ID: 1138387266

View in Genome Browser
Species Human (GRCh38)
Location 16:56644184-56644206
Sequence TGGGGCCTTCCCTGGGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 2, 1: 0, 2: 0, 3: 33, 4: 331}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138387261_1138387266 -4 Left 1138387261 16:56644165-56644187 CCTGCAAGAAGAGTGAGTGTGGG 0: 2
1: 9
2: 3
3: 18
4: 187
Right 1138387266 16:56644184-56644206 TGGGGCCTTCCCTGGGAATCTGG 0: 2
1: 0
2: 0
3: 33
4: 331
1138387258_1138387266 26 Left 1138387258 16:56644135-56644157 CCTGCAAATGCAAAGAGTACAAA 0: 1
1: 4
2: 10
3: 25
4: 328
Right 1138387266 16:56644184-56644206 TGGGGCCTTCCCTGGGAATCTGG 0: 2
1: 0
2: 0
3: 33
4: 331
1138387259_1138387266 -1 Left 1138387259 16:56644162-56644184 CCTCCTGCAAGAAGAGTGAGTGT 0: 3
1: 10
2: 1
3: 15
4: 150
Right 1138387266 16:56644184-56644206 TGGGGCCTTCCCTGGGAATCTGG 0: 2
1: 0
2: 0
3: 33
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138387266 Original CRISPR TGGGGCCTTCCCTGGGAATC TGG Intronic
900117914 1:1036362-1036384 TGGGGTCTTCCCTCGGAGTGTGG + Intronic
900374379 1:2346838-2346860 TGGGGTCTGCCCTGGGGAGCAGG + Intronic
900511230 1:3062093-3062115 TGGGGCCTGCCCTGGGGACTGGG - Intergenic
900620443 1:3584626-3584648 GTGGGCCTGCCCTGGGACTCTGG - Intronic
900758382 1:4454000-4454022 TGGGGCCTTCACTGAGATGCAGG - Intergenic
901853500 1:12030180-12030202 TGTGACCCTCCCTGGGGATCTGG - Intronic
902331568 1:15733568-15733590 TGGGGCCTTCCCAGGAAAGAGGG + Intronic
903073749 1:20745049-20745071 TGCGGCCTTCCCTGGGGACTTGG + Exonic
903372331 1:22844736-22844758 TGGGGGCTTCCTGGGGGATCCGG - Intronic
903550724 1:24156098-24156120 TGGTTCCTCCCCTGGGAAGCAGG + Exonic
905321191 1:37118624-37118646 TGGGGCCTGACCTGGGACCCTGG - Intergenic
905344157 1:37300142-37300164 CAGGGCCTTCCCTGGACATCAGG + Intergenic
907992106 1:59593086-59593108 TGGGGCCTTCCCTAGCTCTCTGG - Intronic
910163520 1:84298899-84298921 TGGGGGCTCCCCGGGGAAGCCGG - Intronic
913608364 1:120487572-120487594 AGGGGCTTTACCTGGGAATGCGG - Intergenic
913877613 1:124080544-124080566 TGAGGCCTTTCCTTGGAAACGGG + Intergenic
914582838 1:149034265-149034287 AGGGGCTTTACCTGGGAATGCGG + Intronic
915240434 1:154517180-154517202 TGGGGTATGCCCTGGAAATCAGG + Intronic
915517093 1:156420034-156420056 TGGGGCCTTTTCTGGCAGTCTGG - Intronic
917772268 1:178292592-178292614 TGGGGCCTTTCCTGGTACCCAGG - Intronic
920971390 1:210746211-210746233 TGGGGCCTTGCCTCAGAGTCTGG - Intronic
921868308 1:220109745-220109767 TGTGACCTTACTTGGGAATCAGG - Intronic
922119113 1:222644595-222644617 TGGGTCCCTCCCCGGGAATCGGG - Intronic
922866870 1:228868000-228868022 AGGGGCCTTGACTGGGAATCTGG + Intergenic
923067944 1:230537592-230537614 TGGGGCCTTCACTGGGGTCCCGG - Intergenic
1063577938 10:7278713-7278735 TGGCCCCTTGCTTGGGAATCAGG + Intronic
1063940076 10:11119379-11119401 TGGGGAGTGCCCTGGGATTCAGG + Intronic
1066164600 10:32772774-32772796 TAGGGCCTTCCCTGGTGATATGG + Intronic
1066449826 10:35518629-35518651 TGAGGCATTCTCTGGGTATCTGG + Intronic
1066449847 10:35518889-35518911 TGAGGCATTCTCTGGGTATCTGG + Intronic
1066449879 10:35519305-35519327 TGAGGCATTCTCTGGGTATCTGG + Intronic
1068963524 10:62888979-62889001 CGGGACCTTCCCTGGGCCTCAGG + Intronic
1069566353 10:69465968-69465990 TGGCCCCTGCCCTGGGAAGCTGG - Intronic
1069637001 10:69930998-69931020 AGGGGCCTTCTCTGGGTCTCAGG + Intronic
1071236638 10:83657393-83657415 TGGGCCAGTCCCTGTGAATCAGG - Intergenic
