ID: 1138385613

View in Genome Browser
Species Human (GRCh38)
Location 16:56633797-56633819
Sequence CTGTGTCTGCAAAGGGACGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 177}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138385598_1138385613 29 Left 1138385598 16:56633745-56633767 CCCCAGGCTGCTGCTCCTGCTGC 0: 7
1: 7
2: 22
3: 186
4: 1141
Right 1138385613 16:56633797-56633819 CTGTGTCTGCAAAGGGACGTTGG 0: 1
1: 0
2: 3
3: 15
4: 177
1138385600_1138385613 27 Left 1138385600 16:56633747-56633769 CCAGGCTGCTGCTCCTGCTGCCC 0: 8
1: 9
2: 14
3: 190
4: 1259
Right 1138385613 16:56633797-56633819 CTGTGTCTGCAAAGGGACGTTGG 0: 1
1: 0
2: 3
3: 15
4: 177
1138385606_1138385613 5 Left 1138385606 16:56633769-56633791 CCGTGGGCTGTGCCAAGTGTGCC 0: 9
1: 3
2: 3
3: 17
4: 168
Right 1138385613 16:56633797-56633819 CTGTGTCTGCAAAGGGACGTTGG 0: 1
1: 0
2: 3
3: 15
4: 177
1138385599_1138385613 28 Left 1138385599 16:56633746-56633768 CCCAGGCTGCTGCTCCTGCTGCC 0: 7
1: 6
2: 22
3: 185
4: 1067
Right 1138385613 16:56633797-56633819 CTGTGTCTGCAAAGGGACGTTGG 0: 1
1: 0
2: 3
3: 15
4: 177
1138385608_1138385613 -7 Left 1138385608 16:56633781-56633803 CCAAGTGTGCCCACGGCTGTGTC 0: 1
1: 2
2: 4
3: 26
4: 168
Right 1138385613 16:56633797-56633819 CTGTGTCTGCAAAGGGACGTTGG 0: 1
1: 0
2: 3
3: 15
4: 177
1138385605_1138385613 6 Left 1138385605 16:56633768-56633790 CCCGTGGGCTGTGCCAAGTGTGC 0: 12
1: 5
2: 4
3: 9
4: 147
Right 1138385613 16:56633797-56633819 CTGTGTCTGCAAAGGGACGTTGG 0: 1
1: 0
2: 3
3: 15
4: 177
1138385603_1138385613 14 Left 1138385603 16:56633760-56633782 CCTGCTGCCCCGTGGGCTGTGCC 0: 4
1: 9
2: 10
3: 44
4: 420
Right 1138385613 16:56633797-56633819 CTGTGTCTGCAAAGGGACGTTGG 0: 1
1: 0
2: 3
3: 15
4: 177
1138385604_1138385613 7 Left 1138385604 16:56633767-56633789 CCCCGTGGGCTGTGCCAAGTGTG 0: 5
1: 10
2: 6
3: 16
4: 128
Right 1138385613 16:56633797-56633819 CTGTGTCTGCAAAGGGACGTTGG 0: 1
1: 0
2: 3
3: 15
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138385613 Original CRISPR CTGTGTCTGCAAAGGGACGT TGG Exonic
900598142 1:3491714-3491736 TTGTCTCTGCAGAGGGAAGTGGG - Intronic
900960812 1:5918154-5918176 TGGTGTCTGCAAAGGGCTGTGGG + Intronic
901667246 1:10833191-10833213 CTGAGTCTGGAAAGGTAAGTAGG - Intergenic
902416212 1:16241236-16241258 CTGCATCTGCAAAGGGACGTCGG - Intergenic
903459362 1:23509792-23509814 CTCTGCCTGCACAGGGACATTGG - Exonic
904781333 1:32951317-32951339 CTGCATCTGCAAAGGGGCGTTGG - Intronic
904804041 1:33118503-33118525 CTGTGACTGCAGAGGGAGGCAGG + Intronic
905288715 1:36906587-36906609 CTTTGTCTGCAAAGGATCGGAGG + Intronic
906339926 1:44970628-44970650 CAGTGTTTGCTAAGGGATGTCGG - Intronic
