ID: 1138376851

View in Genome Browser
Species Human (GRCh38)
Location 16:56570084-56570106
Sequence TCACCCACTCCTGTATCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138376851_1138376856 19 Left 1138376851 16:56570084-56570106 CCATCAGATACAGGAGTGGGTGA No data
Right 1138376856 16:56570126-56570148 GTCACAGAGCAGCCCCAGGTTGG No data
1138376851_1138376857 20 Left 1138376851 16:56570084-56570106 CCATCAGATACAGGAGTGGGTGA No data
Right 1138376857 16:56570127-56570149 TCACAGAGCAGCCCCAGGTTGGG No data
1138376851_1138376858 24 Left 1138376851 16:56570084-56570106 CCATCAGATACAGGAGTGGGTGA No data
Right 1138376858 16:56570131-56570153 AGAGCAGCCCCAGGTTGGGCTGG No data
1138376851_1138376855 15 Left 1138376851 16:56570084-56570106 CCATCAGATACAGGAGTGGGTGA No data
Right 1138376855 16:56570122-56570144 CAAGGTCACAGAGCAGCCCCAGG No data
1138376851_1138376859 25 Left 1138376851 16:56570084-56570106 CCATCAGATACAGGAGTGGGTGA No data
Right 1138376859 16:56570132-56570154 GAGCAGCCCCAGGTTGGGCTGGG No data
1138376851_1138376852 -3 Left 1138376851 16:56570084-56570106 CCATCAGATACAGGAGTGGGTGA No data
Right 1138376852 16:56570104-56570126 TGAGAATAGAGCCTTTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138376851 Original CRISPR TCACCCACTCCTGTATCTGA TGG (reversed) Intergenic