1072547449 10:96450425-96450447 TGGGGCATGGCCTGGGAATGGGG + Intronic
1073460769 10:103664579-103664601 TGGGCCCTTCCCTAGGGACCAGG - Intronic
1074770720 10:116731846-116731868 TGCGGCCTCGTCTGGGAATCTGG + Intronic
1075027250 10:118994451-118994473 GGGGGCCTTATCTGGGACTCTGG - Intergenic
1075091070 10:119444449-119444471 CAGGCCCTTCCCTGGGAACCAGG + Intronic
1077023862 11:431089-431111 TGGGGGCTCCCGTGGGTATCTGG + Intronic
1077023910 11:431209-431231 TGGGGGCTCCCGTGGGTATCTGG + Intronic
1077023927 11:431249-431271 TGGGGGCTCCCGTGGGTATCTGG + Intronic
1077024038 11:431530-431552 TGGGGGCTCCCGTGGGTATCTGG + Intronic
1078891954 11:15565647-15565669 GGGGGCCTTCTCTGGGAAATTGG - Intergenic
1082159459 11:48871652-48871674 TGAGGCCTTCATTGGAAATCAGG + Intergenic
1082829050 11:57601969-57601991 GGGGGCCTTCCTTGGGAATGAGG - Intronic
1083061365 11:59876189-59876211 AGGGGCCTTCCATGGAAATCAGG + Intergenic
1083694952 11:64436565-64436587 TGGGGCCTTCTATGGGATGCTGG + Intergenic
1088861280 11:113802042-113802064 AGGGCCCTTCCCAGGGATTCTGG + Intronic
1090771329 11:129921973-129921995 TGGGAAGTTACCTGGGAATCTGG - Intronic
1091451902 12:577591-577613 TGGGGCCATCCCTCAGTATCTGG - Intronic
1094920290 12:35428507-35428529 TGAGGCCTTCGTTGGGAAACGGG + Intergenic
1096577712 12:52564477-52564499 TGGGTCCCTCACTGGGAATGTGG + Intergenic
1096737004 12:53663499-53663521 TGAGGCCTTCCAAGGGCATCAGG - Intronic
1097184760 12:57190643-57190665 TGGGGCCCTTCCTGGGCATTGGG + Intronic
1098311476 12:69153364-69153386 TGGGGCCTTCCTTGAGACACTGG + Intergenic
1099221043 12:79914719-79914741 TGGTCCCTTTCCTGGAAATCTGG + Intronic
1103342983 12:120230888-120230910 AGGGGCCTTCCCTGCCAATTTGG + Intronic
1104714090 12:131005234-131005256 TGGGCCCTTCCCTTGGCTTCTGG - Intronic
1104814489 12:131637882-131637904 TGGGGCGGTGCCTGGGAAGCAGG + Intergenic
1104933543 12:132352907-132352929 TGGTGCCTTCTCTGGGTTTCCGG + Intergenic
1105250842 13:18697697-18697719 TGGGCCCAGCCCTGTGAATCAGG - Intergenic
1106133755 13:26959286-26959308 GGGGGCCTGCCCTGGGTAACAGG - Intergenic
1110371312 13:74743569-74743591 TAGAGCCTTCCCTGGGGACCAGG - Intergenic
1112401756 13:99084749-99084771 TGGGGCCTGCCGTGGTCATCAGG - Intronic
1113041405 13:106107172-106107194 TGGGGCCAGCCCTGGGACCCTGG - Intergenic
1113787531 13:113010451-113010473 TGGGGCCTCACCTGTGTATCAGG + Intronic
1115778380 14:36741504-36741526 TGGGGCTTTCCCTGGTTGTCAGG + Intronic
1118970795 14:70635875-70635897 CAGGGCCTTCCCTTGGGATCTGG - Intergenic
1119301289 14:73573392-73573414 TGGGCCCTTTCCTGGGATTGTGG + Exonic
1119386806 14:74262358-74262380 GGGAGCCTGGCCTGGGAATCTGG - Exonic
1119396114 14:74327452-74327474 TGGGGCCATCCCTGCGGATCAGG - Intronic
1119654812 14:76409685-76409707 TGGGGACCTCCCTGGGAGCCAGG + Intronic
1120401701 14:84040769-84040791 TGTCCCCTTCTCTGGGAATCAGG - Intergenic
1121312934 14:92944909-92944931 TGGAGCTCTCCCTGGGAGTCGGG - Intronic
1121505512 14:94474021-94474043 TGTGTCCCTCCCTTGGAATCAGG + Intronic
1121643960 14:95505074-95505096 TGGGTCCTGCCTTGGGACTCCGG + Intergenic
1121737393 14:96228079-96228101 TGGGGCCTGCCCTGGGAGAAGGG + Intronic
1122329962 14:100905279-100905301 TGAGCCCTTCCCTGGGACTCTGG - Intergenic
1123035440 14:105469994-105470016 TGGGGCCTTCCCAGGGCAGGCGG + Intronic
1123058738 14:105584788-105584810 TGTTGCCTTCCCAGGGAATGTGG + Intergenic
1123083065 14:105705014-105705036 TGTTGCCTTCCCAGGGAATGTGG + Intergenic