908421641 1:63964227-63964249 GTGTGCCTGCTAAGGGAAGTGGG - Intronic
908596092 1:65690252-65690274 CTGTGTCTCCAACAGGAGGTGGG - Intergenic
915104853 1:153527442-153527464 CTGTGTCTGCTGAGGGACTTGGG - Intergenic
915219878 1:154366239-154366261 CTGGGGCGGCAGAGGGACGTGGG - Intergenic
915907796 1:159891676-159891698 CTGTGGGTGCAAAGTGAGGTAGG - Intronic
920174665 1:204093097-204093119 GTGTATCAGCATAGGGACGTGGG + Intronic
1067275257 10:44828263-44828285 TTATGTCTGCAAAGGGAATTCGG + Intergenic
1069870353 10:71529216-71529238 CTTTGTCTTCAAAGTGAGGTCGG - Intronic
1070756419 10:78996237-78996259 CTGTGTCTGCAAAGAGGGGCTGG - Intergenic
1070844181 10:79508283-79508305 CTCTGTCTGCAAATGTACGCAGG + Intergenic
1070929616 10:80252028-80252050 CTCTGTCTGCAAATGTACGCAGG - Intergenic
1071144274 10:82549422-82549444 CTGGGTCTGCACAGGGAGGTGGG + Intronic
1074386825 10:113023213-113023235 CGGTGTCTGCAAAGTGAGTTGGG + Intronic
1077077415 11:707812-707834 CTGAGTCTGCAAGGGTGCGTTGG + Intronic
1077993292 11:7431662-7431684 CTGAGGCTGCACAGGGCCGTGGG - Intronic
1080056596 11:27913017-27913039 CTGTGTATGGAATGGGACTTTGG + Intergenic
1082292496 11:50394451-50394473 CAGAATCTGCAAAGGGACGTTGG + Intergenic
1083276136 11:61598097-61598119 CTGGGTCTGCAGGGGGAAGTGGG - Intergenic
1083528690 11:63397021-63397043 CCATGTATGCAAAGGGACTTTGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084493513 11:69490835-69490857 CAGAGTCTGGAAAGGGAGGTGGG - Intergenic
1084589780 11:70084028-70084050 CAGTGTCTGCAAAGGCAAGGAGG + Intronic
1085033187 11:73285073-73285095 CTGTCTCAAAAAAGGGACGTAGG - Intronic
1085696708 11:78710958-78710980 TTGTGGCTGCAAAGGGTCTTGGG + Intronic
1085928907 11:81056886-81056908 ATGTGCCTGCAAAGGAAGGTAGG + Intergenic
1086039779 11:82462338-82462360 CTGAGTCTTCAAAGAGAAGTAGG + Intergenic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1091063581 11:132488013-132488035 CTGTGGCTGCAAAGGTAGGCTGG - Intronic
1091312240 11:134582870-134582892 CTGTGTCTGCTCAGGGAAGAAGG - Intergenic
1091323882 11:134669882-134669904 CTGTGTGTGCACAGGGAGGGGGG + Intergenic
1092425614 12:8373375-8373397 CTGTGTTTGCAAAGGCTCGCAGG - Intergenic
1095963708 12:47852203-47852225 CTGTATCTGGAAAGGGCCGTGGG + Intronic
1098918082 12:76277785-76277807 CTGTGTCTGGAAAAGTAAGTTGG - Intergenic
1101580295 12:106036787-106036809 CTGTGTCAGCAAAGCAATGTTGG + Intergenic
1104519008 12:129455671-129455693 CAGTGTGTGCAAAGGCACGGTGG + Intronic
1105931562 13:25057353-25057375 CTTTCCCTGCAAAGGGAGGTAGG + Intergenic
1108476974 13:50829865-50829887 CTGAGTCTGCAATGGAAGGTAGG + Intronic
1111148553 13:84217239-84217261 CAGTGTCTGCAAAGAGTCCTAGG - Intergenic
