ID: 1138381871

View in Genome Browser
Species Human (GRCh38)
Location 16:56608343-56608365
Sequence CGCCTCGGCGCGGAAGGGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 169}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138381871_1138381887 24 Left 1138381871 16:56608343-56608365 CCAGCCCCTTCCGCGCCGAGGCG 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1138381887 16:56608390-56608412 TTCAGGGAACTGACCGCCCGCGG 0: 1
1: 0
2: 0
3: 4
4: 36
1138381871_1138381878 -5 Left 1138381871 16:56608343-56608365 CCAGCCCCTTCCGCGCCGAGGCG 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1138381878 16:56608361-56608383 AGGCGTCCCCGAGGCGCAAGTGG 0: 1
1: 0
2: 1
3: 3
4: 44
1138381871_1138381884 8 Left 1138381871 16:56608343-56608365 CCAGCCCCTTCCGCGCCGAGGCG 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1138381884 16:56608374-56608396 GCGCAAGTGGGCCGCCTTCAGGG 0: 1
1: 0
2: 0
3: 0
4: 50
1138381871_1138381879 -4 Left 1138381871 16:56608343-56608365 CCAGCCCCTTCCGCGCCGAGGCG 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1138381879 16:56608362-56608384 GGCGTCCCCGAGGCGCAAGTGGG 0: 1
1: 0
2: 0
3: 3
4: 26
1138381871_1138381883 7 Left 1138381871 16:56608343-56608365 CCAGCCCCTTCCGCGCCGAGGCG 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1138381883 16:56608373-56608395 GGCGCAAGTGGGCCGCCTTCAGG 0: 1
1: 0
2: 1
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138381871 Original CRISPR CGCCTCGGCGCGGAAGGGGC TGG (reversed) Exonic
900512963 1:3069038-3069060 CGCCTCGGCGCGGGATTGGGGGG - Intergenic
900513353 1:3070368-3070390 CGCCTCACCGCGGATGGCGCCGG - Intronic
901068928 1:6507760-6507782 CGTGCCGGCGCGGGAGGGGCCGG - Intronic
901483079 1:9539510-9539532 GGCCACGCCGCGGAAGGCGCGGG + Exonic
902042976 1:13505886-13505908 GGCCTGGGTGGGGAAGGGGCAGG + Intronic
902214121 1:14924039-14924061 CGCCGCGGCGGGGCGGGGGCGGG + Intronic
905369287 1:37474654-37474676 GGCCTCGGCGGGGAAGCGGCAGG + Intronic
906805704 1:48777016-48777038 CGCCTGGGCGCGGAAAAGGGAGG + Intronic
907704270 1:56819432-56819454 AGCCTCGGCCCAGATGGGGCAGG - Intronic
909433552 1:75616044-75616066 CGGCTCGGCTCGGCTGGGGCGGG + Intergenic
913161824 1:116152167-116152189 CGCCGCGGCTCGGAAGCGGCAGG + Intergenic
914702932 1:150150341-150150363 CGCCGCGGCGCCGACGGAGCGGG - Intronic
915438068 1:155924455-155924477 CGCCTCGGCCCTGAAAGTGCTGG + Intronic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
921923099 1:220690312-220690334 CGCCCCAGCCCGGACGGGGCGGG - Exonic
1063369602 10:5512516-5512538 GCCCACGGCGAGGAAGGGGCGGG - Intergenic
1064028794 10:11869976-11869998 CCCCGCGGCGGGGAAGGCGCCGG - Exonic
1065844683 10:29735437-29735459 CGCCTCGGGGAGGAGCGGGCCGG - Intronic
1067039873 10:42943625-42943647 CACCACGGGGTGGAAGGGGCTGG - Intergenic