1123123800 14:105930289-105930311 TGTGTCCTTCCCTGGGGATGAGG + Intronic
1202895151 14_GL000194v1_random:2470-2492 TGGTGCCTTGCCTGGAAGTCAGG + Intergenic
1126023762 15:44426988-44427010 TGGCGCCTTTCCTGGGATTTCGG - Intergenic
1126446958 15:48758064-48758086 TGGGCCCTGGCCTGGGCATCAGG - Intronic
1128478184 15:68015149-68015171 GAGCTCCTTCCCTGGGAATCTGG - Intergenic
1128636153 15:69303763-69303785 TGAGGCCTCACTTGGGAATCTGG + Intronic
1128699737 15:69795425-69795447 AGGGGCCTGCCCTGGGTGTCAGG + Intergenic
1129905911 15:79186905-79186927 TTGGGGCTTCCCTGGGCATTTGG + Intergenic
1131175421 15:90206250-90206272 TGTGGCCCTCCCTGGGGATCGGG + Intronic
1132463246 16:65948-65970 TGGGGCCTTCCGTGGGGCCCTGG - Intronic
1133202488 16:4212705-4212727 TGGGGCCTTCCCATGGTCTCTGG - Intronic
1133393826 16:5430258-5430280 TGGGGCCTGACCTGGGGGTCAGG + Intergenic
1133817144 16:9206632-9206654 TTGTGCCCTCCCTGTGAATCTGG + Intergenic
1135940781 16:26819977-26819999 TGGGACCCTCCTTGGGGATCTGG - Intergenic
1136419259 16:30122296-30122318 AGGAGCCTTTCCTGGGAATGGGG - Intronic
1138386554 16:56639337-56639359 TGGGGCCATCTCCAGGAATCTGG + Intronic
1138387266 16:56644184-56644206 TGGGGCCTTCCCTGGGAATCTGG + Intronic
1138387942 16:56648899-56648921 TGGGGCCTTCCCTGGGAATCAGG + Intronic
1138392912 16:56683238-56683260 CAGGGCCTTCCCTGCGAATCTGG + Intronic
1138490220 16:57372279-57372301 TGGGACCTTCCCCGGGAGGCTGG - Intergenic
1138804998 16:60081313-60081335 TGGGGGCTTCCAAGGCAATCGGG - Intergenic
1139178299 16:64715777-64715799 TGGGGCCTTGCCTGATAACCAGG - Intergenic
1139440704 16:66965237-66965259 GGGGGCCATGCCTGGGAATCTGG + Intronic
1139972674 16:70786011-70786033 TGGGCCCTCTCCTGGGAATGAGG - Intronic
1140892318 16:79295739-79295761 TGGGGGCTTCCCTGTGTGTCAGG + Intergenic
1141629193 16:85277501-85277523 TGGGGCCAGGCCTGGGATTCCGG + Intergenic
1142147797 16:88499797-88499819 TGGGCCCTTCCCTGGGAGGCAGG - Intronic
1142584014 17:959436-959458 TGGGAGCTTCCCTGGGAGTGGGG - Intronic
1142961980 17:3557022-3557044 TGTGGCCTGCCCTGGGCCTCTGG + Intronic
1143660358 17:8320861-8320883 TGGGGCCTTCCCTGCCCAGCTGG + Exonic
1143891555 17:10106234-10106256 TGTGGCCTTCCCTGAGAAGCAGG - Intronic
1143896620 17:10141500-10141522 TTGGATCTACCCTGGGAATCTGG - Intronic
1144300934 17:13922627-13922649 TGGGGCCTTGCCTGAGATCCCGG + Intergenic
1144760916 17:17706746-17706768 TGGGGCCTGCCCTGGGAGCCGGG + Intronic
1145017361 17:19408043-19408065 TGGCGCCTTCACTGGGAATTCGG + Intergenic
1145093491 17:20004993-20005015 TGGGGGCTGACCTGGGAATAGGG + Intergenic
1148935638 17:51162822-51162844 TGAGGCCATCCCAGGGACTCAGG - Intronic
1149459873 17:56819760-56819782 TGGGGCTTTTCCTGAGAACCGGG - Intronic
1152271097 17:79325288-79325310 TGCGGCCTTCCCTGGAGATGAGG + Intronic
1152470031 17:80485996-80486018 TGGGGCCTCCCCGGGCCATCTGG - Intergenic
1154438007 18:14361229-14361251 TGGGCCCAGCCCTGTGAATCAGG + Intergenic
1154590456 18:16231498-16231520 TGGGGATTTCGCTGGGAAGCGGG + Intergenic
1154612799 18:16537630-16537652 TGGGGATTTCGCTGGGAAGCGGG + Intergenic
1154822071 18:19408611-19408633 TGGGGATTTCGCTGGGAAGCGGG + Intergenic
1155921909 18:31611816-31611838 TGGGGCCTGCACAGGGAATGGGG + Intergenic
1156366180 18:36429402-36429424 TGGAGCCTTCCATAGGAAACTGG - Intronic
1157105333 18:44769182-44769204 TTGGACTTTCCATGGGAATCTGG + Intronic
1158847471 18:61459756-61459778 AGGAGCCTTCCCTGGGAAGATGG + Intronic
1159972282 18:74669297-74669319 TGGGGCCTTCCCTGCATATGGGG + Intronic
