ID: 1138376882

View in Genome Browser
Species Human (GRCh38)
Location 16:56570307-56570329
Sequence CAGTGGAAACAGCTTGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138376879_1138376882 -1 Left 1138376879 16:56570285-56570307 CCTTAGACACAGAATCATAGTGC No data
Right 1138376882 16:56570307-56570329 CAGTGGAAACAGCTTGGCCCTGG No data
1138376876_1138376882 19 Left 1138376876 16:56570265-56570287 CCCTCTGTCCATGAGTTGTGCCT No data
Right 1138376882 16:56570307-56570329 CAGTGGAAACAGCTTGGCCCTGG No data
1138376877_1138376882 18 Left 1138376877 16:56570266-56570288 CCTCTGTCCATGAGTTGTGCCTT No data
Right 1138376882 16:56570307-56570329 CAGTGGAAACAGCTTGGCCCTGG No data
1138376878_1138376882 11 Left 1138376878 16:56570273-56570295 CCATGAGTTGTGCCTTAGACACA No data
Right 1138376882 16:56570307-56570329 CAGTGGAAACAGCTTGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138376882 Original CRISPR CAGTGGAAACAGCTTGGCCC TGG Intergenic
No off target data available for this crispr