1069942464 10:71964758-71964780 CGCCTGGACGCGGAAGGCGGGGG - Intronic
1070877536 10:79827072-79827094 CACCTCGCCGCGGGCGGGGCTGG - Intergenic
1071644031 10:87343118-87343140 CACCTCGCCGCGGGCGGGGCTGG - Intergenic
1073330077 10:102664515-102664537 CGCCTGGACCAGGAAGGGGCTGG + Intergenic
1077441688 11:2571902-2571924 CGCCTGGGAGGGGCAGGGGCAGG + Intronic
1078631781 11:13009989-13010011 CGCCTCGGCGCTGCGGGGGCCGG - Intergenic
1079451345 11:20601887-20601909 CGCCAAGGCTGGGAAGGGGCAGG - Intronic
1080628527 11:34052177-34052199 CGGCTCCGCGGGGGAGGGGCGGG + Intronic
1082206002 11:49434599-49434621 GGCCACGCCGCGGAAGGCGCGGG - Intergenic
1083659827 11:64246858-64246880 CGGATCGGCGGGGAGGGGGCGGG - Exonic
1083681571 11:64354080-64354102 CGCCTGGGGGCCGATGGGGCTGG + Exonic
1083802923 11:65057322-65057344 GGCCTCGGTGAGGAAGGGGCTGG - Intronic
1083886577 11:65576184-65576206 CACCTCCGCACGGACGGGGCGGG + Exonic
1084184556 11:67464771-67464793 GGCACCGGGGCGGAAGGGGCGGG - Intronic
1084636872 11:70398678-70398700 CGCCTGGCCGCGAAAGGGGAAGG + Intronic
1084888457 11:72224925-72224947 CGTCTCGGGGCGGATGGCGCGGG + Exonic
1085100451 11:73796117-73796139 CGCCCCAACTCGGAAGGGGCAGG - Intronic
1085457011 11:76670918-76670940 GACCTCGGCCGGGAAGGGGCGGG + Intergenic
1087432288 11:98069575-98069597 CCCCTTGGCGGGGAAGGGGAAGG + Intergenic
1089823017 11:121246084-121246106 CGCCTCAACTCAGAAGGGGCGGG - Intergenic
1094573085 12:31659210-31659232 CGCCGCGGCCCGGCAGGGGGCGG - Intronic
1095310617 12:40692927-40692949 CGCCTCGGCAGGGGAGGGGTGGG + Intronic
1095672263 12:44875750-44875772 CGCCTCGGGGCAGCATGGGCTGG - Intronic
1096773969 12:53953084-53953106 CTCCTGGGGGCGGGAGGGGCTGG + Intergenic
1097172901 12:57127731-57127753 GCCCTAGGCGCGGGAGGGGCAGG - Intronic
1100395967 12:94186684-94186706 AGTCTCGGGGCGGGAGGGGCAGG + Intronic
1103325496 12:120117242-120117264 GGGGTCGGTGCGGAAGGGGCGGG - Intronic
1103410800 12:120710385-120710407 GGGCCCGGCGGGGAAGGGGCGGG - Intergenic
1103778513 12:123383998-123384020 CGCCCCGCCGCCGAAGAGGCGGG + Exonic
1106720010 13:32427554-32427576 CACGGCGGCGGGGAAGGGGCCGG + Intronic
1107851528 13:44576940-44576962 GTCCTCGGGGAGGAAGGGGCCGG + Intronic
1108063393 13:46553848-46553870 CGCGTGGGCGCGGAAGAAGCGGG + Intronic
1112402195 13:99086698-99086720 CGGCGCGGCGCGGGCGGGGCGGG + Intergenic
1115755121 14:36521296-36521318 CTCCTCTGCGCGCCAGGGGCTGG + Intergenic
1116820369 14:49621198-49621220 TGCTTCTGCACGGAAGGGGCGGG - Exonic
1118530512 14:66700674-66700696 CGCCTCGGCCCCCAAGGTGCTGG - Intronic
1118752435 14:68816708-68816730 CGGCTCGGAACGCAAGGGGCCGG + Intergenic
1119759295 14:77140001-77140023 CGCCTTGGCGCGGCAGAGTCTGG + Intronic
1121342957 14:93115909-93115931 CGCGGCGGCGAGGAAGCGGCGGG + Intronic
1122137853 14:99645124-99645146 CGCGGCGGCAGGGAAGGGGCGGG - Exonic
1122300114 14:100726804-100726826 CGCCTCCGTGCGCACGGGGCCGG - Intronic
