG - Intronic
1002219522 5:177669201-177669223 TAGAGAAAATTTAGAAACGAAGG + Intergenic
1003990573 6:11482459-11482481 TTCAGTAAATGCAGAAACAAAGG - Intergenic
1004031680 6:11876300-11876322 TGGAGGGAAGGAAGAAACGAAGG + Intergenic
1004086631 6:12455993-12456015 TGGTGTCAATGGACAAACCAGGG + Intergenic
1004160451 6:13208198-13208220 CGGAGTAGATGGAGAAACTAAGG + Intronic
1005871566 6:29977417-29977439 TGCAGAGAATGGAGAAAGGAGGG + Intergenic
1005938189 6:30540376-30540398 TGGGGTAAATGGGGATATGATGG + Intergenic
1006057915 6:31399633-31399655 TGCAGAGAATGGAGAAAAGAGGG - Intergenic
1007007568 6:38380032-38380054 TGGAGTAAATGAAGAAAGGTGGG + Intronic
1008022680 6:46598975-46598997 TGGAGTAAAAGTAGATAGGAAGG - Intronic
1009522305 6:64698533-64698555 TGGAGTAAATAGACAACCTATGG + Intronic
1010924253 6:81724413-81724435 TGGATTAAATGGAGGACTGAAGG - Intronic
1011339575 6:86298972-86298994 TGGAGTAAATGCAGAAGGGTGGG + Intergenic
1013066170 6:106686251-106686273 TGAATTAAATGGAGACATGATGG - Intergenic
1013336500 6:109168317-109168339 TGAAGTAAATGGAGAAGTGGGGG + Intergenic
1014046255 6:116891878-116891900 TGGAACAAAGGGAGAAATGAAGG - Intronic
1017190840 6:151651040-151651062 TGGAGGAGAAGGAGAAAAGAAGG - Intergenic
1017997403 6:159544293-159544315 TTTAGTAAATAAAGAAACGAAGG - Intergenic
1020790386 7:12620337-12620359 TAGAGGAAATGGAGAAATGTTGG - Intronic
1021258300 7:18422049-18422071 TGGAGTAAAAGTAGAATAGAAGG - Intronic
1021563549 7:21993111-21993133 TGGAGTTCATGGAGAACAGAAGG - Intergenic
1023523444 7:41072612-41072634 TGGAGTAAATGAAGAATGGTAGG + Intergenic
1024681271 7:51691533-51691555 AGAATTAAATGGAGAAAAGATGG - Intergenic
1024876392 7:54028883-54028905 CTGAGCAAATGGAGAAACAAAGG - Intergenic
1027848843 7:83423352-83423374 TGGAGAAAAGTGAGAAAGGAGGG - Intronic
1029039759 7:97560426-97560448 CTGAGTAAATGGTGAAATGAAGG + Intergenic
1029147966 7:98459829-98459851 TGGGGTAAAGGGAGAAACCAGGG - Intergenic
1030985809 7:116240479-116240501 TGGAGGAAAGGGAGGAGCGAGGG - Intronic
1031279736 7:119783064-119783086 TGGAGTGAATGTATAAACTATGG - Intergenic
1032637348 7:133724246-133724268 TGGAGTAACTGGAAAAGTGAAGG - Intronic
1032834083 7:135657629-135657651 AGCACTAAATGGAGAAAAGATGG - Intergenic
1033044427 7:137948419-137948441 TGGAGGAGATGGAGAAGCTATGG - Intronic
1035359010 7:158297546-158297568 TGTAGTCAAAGGAGAAATGAGGG - Intronic
1038297759 8:26311747-26311769 TGGAGGAACTGGAGAAAAAAGGG - Intronic
1038947488 8:32377243-32377265 TTGGGTAAATGGGGAAACAAAGG - Intronic
1039366371 8:36932325-36932347 TGGCATAAATGGAGAGAGGAGGG - Intronic
1039796898 8:40923446-40923468 TGGAGGAATTGCAGAAAAGAGGG - Intergenic
1041270731 8:56106149-56106171 TTGAGTCAGTGGAGAAAAGATGG - Intergenic
1041271582 8:56114012-56114034 TGGAGTGAATGAAGAGACTAGGG + Intergenic