1117886706 14:60371747-60371769 CTGAGGCTGCACAGGGAAGTGGG - Intergenic
1118866930 14:69711486-69711508 CTGTTCCTGCAAAGGGCAGTAGG - Exonic
1122235473 14:100328754-100328776 CTGCGTCTGCAAGCGGACTTTGG - Exonic
1123131945 14:105994336-105994358 ATGTGACTGCAAAGTGATGTGGG + Intergenic
1202921255 14_KI270723v1_random:32005-32027 CTGGATCTGCAAAGGGACTAGGG + Intergenic
1123582178 15:21725466-21725488 ATGTGCCTGCAAAGTGATGTGGG + Intergenic
1123618828 15:22168062-22168084 ATGTGCCTGCAAAGTGATGTGGG + Intergenic
1124220388 15:27845949-27845971 CTGTGTCTTCATGGGGACGTGGG - Intronic
1124514029 15:30350986-30351008 TGGTGTCTGGAGAGGGACGTGGG - Intergenic
1124728892 15:32179779-32179801 TGGTGTCTGGAGAGGGACGTGGG + Intergenic
1128401919 15:67292102-67292124 CTGTGTCTGCACATGGAAGAGGG - Intronic
1129376854 15:75138971-75138993 CTGTTTGTGCAAAGGGACATGGG - Intergenic
1130914813 15:88296786-88296808 CCATGTCTGCAAAGGGATGCAGG - Intergenic
1134876856 16:17708121-17708143 CTTTGTCTGCAAAGGGGAGAAGG - Intergenic
1135054328 16:19218483-19218505 TTGTATCTGCAAAGGGAAGAAGG + Intronic
1138382065 16:56609309-56609331 CTGCATCTGCAAAGGGGCGTCGG + Exonic
1138383353 16:56618635-56618657 CTGCGTCTGCAAAGGGGCGTCGG + Intergenic
1138384520 16:56626926-56626948 CTGCGTCTGCAAAGGGGCATCGG + Exonic
1138385613 16:56633797-56633819 CTGTGTCTGCAAAGGGACGTTGG + Exonic
1138386165 16:56636898-56636920 CTGCATCTGCAAAGGGACGTCGG + Intergenic
1138390445 16:56666902-56666924 CTGCATCTGCAAAGGGGCATCGG - Exonic
1138487947 16:57358770-57358792 AGGTGTCTGCAAAGGGACATAGG - Exonic
1141624447 16:85253893-85253915 CTGTGTGTGCAAAGGGCAGGAGG + Intergenic
1144705384 17:17364369-17364391 CTGTGTCTGCTTGGGGACATGGG + Intergenic
1145053059 17:19679190-19679212 CTGTGGCTTCAAAAGCACGTGGG + Intronic
1146277172 17:31523286-31523308 CTGTGTCTGCCAGGGGACCCCGG + Intronic
1146955655 17:36935195-36935217 CGGAGTCAGCAAAGGGGCGTTGG + Intergenic
1150144120 17:62753633-62753655 CTGAGTGTGCAAAGGAACGGAGG - Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1203171106 17_GL000205v2_random:148453-148475 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1154368420 18:13733208-13733230 CTTTGGCTGAAAAGGGAGGTAGG + Intronic
1157155999 18:45266687-45266709 ATGTGTCTGCAAAGGGTGATTGG - Intronic
1162140080 19:8580441-8580463 CTGTGTCTGCTATGGGAGGGGGG - Exonic
1165117158 19:33535460-33535482 CTGTGTCTGCCAGCAGACGTCGG - Intergenic
1168422280 19:56212417-56212439 CTGTGTCTGGAGAAGGATGTTGG - Intergenic
1168449859 19:56457937-56457959 CTGTGTCTGCACATGGAGGAAGG - Intronic
931256034 2:60573710-60573732 AGATGTCTGCAAAGGGAGGTTGG + Intergenic