1160043635 18:75367688-75367710 TGGGACCTTACCTGGAAATGGGG - Intergenic
1160838505 19:1135975-1135997 TGTGGCCTTATTTGGGAATCCGG + Intronic
1160879320 19:1312431-1312453 TGGGGCCTTCCCAGGGCCCCTGG + Intergenic
1160907405 19:1457915-1457937 TGGGACATTTCCTGGGAATGGGG + Intronic
1161576934 19:5059502-5059524 TGGGTCCCTCCCTGGGCCTCGGG - Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1161775500 19:6260036-6260058 TGGGGCCTTCCAGAGGAACCAGG + Intronic
1162021431 19:7870142-7870164 AGGGGCCTGCCCAGGGAATGAGG + Exonic
1162743454 19:12786319-12786341 TGGGGCCCTCACTAGGAAACTGG - Intronic
1163186235 19:15641362-15641384 TGGGCCCTTCCCTGGGCCTCAGG + Intronic
1163222853 19:15934440-15934462 TGGGCCCTTCCCTGGGCCTCAGG - Exonic
1163508162 19:17720120-17720142 TGCGGCCTGCCCTGGGGATTTGG + Intronic
1163557773 19:18002141-18002163 GGGGGCCTTCTCTGAGAATCAGG - Intronic
1165271475 19:34711501-34711523 AAGGCCTTTCCCTGGGAATCTGG + Intergenic
1165299142 19:34957176-34957198 TGGGGCACCCCCTGGGAATAAGG + Exonic
928163908 2:28955436-28955458 TGGGGTCCTCCCTGGTCATCTGG + Intergenic
928938758 2:36706630-36706652 TGAGGCCTCCCCTGGGATTTTGG - Intronic
929780784 2:44955615-44955637 AGGGGACTTCCCTGGGTCTCTGG - Intergenic
930089860 2:47523872-47523894 TGGGGCCAGCCCTGGGAAAGTGG + Intronic
930361789 2:50389836-50389858 TGAGGCCTTCCCTGGGGTTTGGG - Intronic
931198380 2:60074217-60074239 TGGGACCATGCCTGGGAATGAGG + Intergenic
934490703 2:94760548-94760570 TGGGGGCTTCCATGGGAATTGGG - Intergenic
934518688 2:95005838-95005860 CGTGGCCTTCCCTGGGCAGCAGG + Intergenic
934552917 2:95273000-95273022 TAGGGCCTTACGTGTGAATCAGG - Intergenic
935537956 2:104316399-104316421 TGTGGGGTTTCCTGGGAATCTGG + Intergenic
935624807 2:105163409-105163431 TTGAGCCATCCCGGGGAATCAGG - Intergenic
936048202 2:109202813-109202835 TGGGCCCTTTCCCGGGAATGGGG - Intronic
936227162 2:110666264-110666286 TCGGACCTTTCCTGGGAAGCGGG + Exonic
936483330 2:112905851-112905873 AGGGTGTTTCCCTGGGAATCTGG - Intergenic
937378107 2:121351693-121351715 TGGGGCCTACACTGGGATTATGG + Intronic
937924156 2:127154681-127154703 TGGGGGCTTCACTAGGAACCTGG + Intergenic
940033290 2:149287577-149287599 TTGGGCCTTCCCTGGGGGACTGG - Intergenic
940365466 2:152843820-152843842 TGAGGCCTGCCCTGGGAATATGG - Intergenic
940478936 2:154203587-154203609 TTGGGGGTTCCCTGGAAATCAGG - Intronic
940574560 2:155484511-155484533 TGGTGACTCCACTGGGAATCAGG + Intergenic
942098009 2:172551849-172551871 TGGCTCTTTCCTTGGGAATCAGG - Intergenic
948251989 2:236536632-236536654 TGGTACCTTCCCCCGGAATCAGG - Intergenic
948456264 2:238105993-238106015 TGGGGCCTTCCCTGCCCAGCTGG + Intronic
948654101 2:239466067-239466089 TGGGACCTTCCCAGGGACCCTGG - Intergenic
948916586 2:241037506-241037528 TGGGCCTTTCCCTGGGCATCTGG - Intronic
949044995 2:241868407-241868429 CGGGGCTTTCCCTGGCAGTCTGG + Intergenic
1169028519 20:2390001-2390023 TGGAGGCTTCTCTGGGAATGAGG - Intronic
1169302368 20:4455329-4455351 TGGGACATCACCTGGGAATCAGG - Intergenic
1170969797 20:21105702-21105724 TCGCGCCTCCCCTAGGAATCCGG + Intergenic
1171097591 20:22346712-22346734 TGGGGCTCTGCCTGGGACTCTGG - Intergenic
1171449350 20:25225073-25225095 TGCGGCCTTGTCTGTGAATCCGG + Intronic
1171575590 20:26310578-26310600 TGAGGCCTTCATTGGAAATCGGG + Intergenic
1171575688 20:26312280-26312302 TGAGGCCTTCGTTGGAAATCGGG + Intergenic
1171575780 20:26313982-26314004 TGAGGCCTTCATTGGAAATCGGG + Intergenic
1171798065 20:29581841-29581863 TGGGCCTTTCCCTGGGAGTTGGG + Intergenic