1041764926 8:61408892-61408914 TAGAGTTTATGGGGAAACGATGG + Intronic
1041895211 8:62916783-62916805 TGAAGTAGAAGGAGAAATGATGG + Intronic
1043035769 8:75196997-75197019 TGGACAAAATGAAGAAAGGAGGG - Intergenic
1043219916 8:77648237-77648259 TTGAGTAAATGGACAAAGGCTGG + Intergenic
1044080594 8:87877658-87877680 TTCTGTAAATGGAGAAACTATGG + Intergenic
1044900732 8:96941591-96941613 TTGAGTAGATGGAGCAACCAAGG + Intronic
1045198294 8:99952326-99952348 TGGAGTAGATGGAGCACCTATGG - Intergenic
1046186609 8:110729728-110729750 AGGAGCAAAGGGAGAAAAGAAGG + Intergenic
1046612165 8:116437976-116437998 AGAACTAAATGGAGAAAAGAAGG + Intergenic
1047986753 8:130243307-130243329 TGGAGTACAGGGAGAGACGCAGG - Intronic
1048454192 8:134563285-134563307 GGGAGAAATTGGAGAAACTAAGG - Intronic
1049942405 9:560074-560096 TGGAATAAATGGGGAGAAGAAGG + Intronic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1059884838 9:118734346-118734368 TGGACTAAACAGAGAAACAAAGG + Intergenic
1060832628 9:126726888-126726910 AGGAATAAAAGGAGAAAGGAAGG - Intergenic
1061710244 9:132482451-132482473 TGGAGAAAAAGGGGAAAAGAGGG + Intronic
1062031113 9:134362411-134362433 TGGCATGAATGGAGAAACGCGGG - Intronic
1062085510 9:134646025-134646047 TGGAGTAAAAAGAGAAGGGATGG - Intronic
1185764289 X:2712231-2712253 TGGGGGAAATGGGGAAATGATGG + Intronic
1186833899 X:13418450-13418472 AGGAGAAAATGGAGAGACAATGG - Intergenic
1187770228 X:22687473-22687495 TGGAAAAAATGGAGAAATGTGGG - Intergenic
1190154098 X:47973686-47973708 GGGAGTGAATGGAGTAAAGAGGG - Intronic
1192165002 X:68822694-68822716 GGGAGGATAGGGAGAAACGAGGG + Intergenic
1192462827 X:71332079-71332101 TGGAGGAAATGGGGAGATGATGG + Intergenic
1192709387 X:73563713-73563735 TGGTCTAAATGGGGAAACCATGG + Intronic
1194244233 X:91492071-91492093 TGGAGAAAATGAAGAAAGAATGG - Intergenic
1194733738 X:97487140-97487162 TAGAGTAAATGGAGAAAATGTGG - Intronic
1194865691 X:99063155-99063177 AGGAGTAAGTAGAGAAAGGAAGG + Intergenic
1195368386 X:104149183-104149205 TGAAGTAAAAGGAGCAAGGAAGG - Intronic
1196244491 X:113384385-113384407 TGGAGCTAATGGAGAAAGGGAGG + Intergenic
1197573650 X:128180583-128180605 TGGAGTAAATGCTGAAATTAAGG + Intergenic
1198243034 X:134803000-134803022 TGGAGGAAAGGGAGAAAGTAGGG + Intronic
1198421717 X:136475083-136475105 AGCAGTAAAGGGAGAAAGGAAGG + Intergenic
1198605547 X:138333262-138333284 TGGATTAAATGGAGATATAATGG + Intergenic
1199280865 X:145997637-145997659 AGGAATATATGGAGAAAAGAAGG - Intergenic
1199482581 X:148313224-148313246 TAGAGTACATGAAGAAATGATGG + Intergenic
1200563214 Y:4733386-4733408 TGGAGAAAATGAAGAAAGAATGG - Intergenic
1201351438 Y:13046900-13046922 TGGTGTAAATGTAGAAAAAAAGG + Intergenic
1201463617 Y:14255777-14255799 TGGAGAACAGGGAGAAATGAAGG - Intergenic
1201731396 Y:17207675-17207697 TGGAGTTATTGCAGAAATGATGG - Intergenic