932983179 2:76695117-76695139 CAGTGACTGCAAAGTGACTTAGG - Intergenic
933175579 2:79169293-79169315 TTGTGTCTCCAAAGGGATCTAGG - Intergenic
934588926 2:95529134-95529156 CTGTTTCTGCCATGGGAAGTTGG + Intergenic
943494939 2:188608479-188608501 CTGTGTCTGCCAAAGGCCTTTGG + Intergenic
944132021 2:196357218-196357240 CTCTGTCTGCACAGGGAGGATGG - Intronic
946036455 2:216746266-216746288 CTGTGGCTGCTATGGGACATGGG - Intergenic
1170123013 20:12931460-12931482 GTGTGTCTGCAAAAAGAAGTTGG - Intergenic
1171826000 20:29906763-29906785 TAGAGTCTGCAAATGGACGTTGG + Intergenic
1172150807 20:32789062-32789084 CTTTGTCTTCAAAGGGAGGCAGG - Intronic
1172326423 20:34039072-34039094 CTGTGTCTCCAAAGGCGCATTGG + Intronic
1174295525 20:49542565-49542587 CTTTGTCTGCACAGGGACCCAGG + Intronic
1175231747 20:57477853-57477875 CTGCGGCTGCAAGGGGACCTGGG - Intergenic
1175774950 20:61647258-61647280 GGGTGTCTGCAAGGGGACTTTGG - Intronic
1175883118 20:62271838-62271860 CTGTGTCTGGAATGGGGCGGTGG + Intronic
1176327090 21:5510284-5510306 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1176330622 21:5545927-5545949 CCGTGTCTGCAGAGGGACTAGGG - Intergenic
1176397135 21:6275024-6275046 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1176400667 21:6310667-6310689 CCGTGTCTGCAGAGGGACTAGGG - Intergenic
1176436490 21:6678437-6678459 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1176440022 21:6714080-6714102 CCGTGTCTGCAGAGGGACTAGGG - Intergenic
1176460752 21:7005507-7005529 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1176464284 21:7041149-7041171 CCGTGTCTGCAGAGGGACTAGGG - Intergenic
1176484313 21:7387285-7387307 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1176487845 21:7422928-7422950 CCGTGTCTGCAGAGGGACTAGGG - Intergenic
1176663925 21:9666625-9666647 CTGTTTCTGCAGAGGGATTTGGG + Intergenic
1177358963 21:20045004-20045026 ATGTGACAGCAAAGTGACGTGGG - Intergenic
1177507811 21:22040668-22040690 ATGTGTCAGCAAAGTGATGTGGG + Intergenic
1178781749 21:35609962-35609984 CTGTGGGTGCAAAGTGATGTAGG + Intronic
1178838020 21:36114677-36114699 CTGTCTCTGGAAGGGGACATGGG - Intergenic
1179124107 21:38576639-38576661 CTGTGACAGCAAAGGGAGGTTGG - Intronic
1179310285 21:40189500-40189522 CTGGGTGTGCTAAGGGACATAGG - Intronic
1181313692 22:21958959-21958981 CTGTGTATTCTAGGGGACGTGGG + Intronic
1184770803 22:46595447-46595469 CTGTGTCTGGAAAGGGGAGGTGG + Intronic
1185210989 22:49570373-49570395 CTCTCTCTGCAAGGGTACGTGGG + Intronic
950523913 3:13512599-13512621 CTGTCTGTGCAAGGAGACGTTGG - Intergenic
952762171 3:36924298-36924320 TTGTGTCTGCTGAGGGACTTTGG - Intronic