1172612549 20:36262605-36262627 TGAGGCCTTCCCTGGAGAGCTGG - Intronic
1173675945 20:44835809-44835831 TGCGGCCCTTCCTGGGAAGCAGG - Intergenic
1173925173 20:46775986-46776008 AGAGTCCTTCCCTGGGAATGTGG - Intergenic
1174128653 20:48326699-48326721 TGGGCCCTCACCTGGGCATCGGG + Intergenic
1174420381 20:50395571-50395593 TGGGGCCTTCCTCTTGAATCAGG - Intergenic
1175514919 20:59563254-59563276 TGGGGGCTTCCCTTGGCATGGGG - Intergenic
1175731340 20:61356119-61356141 TGGAGCATTCACTGGGCATCAGG + Intronic
1176095769 20:63343702-63343724 TGGGGCCTCCCCTGGGAAGGAGG + Intronic
1176115888 20:63431846-63431868 TGGGGCCTTCCCTGAGGGTGGGG - Intronic
1176115911 20:63431900-63431922 TGGGGCCTTCCCTGAGGGTGGGG - Intronic
1176115939 20:63431972-63431994 TGGGGCCTTCCCTGCGGGTGGGG - Intronic
1176115947 20:63431990-63432012 TGGGGCCTTCCCTGAGGGTGGGG - Intronic
1176115955 20:63432008-63432030 TGGAGCCTTCCCTGTGGATGGGG - Intronic
1176115979 20:63432080-63432102 TGGGGCCTTCCCTGTGGGTGGGG - Intronic
1176115987 20:63432098-63432120 TGGGGCCTTCCCTGAGGGTGGGG - Intronic
1176116089 20:63432386-63432408 TGGGGCCTTCCCTGTGGGTGGGG - Intronic
1176116097 20:63432404-63432426 TGGGGCCTTCCCTGAGGGTGGGG - Intronic
1176116193 20:63432674-63432696 TGGGGCCTTCCCTGAGGGTGGGG - Intronic
1176116235 20:63432782-63432804 TGGGGCCTTCCCTGAGGGTGGGG - Intronic
1176221600 20:63971746-63971768 TGAGGCCTTCCCTGGGAGATGGG - Intronic
1176257443 20:64159653-64159675 TGGGAGCTTCCCTCGGCATCAGG + Intronic
1176297857 21:5083744-5083766 TGGGGCCTCACCTGGGGCTCAGG - Intergenic
1176457671 21:6928240-6928262 TGGGCCCAGCCCTGTGAATCAGG - Intergenic
1176614854 21:9018457-9018479 TGGTGCCTTGCCTGGAAGTCAGG + Intergenic
1176835843 21:13793324-13793346 TGGGCCCAGCCCTGTGAATCAGG - Intergenic
1179072524 21:38084950-38084972 TGGGCCCTTCTCAGGGCATCAGG + Intronic
1179859172 21:44178205-44178227 TGGGGCCTCACCTGGGGCTCAGG + Intergenic
1181571232 22:23768594-23768616 TCGGGCCGGCCCGGGGAATCCGG - Intronic
1182354138 22:29714687-29714709 TGGTGCCTCACCTGGGAATAAGG - Intergenic
1184088416 22:42279822-42279844 TGGGGGCCTCCGTGGCAATCGGG + Intronic
1184992626 22:48180957-48180979 TGGGGTGTGCCCTGGGAACCAGG + Intergenic
949879331 3:8649309-8649331 TGGGACCTGCTCTGGGAATGAGG - Intronic
950294883 3:11820883-11820905 GGTGGCCTTCCCTGTGATTCAGG + Intronic
950714007 3:14835046-14835068 TGGGGCCTGCTCTGGGATTTCGG - Intronic
951739616 3:25905966-25905988 TGAAGCCTTGCCTGGGAAACTGG - Intergenic
956889555 3:73598669-73598691 TGGGGCTGTGGCTGGGAATCTGG - Intronic
958473265 3:94548940-94548962 TGGGTGCTTCCCAGGGGATCAGG - Intergenic
962887198 3:139638455-139638477 TGGGGGCTTCCCTGTGTATCAGG + Intronic
962890332 3:139666382-139666404 TGGGGCCTCCACTGGGATGCTGG - Intronic
968232435 3:197011722-197011744 TGGTCCCTTCCCTGGGTAACTGG + Intronic
969115327 4:4867444-4867466 CGGGGGCTTCCCAGGGAGTCCGG - Intergenic
969160656 4:5255567-5255589 TGGGGCATTGACTGGGAATGAGG - Intronic
969191702 4:5526550-5526572 TGGGGCCTTCCCTGGAGAGCTGG + Intronic
971386199 4:26142425-26142447 TTGGGCCTTCACTGGGCAGCTGG + Intergenic
975530723 4:75396620-75396642 GAGGGCCTTCCCAGGGAAACGGG - Intergenic
976262088 4:83155359-83155381 TGGGGCCTTCCATGGCAACATGG - Intergenic
976744702 4:88391548-88391570 TGGGGTCTGACCTGGGCATCGGG - Intronic
979377470 4:119963984-119964006 TGGGGCATTCCCTGGAATCCAGG - Intergenic
981412535 4:144449836-144449858 TCAGGCTTTCCCTGGGATTCAGG - Intergenic