1122400951 14:101467054-101467076 CGTCTCTGGGCTGAAGGGGCGGG - Intergenic
1122905694 14:104800590-104800612 CGCCCCGGCGGGGAGGGCGCGGG - Intronic
1125181797 15:36887404-36887426 AGCCCCGCCGCGGAAGAGGCAGG + Intergenic
1128847732 15:70916726-70916748 CGCCCCAACTCGGAAGGGGCAGG - Intronic
1129424624 15:75454694-75454716 CCGCTCGGCGCGGATGGGGCGGG - Intronic
1132156500 15:99499462-99499484 CTCCTGGGCACGGAAGGGGCAGG + Intergenic
1132506555 16:312710-312732 CAGCTCTGCCCGGAAGGGGCAGG + Intronic
1132560223 16:590123-590145 CGCCCGGGCGCGGGCGGGGCGGG + Intronic
1136171735 16:28494165-28494187 CCCCCAGGGGCGGAAGGGGCCGG - Intronic
1136220044 16:28823060-28823082 CGCCGCGAGGCGGAAGGGGAGGG - Intronic
1138381871 16:56608343-56608365 CGCCTCGGCGCGGAAGGGGCTGG - Exonic
1141008146 16:80372430-80372452 CCACTCGGGGCTGAAGGGGCTGG + Intergenic
1141584939 16:85027700-85027722 CGCGCCTGCGCAGAAGGGGCTGG + Intergenic
1142393252 16:89816345-89816367 CGCCCAGGCGCAGGAGGGGCCGG + Intronic
1143750301 17:9022335-9022357 ATCCTCGGCGCGGCAGGGCCGGG + Exonic
1145094191 17:20009938-20009960 CACCCCGGCCAGGAAGGGGCGGG - Intronic
1146704666 17:34992302-34992324 CGCCTTAGCGAGGAGGGGGCTGG - Intronic
1148206971 17:45785033-45785055 CGCCGCGGAGGGGAAGGGGCAGG - Intronic
1148783776 17:50135435-50135457 CACCGGGGGGCGGAAGGGGCTGG - Intronic
1151662346 17:75525593-75525615 CAGCTCGGCGCCGCAGGGGCGGG - Intronic
1151945925 17:77319866-77319888 AGCCTCGGGGCGGCGGGGGCTGG + Intronic
1152649359 17:81484730-81484752 CGCCTGAGCCCCGAAGGGGCGGG + Intergenic
1153457392 18:5295781-5295803 GGCCAGGGTGCGGAAGGGGCTGG - Intronic
1153480679 18:5543644-5543666 CGCCGCGGCGCAGTAGTGGCTGG - Intronic
1153770855 18:8415529-8415551 CCCCTGGGCACGGAAGGTGCGGG + Intergenic
1154230636 18:12553135-12553157 CACCACAGCGGGGAAGGGGCTGG - Intronic
1155461741 18:26090975-26090997 TGCCACGGCGCGAAGGGGGCGGG - Intronic
1155654609 18:28178120-28178142 CGCTTCGGCGGGGCGGGGGCGGG - Intergenic
1156008622 18:32471130-32471152 GGCCTGGGCGGGGAAGGAGCCGG - Intergenic
1161327564 19:3670963-3670985 CGCGGCGGGGCGGAAGGTGCTGG + Intronic
1161333851 19:3700492-3700514 CGGCGCGGGGCGGACGGGGCGGG + Intergenic
1161864166 19:6821787-6821809 CTCCTCGGTGGGGAAGGGCCTGG - Exonic
1162778977 19:12996692-12996714 CGCCTGGAGGCGGGAGGGGCGGG + Intronic
1162962540 19:14136467-14136489 CGCCGCGCCGCAGCAGGGGCAGG + Exonic
1164994026 19:32706433-32706455 CGCCTCGGCCCCCAAGGGGTTGG - Intronic
1166306901 19:41940407-41940429 CGCGGCGGCGGGGGAGGGGCGGG - Intergenic
1166984184 19:46649697-46649719 CGCCACGGCGTGCAGGGGGCTGG + Exonic
1167915273 19:52735105-52735127 GGCCTGGGCGAGGTAGGGGCGGG + Intergenic
1167938069 19:52923473-52923495 GGCCTGGGCGAGGTAGGGGCGGG + Intergenic
1167938079 19:52923495-52923517 GGCCTGGGCGAGGTAGGGGCGGG + Intergenic