953362292 3:42308782-42308804 CTATGTATTCAAAGGGACTTGGG + Intergenic
953884961 3:46709944-46709966 GTGTATCTGCAGAGGGACGGTGG - Exonic
954979638 3:54733273-54733295 CTATGACTGCCAAGTGACGTGGG - Intronic
956167257 3:66406052-66406074 CTGTGTCTGCAAGGGCTCGGGGG - Intronic
957080264 3:75630964-75630986 CTGGCTCTGCAAAGGGACTAGGG - Intergenic
958854561 3:99368868-99368890 ATGTGTCTGCAGAGGTATGTTGG + Intergenic
960244078 3:115380401-115380423 CTGAGGCTGCACAGGGAAGTGGG + Intergenic
960774570 3:121234702-121234724 CGGTGTTTGGAAAGGGATGTAGG + Intronic
962054836 3:131860138-131860160 CTGTGTCTGTAAAGTTATGTTGG + Intronic
966241370 3:177758109-177758131 CTGAGGCTGCAAAGGGCAGTGGG + Intergenic
967724768 3:192851328-192851350 TTGTGTCTGCCAAGGGCTGTTGG + Intronic
970503453 4:16702726-16702748 TTGTGTCTGCAAAGGCTGGTGGG - Intronic
970938484 4:21603236-21603258 CTGTGTCTGTAAAATGACCTTGG + Intronic
974932660 4:68376463-68376485 CTGCATCTGCAAAGGGGCGTCGG + Intergenic
981099199 4:140811805-140811827 CGGTCTCTGCAAAGTGAAGTGGG - Intergenic
981779153 4:148405971-148405993 CTGTCTCTGCAAAGGGTTTTGGG + Intronic
983420194 4:167507008-167507030 ATGTGTCAGCAAAGTGATGTGGG + Intergenic
983941687 4:173539583-173539605 CTGTGTCTGAAAAGGGGGATGGG - Intergenic
985354392 4:189102240-189102262 CTGTCTCTACACATGGACGTGGG + Intergenic
985409382 4:189667307-189667329 CTGTTTCTGCAGAGGGATTTGGG + Intergenic
986210757 5:5669649-5669671 CTGGGGCTGCACAGGGAGGTAGG - Intergenic
986682804 5:10249459-10249481 CCCTGTCTGCAAAGTGACGGTGG - Intronic
993907222 5:93636490-93636512 CTGTGTCTTCACAGGGAAGAAGG - Intronic
995858633 5:116619092-116619114 CTGAGTCTGAAAAGGGAGATAGG + Intergenic
996942192 5:129021453-129021475 CTGAATCTGCAAAGATACGTGGG + Intronic
997957003 5:138286553-138286575 CTGGGTGTCCAAAGGGACGATGG + Exonic
999455088 5:151708584-151708606 GTGTGTCTGCCAAGGGAATTTGG - Intergenic
1000174638 5:158739275-158739297 CTGTGTCTAAAATGGGAAGTAGG + Intronic
1001494629 5:172179222-172179244 TTGTGTCTGCAAAGTGGAGTTGG - Intronic
1002063787 5:176642204-176642226 ATGTGTCTCCAAAGGGACTGGGG + Intronic
1002068771 5:176665988-176666010 CTGTGCCTGCAAATGGGAGTGGG + Intergenic
1002467685 5:179415996-179416018 CAGGGTCTGCAAAGAGAGGTGGG + Intergenic
1004449413 6:15730972-15730994 CTGTGTCTGGAAAGGCAGGAGGG - Intergenic
1004845176 6:19633892-19633914 GTGTGTGTGGAAAGGGAGGTGGG + Intergenic
1009419414 6:63448526-63448548 CTGTCTCTGGAAAGGGAGGTAGG + Intergenic
1010517429 6:76790141-76790163 CTGAGGCTGCACAGGGAAGTAGG + Intergenic
1016784216 6:147992216-147992238 CTGTGACTGCTAAGGGACTGCGG - Intergenic
1019872337 7:3776275-3776297 ATGTGTATGCAAAGGGCCATGGG + Intronic