984515256 4:180730928-180730950 TAGGGCATTCACTGGGAGTCTGG + Intergenic
984523614 4:180830008-180830030 TGAGTTCTTACCTGGGAATCTGG + Intergenic
985551965 5:538361-538383 TGGGGGCTTCCCTGTGAAGGGGG - Intergenic
985913267 5:2898934-2898956 AGGAGCCTTCCCTGGGAGCCGGG + Intergenic
989899893 5:47155261-47155283 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989900060 5:47157981-47158003 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989900219 5:47160702-47160724 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989900537 5:47166143-47166165 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989900703 5:47168862-47168884 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989900872 5:47171583-47171605 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989901035 5:47174304-47174326 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989901202 5:47177025-47177047 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989901364 5:47179745-47179767 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989901511 5:47182126-47182148 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989901677 5:47184846-47184868 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989901843 5:47187566-47187588 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989902008 5:47190290-47190312 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989902171 5:47193008-47193030 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989902334 5:47195727-47195749 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989902485 5:47198107-47198129 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989902652 5:47200827-47200849 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989902817 5:47203547-47203569 TGTGGCCTTCATTGGGAATGGGG + Intergenic
989902985 5:47206265-47206287 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989903150 5:47208986-47209008 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989903371 5:47212722-47212744 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989903515 5:47215103-47215125 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989903712 5:47218504-47218526 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989903875 5:47221223-47221245 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989904023 5:47223603-47223625 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989904192 5:47226323-47226345 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989904367 5:47229210-47229232 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989904532 5:47231930-47231952 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989904695 5:47234651-47234673 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989904859 5:47237370-47237392 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989905105 5:47241449-47241471 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989905272 5:47244168-47244190 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989905442 5:47246884-47246906 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989905592 5:47249264-47249286 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989905757 5:47251984-47252006 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989905925 5:47254703-47254725 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989906093 5:47257425-47257447 