ID: 1138387147

View in Genome Browser
Species Human (GRCh38)
Location 16:56643522-56643544
Sequence CGGGGCTGTGCGCACCAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 234}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138387147_1138387151 -9 Left 1138387147 16:56643522-56643544 CCCGCCTGGTGCGCACAGCCCCG 0: 1
1: 0
2: 4
3: 30
4: 234
Right 1138387151 16:56643536-56643558 ACAGCCCCGCCCTGAACCCTGGG 0: 1
1: 1
2: 1
3: 18
4: 254
1138387147_1138387164 30 Left 1138387147 16:56643522-56643544 CCCGCCTGGTGCGCACAGCCCCG 0: 1
1: 0
2: 4
3: 30
4: 234
Right 1138387164 16:56643575-56643597 CTGGGCTGGTGCGAGACCTGGGG 0: 1
1: 0
2: 0
3: 21
4: 234
1138387147_1138387160 12 Left 1138387147 16:56643522-56643544 CCCGCCTGGTGCGCACAGCCCCG 0: 1
1: 0
2: 4
3: 30
4: 234
Right 1138387160 16:56643557-56643579 GGCAGCGCTGACACTGAGCTGGG 0: 1
1: 1
2: 2
3: 18
4: 264
1138387147_1138387162 28 Left 1138387147 16:56643522-56643544 CCCGCCTGGTGCGCACAGCCCCG 0: 1
1: 0
2: 4
3: 30
4: 234
Right 1138387162 16:56643573-56643595 AGCTGGGCTGGTGCGAGACCTGG 0: 1
1: 0
2: 0
3: 17
4: 187
1138387147_1138387161 16 Left 1138387147 16:56643522-56643544 CCCGCCTGGTGCGCACAGCCCCG 0: 1
1: 0
2: 4
3: 30
4: 234
Right 1138387161 16:56643561-56643583 GCGCTGACACTGAGCTGGGCTGG 0: 1
1: 1
2: 1
3: 20
4: 188
1138387147_1138387150 -10 Left 1138387147 16:56643522-56643544 CCCGCCTGGTGCGCACAGCCCCG 0: 1
1: 0
2: 4
3: 30
4: 234
Right 1138387150 16:56643535-56643557 CACAGCCCCGCCCTGAACCCTGG 0: 1
1: 0
2: 1
3: 29
4: 388
1138387147_1138387163 29 Left 1138387147 16:56643522-56643544 CCCGCCTGGTGCGCACAGCCCCG 0: 1
1: 0
2: 4
3: 30
4: 234
Right 1138387163 16:56643574-56643596 GCTGGGCTGGTGCGAGACCTGGG 0: 1
1: 0
2: 0
3: 23
4: 224
1138387147_1138387159 11 Left 1138387147 16:56643522-56643544 CCCGCCTGGTGCGCACAGCCCCG 0: 1
1: 0
2: 4
3: 30
4: 234
Right 1138387159 16:56643556-56643578 GGGCAGCGCTGACACTGAGCTGG 0: 1
1: 0
2: 1
3: 17
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138387147 Original CRISPR CGGGGCTGTGCGCACCAGGC GGG (reversed) Intronic