1023241402 7:38151455-38151477 ATGTGTCAGCAAAGTGATGTGGG - Intergenic
1029221310 7:98992804-98992826 CTGAGTCTCCTAAGGGCCGTGGG + Intronic
1029506278 7:100965777-100965799 CTGTGTCACCAAATGCACGTCGG + Exonic
1031408826 7:121418964-121418986 CTGTGTCTTTCAAGGGACTTAGG + Intergenic
1033430323 7:141283194-141283216 ATTTGTCAGCAAAGGGAGGTTGG + Intronic
1033589158 7:142796304-142796326 CTGTCTGTGCTAAGGGAGGTGGG + Intergenic
1033911756 7:146272333-146272355 CTGTCTCTCCAATGGCACGTGGG + Intronic
1034552920 7:151832650-151832672 CCGTGCCTGCAAAGGAACGCAGG + Intronic
1035395059 7:158529363-158529385 CTGTGTCGGCAGAGGAAGGTGGG + Intronic
1036279771 8:7390878-7390900 CTGTGTGTGTAAATGGAGGTAGG - Intergenic
1036341748 8:7921005-7921027 CTGTGTGTGTAAATGGAGGTAGG + Intergenic
1039763867 8:40607851-40607873 GTGTGTCTGCAAAGAGTCCTGGG + Intronic
1041714791 8:60923252-60923274 CTGTGTCTGCAGAGGGGCCCGGG - Intergenic
1042976732 8:74478301-74478323 CTGTGCCGGCCAAGGGATGTTGG + Intronic
1044461161 8:92445899-92445921 CTGTTTCTGCAAGAGGACTTTGG + Intergenic
1046018760 8:108638009-108638031 ATGTGTCTGCAAAGAGAGGTTGG - Intronic
1051899598 9:22024733-22024755 ATGTGCCTGCAAAGTGATGTGGG + Intronic
1052678216 9:31654334-31654356 CTGTGTCTACAAAGTGACCAAGG + Intergenic
1056315057 9:85380370-85380392 CTGTGTCTGCACATGGATGGAGG + Intergenic
1056736828 9:89217002-89217024 CTTTTTCTGCAAAGAGACTTTGG - Intergenic
1057868004 9:98696568-98696590 CTGTGCTTTCAAAGGCACGTGGG - Intronic
1060197573 9:121633458-121633480 CTGTGTCTCCAAAGCAAGGTGGG + Intronic
1060495237 9:124113473-124113495 CTGTGGCTGCAGAGGGAGCTAGG + Intergenic
1060637339 9:125209735-125209757 CTGTGTGTGCAAAGGCATGGAGG - Intronic
1061385844 9:130289009-130289031 CTGTGTCTGCCAGGGAACTTGGG - Intronic
1061763058 9:132863660-132863682 CTTTATCTGCAAAGGAAGGTAGG - Exonic
1062115494 9:134806048-134806070 CTGTGCTTGCAAAGGGCCATAGG + Intronic
1203431473 Un_GL000195v1:94399-94421 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1203662175 Un_KI270753v1:55137-55159 CTGTTTCTGCAGAGGGATTTGGG - Intergenic
1186233382 X:7480223-7480245 CTGTGGCAGCAAAGGGAAGTTGG + Intergenic
1186446819 X:9637029-9637051 CTGTGTCTGGAAATAGACCTAGG - Intronic
1191718186 X:64206896-64206918 GTGTGTCTAAAAAGGGAGGTGGG + Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1194374509 X:93114997-93115019 CTGTGCCTGAAAAGGGGCCTTGG + Intergenic
1198258987 X:134949749-134949771 GTGTGTCTGTAAAGGTAGGTAGG + Intergenic
1200413838 Y:2887932-2887954 TTGTGTCTGCTGAGGGACTTGGG + Intronic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1200682533 Y:6229051-6229073 CTGTGCCTGAAAAGGGGCCTTGG + Intergenic