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989906256 5:47260145-47260167 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989906424 5:47262865-47262887 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989906589 5:47265586-47265608 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989906751 5:47268308-47268330 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989906923 5:47271030-47271052 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989907089 5:47273751-47273773 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989907250 5:47276471-47276493 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989907416 5:47279192-47279214 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989907577 5:47281911-47281933 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989907743 5:47284630-47284652 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989907908 5:47287351-47287373 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989908065 5:47290069-47290091 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989908230 5:47292790-47292812 TGAGGCCTTCATTGGGAATGGGG + Intergenic
989908396 5:47295511-47295533 TGAGGCCTTCATTGGGAATGGGG + Intergenic
991130981 5:63122090-63122112 TAGGGACTTGCCTGGGAGTCAGG + Intergenic
992484190 5:77180097-77180119 TGGAGCCTTTCTTGGGACTCAGG - Intergenic
992548998 5:77844169-77844191 TGGGGCCCTCCCAGAGAAGCGGG + Intronic
995051715 5:107714335-107714357 TGGGGTATAGCCTGGGAATCAGG + Intergenic
997544967 5:134698522-134698544 TGGGGCCTGGCCTGGGAGTCAGG + Intronic
998396541 5:141822240-141822262 TGGGGCCTTGGCTGGAATTCTGG + Intergenic
1000614549 5:163412916-163412938 TGTAGACTTCCATGGGAATCTGG + Intergenic
1001290238 5:170452074-170452096 TGGGTCTTTCCATGGGAAGCAGG - Intronic
1001577313 5:172772427-172772449 GGGGGCCGTCACTGGGACTCAGG - Intergenic
1002918533 6:1548463-1548485 TGGGGCCTTGCTTGGTTATCAGG - Intergenic
1004289336 6:14352018-14352040 TGTGGCCTCTCCTGGGAAGCAGG - Intergenic
1005808704 6:29500229-29500251 TGGGGTGTTCCCTGCCAATCAGG + Intergenic
1005954884 6:30656857-30656879 TGGGGGCTTCCTAGGGAACCGGG - Intronic
1006515326 6:34542224-34542246 TGCAGCTTTCCCTGGGAAGCAGG - Intronic
1007445410 6:41901886-41901908 TTGGGCCTCCCCTGAGAATTTGG - Intergenic
1008932634 6:56955513-56955535 AAGGGCCTTCCCTGGGAATTGGG + Intronic
1009686880 6:66971278-66971300 TGTGGCTTTGCCTGGGAATAAGG - Intergenic
1012303992 6:97627292-97627314 TGCAGCCTCCCCTGGGAATAGGG + Intergenic
1014415522 6:121178568-121178590 TGGGGGCTACCCTAAGAATCTGG - Intronic
1018034104 6:159866947-159866969 TGGAGCCTTCCCTGGGCCACAGG + Intergenic
1019594480 7:1852093-1852115 TGGGTCCTGCCCTGGGTCTCGGG - Intronic
1019932714 7:4234447-4234469 TGTGACCTCGCCTGGGAATCAGG + Intronic
1020238408 7:6374274-6374296 AGGTCCCTTCCCTGGGACTCAGG - Intergenic
1022500262 7:30878287-30878309 TGGGGCCCTCACTGGGTATGTGG + Intronic
1022647496 7:32244947-32244969 CTGGGCCTTCCCAGGGACTCTGG - Intronic
1023210522 7:37799140-37799162 TGGTGCCTTCACTGGAAGTCTGG - Intronic
1024467596 7:49728752-49728774 TGAGACCTTCCCTGAGACTCAGG - Intergenic
1025250592 7:57348919-57348941 TGGGGCCTTCCTCTTGAATCAGG + Intergenic
1025468487 7:60750510-60750532 TGAGGCCTTCGTTGGGAAACGGG + Intergenic
1026449070 7:70511466-70511488 TGGGGCTGTCCCAGGGAAACTGG - Intronic
1031506633 7:122592825-122592847 TGGGGCCTTCCAGGGGGATGGGG + Intronic