1168084410 19:54034816-54034838 CGCCCCAACTCGGAAGGGGCAGG - Intergenic
926089999 2:10043536-10043558 CCTCGCGGCGCGGGAGGGGCGGG - Exonic
926101908 2:10123152-10123174 CGCCTAGGCGGGAAAGGAGCCGG - Intronic
927713681 2:25340497-25340519 CCCTTCGGCGCGGACCGGGCTGG - Intronic
928964964 2:36966765-36966787 CGGCTCGCCGCGTAGGGGGCCGG + Intergenic
931349058 2:61471572-61471594 AGCCTAAGCGCGGAAGAGGCCGG - Intergenic
932593570 2:73080986-73081008 CTCCTCGGGTCGGTAGGGGCTGG - Intronic
937869378 2:126776736-126776758 CGCCTGGGCGGGGCTGGGGCGGG - Intergenic
938639770 2:133266479-133266501 CGCCTGGGCGGGGAGTGGGCTGG + Intronic
939311518 2:140483887-140483909 CGCCTCGGCGCCCAAAGTGCTGG + Intronic
947718118 2:232351963-232351985 CGCGCCGGTGAGGAAGGGGCGGG - Intergenic
947992337 2:234497252-234497274 CGGCGCGGCGCGGGAGGGGCCGG - Intergenic
948476189 2:238221345-238221367 CCGCTGGGCGGGGAAGGGGCCGG + Intergenic
1176125061 20:63471590-63471612 GGCGTCGGCGCCGAGGGGGCAGG + Intronic
1179794333 21:43774073-43774095 CCCCTTGGGGTGGAAGGGGCAGG - Exonic
1179911949 21:44455406-44455428 CGCGGGGGCGGGGAAGGGGCGGG - Intergenic
1182576454 22:31276498-31276520 CGGATCGGCGGGGAGGGGGCGGG + Intronic
1183211701 22:36455261-36455283 AGGCTCGGCGCGGGAGGGGCGGG + Intergenic
1184164746 22:42720700-42720722 CGCCTCGGGAAGGCAGGGGCAGG - Intronic
1184557457 22:45240964-45240986 GGCCGGGGCGGGGAAGGGGCGGG - Intergenic
952178709 3:30894897-30894919 CGCCTTTGCGGGGAAGGGGTGGG + Intergenic
954036979 3:47856138-47856160 CTGCTGGGCGCGGGAGGGGCTGG - Intronic
960101334 3:113746252-113746274 CGCGCCGGCGCGCGAGGGGCGGG - Exonic
961929378 3:130517106-130517128 CGCCGGGGCGGGGAAGGGTCGGG + Intergenic
968920009 4:3517629-3517651 CCCCTCAGCCCGGCAGGGGCAGG - Intronic
970202863 4:13627463-13627485 GGCCCCGGCGCGGGCGGGGCGGG - Exonic
974511805 4:62852995-62853017 CGCCTCGGCCCCCAAGGTGCTGG + Intergenic
977574002 4:98658403-98658425 GGCCTCGGCGCGCGAGGGGCTGG - Exonic
977607240 4:98995613-98995635 GGCCTGGGCGCGGGAGGGGGAGG - Exonic
983577181 4:169271503-169271525 AGTCGCGGCGCGGGAGGGGCTGG + Intergenic
986402782 5:7396040-7396062 CGCCACCGCGCGGGAGGGGGCGG - Intergenic
986684403 5:10263329-10263351 CGCCTCTGCGTGGAGGGGGGGGG + Intronic
999235205 5:150086428-150086450 GGCCTCGGTGGGGAAGTGGCAGG + Exonic
1001922848 5:175614003-175614025 CGGCTGGGTGAGGAAGGGGCTGG + Intergenic
1002991868 6:2245732-2245754 GGCCACCGCGCGGGAGGGGCGGG + Intergenic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006136216 6:31897620-31897642 CGCCGAGGTGCGGAAGGGGAGGG - Exonic
1007336719 6:41159908-41159930 TGCCTCGAGGAGGAAGGGGCTGG - Intronic
1007548392 6:42710616-42710638 TCACTCTGCGCGGAAGGGGCCGG + Intronic
1007558250 6:42783683-42783705 CGGCTCGGAGCGGGAAGGGCTGG + Intronic
1010033030 6:71289292-71289314 AGCCGCGGCGCGGAGGGGTCGGG - Intronic