1032446633 7:131989841-131989863 AGGGGCCTTTCCTTGGAGTCAGG - Intergenic
1032757883 7:134908633-134908655 TGGGGCATGGCCTGGGCATCAGG + Intronic
1033129538 7:138734000-138734022 GGGGTACTTCCCTGGGCATCTGG - Intronic
1033248240 7:139736534-139736556 AGATGCCCTCCCTGGGAATCAGG - Intronic
1034276142 7:149824659-149824681 TGGAGCCTGCCCTGGTAATGGGG + Intergenic
1034416802 7:150969580-150969602 AGGAGCCTTCCCTGGGAGTCAGG - Intronic
1035238392 7:157514936-157514958 TGGGGTCTGCCCTGGGGGTCAGG + Intergenic
1037918157 8:22785336-22785358 TGGGGCCACCTATGGGAATCTGG + Intronic
1039437042 8:37566885-37566907 TGGGGAAGTCCCTGGGAAGCAGG - Intergenic
1039840438 8:41289153-41289175 AGGGGCCTTGCCTGGGGAGCAGG + Intronic
1040105562 8:43539674-43539696 TGCGGGCTTCCCTGGGAATTGGG + Intergenic
1042604745 8:70534197-70534219 TGGGGGCTCCACTGGGGATCAGG - Intergenic
1042761199 8:72273274-72273296 TGGGTCATTCCCTGAGGATCTGG + Intergenic
1042793578 8:72635449-72635471 TGGGGCCTTTCCTGTCAACCAGG - Intronic
1044948657 8:97414724-97414746 TGGGGGCCTTCATGGGAATCTGG + Intergenic
1047723978 8:127668796-127668818 CCTGTCCTTCCCTGGGAATCAGG - Intergenic
1048159485 8:132000987-132001009 TGAGTACTTGCCTGGGAATCTGG - Intronic
1048899470 8:139023896-139023918 TGGGGCCATTCATGGCAATCAGG + Intergenic
1049170037 8:141154207-141154229 CGGGGCCTTCCCCAGGAACCTGG + Intronic
1049747322 8:144268587-144268609 TGGGGGCTTCCCAGGGAGCCGGG - Intronic
1052881417 9:33602974-33602996 GGGGGCTTTCCATGGGAATTGGG + Intergenic
1053432852 9:38054594-38054616 TGGGGTCCTGGCTGGGAATCTGG + Intronic
1053667290 9:40325146-40325168 TGGGGGCTTCCATGGGAATTGGG + Intronic
1053787951 9:41665613-41665635 TGGGCCTTTCCCTGGGACTTGGG - Intergenic
1053916871 9:42950251-42950273 TGGGGGCTTCCATGGGAATTGGG + Intergenic
1054157180 9:61649155-61649177 TGGGCCTTTCCCTGGGACTTGGG + Intergenic
1054176227 9:61876955-61876977 TGGGCCTTTCCCTGGGACTTGGG - Intergenic
1054378435 9:64465174-64465196 TGGGGGCTTCCATGGGAATTGGG + Intergenic
1054423479 9:64974869-64974891 TGAGGCCTTCCCTGGAAACGGGG + Intergenic
1054476955 9:65580160-65580182 TGGGCCTTTCCCTGGGACTTGGG + Intergenic
1054517320 9:66051137-66051159 TGGGGGCTTCCATGGGAATTGGG - Intergenic
1054661312 9:67703853-67703875 TGGGCCTTTCCCTGGGACTTGGG + Intergenic
1057053818 9:91946493-91946515 TGGTTCATTCCCTGGGAACCTGG - Intronic
1059465802 9:114468073-114468095 TGTGCCCTCCCCTGGGAAGCTGG - Intronic
1059998958 9:119941318-119941340 TGGGGCCTTCCCAGGCAAGTTGG - Intergenic
1061137103 9:128741304-128741326 AGGGGCTTTCCCTGGGAGTGGGG + Intronic
1061191769 9:129086362-129086384 TGGGGCCTTCCCAGGGAGACAGG - Intronic
1062074043 9:134574861-134574883 TGAGTCCTTGCCTGGGAGTCAGG + Intergenic
1062084930 9:134643554-134643576 TGGGGGCTGCCCTGGGGCTCTGG + Intronic
1062496940 9:136836388-136836410 TGGTGCCTCCCCTGGGACCCAGG + Intronic
1062573816 9:137197469-137197491 TGTGGCCATCCCTGGGAGCCTGG - Intronic
1062598372 9:137309210-137309232 TGGGGCCTTCCCTGGGGGGGTGG + Intronic
1185888167 X:3801603-3801625 TGGGGCCTTATTTGGAAATCCGG + Intergenic
1186218690 X:7326525-7326547 TGGGGCCTTAGCTGGGGACCCGG - Intronic
1186776875 X:12873646-12873668 AGGGGCCTTCCCTGGGAAGAGGG - Intronic
1189175560 X:38953772-38953794 TGGGGACTTCTTTGGGAATCTGG + Intergenic
1195094644 X:101492258-101492280 TTGGGCTCTCGCTGGGAATCAGG + Exonic
1195155138 X:102115600-102115622 TTGGGGCTTTCCTGGGAAACAGG - Intergenic
1197046780 X:122007219-122007241 TGGGATCTTCCCTGGGAAAGAGG + Intergenic