1011277095 6:85642479-85642501 CGCCGCGGCGCGGGAGTGGGCGG - Intronic
1011448959 6:87472950-87472972 CGCGGGGGCGCGGAGGGGGCGGG + Intronic
1016597009 6:145814552-145814574 CGCCGCAGCGCGGACGGCGCCGG + Intronic
1017000266 6:149991612-149991634 CGCCTGAGTGCGGCAGGGGCAGG - Intergenic
1017010493 6:150060111-150060133 CGCCTGAGTGCGGCAGGGGCAGG - Intergenic
1018911191 6:168101595-168101617 CGGCTGGGCGGGGAGGGGGCGGG - Intergenic
1019577945 7:1746542-1746564 GGCCTCGGCTCGGAAGGCGCGGG - Exonic
1020235047 7:6348789-6348811 CGACGCGGCGCGGAGAGGGCGGG - Exonic
1023177591 7:37448610-37448632 GACCTCGGCGCGGCAGGGGAGGG - Intronic
1025129734 7:56369069-56369091 CCTCTCGGCGTGGGAGGGGCCGG + Intergenic
1026765089 7:73155153-73155175 CGGCAGGGCGCGGAGGGGGCGGG + Intergenic
1026839051 7:73658643-73658665 CGCCTCGGCCCCCAAGGTGCTGG - Intergenic
1026840414 7:73667721-73667743 CGGCGCGGCGCGGCCGGGGCGGG + Intergenic
1027041562 7:74964908-74964930 CGGCAGGGCGCGGAGGGGGCGGG + Exonic
1027082080 7:75237461-75237483 CGGCAGGGCGCGGAGGGGGCGGG - Intergenic
1028621433 7:92833341-92833363 CGCCGCGGCGCCGCTGGGGCGGG + Exonic
1029390660 7:100272007-100272029 CGGCAGGGCGCGGAGGGGGCGGG - Exonic
1032240007 7:130153257-130153279 GGCTCCGGCGGGGAAGGGGCTGG + Intergenic
1034975909 7:155449246-155449268 TCCCCCGGCGGGGAAGGGGCCGG + Intergenic
1034998651 7:155594241-155594263 GGCCTCGGCGTGGGAAGGGCAGG - Intergenic
1039576772 8:38629948-38629970 CGCCTCGGCCCCCAAGGTGCTGG - Intergenic
1040039143 8:42897915-42897937 CGCCGCGGCGCGGCCGGGGAGGG + Intronic
1046547443 8:115669133-115669155 CGGCTCGCCGCGGCCGGGGCCGG - Intronic
1048972650 8:139653916-139653938 AGCCTCAGAGCAGAAGGGGCCGG + Intronic
1049228145 8:141467453-141467475 TGCCTGCACGCGGAAGGGGCTGG + Intergenic
1049693850 8:143974200-143974222 AGCCCCGGCGCGGAAGGTGCTGG + Intronic
1049802500 8:144524585-144524607 CGGCTGCGCGCGGAAGGCGCCGG + Exonic
1051809320 9:21031661-21031683 CGGCTGGGCGCGGAAGGGCGGGG + Intergenic
1052048544 9:23821747-23821769 CGGCGCGGCGCGGGTGGGGCGGG - Intronic
1056992573 9:91424471-91424493 CGCTGCGGCGGGGAAGGGGTTGG + Intergenic
1057673847 9:97121344-97121366 CGACGCGGCGCGGAGAGGGCAGG + Intergenic
1058508836 9:105694511-105694533 CGCCCTGGCGCCGAGGGGGCGGG - Intergenic
1060407098 9:123378252-123378274 GGCATCGCCGGGGAAGGGGCTGG - Exonic
1062284129 9:135765568-135765590 CGCCCGGGCGGGGCAGGGGCTGG + Intronic
1062569678 9:137179334-137179356 CGGCTCGGGGAGGAAGGGGTCGG - Intronic
1186496500 X:10015710-10015732 GGCGGCGGCGCGGAAGGAGCTGG - Exonic
1186670241 X:11759337-11759359 CTCCTCGGGGCGGAGGGGGGGGG + Intronic
1195702675 X:107716648-107716670 CGCCCCGGCTCGGGAGGCGCCGG + Intronic
1200216591 X:154370768-154370790 CGCTGCGGCCCGGAAGGGGGTGG + Intronic
1200239605 X:154486735-154486757 GGCCGGGGCGCGGACGGGGCAGG - Intergenic