ID: 1138387339

View in Genome Browser
Species Human (GRCh38)
Location 16:56644621-56644643
Sequence CTGGAGGCACAGCTTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 6, 3: 52, 4: 432}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138387334_1138387339 0 Left 1138387334 16:56644598-56644620 CCTGAACTAAGCGTCTTTTGGGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG 0: 1
1: 0
2: 6
3: 52
4: 432
1138387331_1138387339 4 Left 1138387331 16:56644594-56644616 CCATCCTGAACTAAGCGTCTTTT 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG 0: 1
1: 0
2: 6
3: 52
4: 432
1138387330_1138387339 19 Left 1138387330 16:56644579-56644601 CCTGACAGAACAATGCCATCCTG 0: 1
1: 0
2: 1
3: 17
4: 125
Right 1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG 0: 1
1: 0
2: 6
3: 52
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138387339 Original CRISPR CTGGAGGCACAGCTTGAGGC AGG Intronic
900139127 1:1132149-1132171 CGGGAGGCAGAGCCTGAGACGGG + Intergenic
900291352 1:1924891-1924913 CTGGAGGCAGAGCCCGAGACGGG - Intronic
900423144 1:2564386-2564408 CTGGGGGCTCTGCTGGAGGCAGG - Intronic
900740077 1:4325758-4325780 CTGCAGGGGCAGCCTGAGGCTGG - Intergenic
901083682 1:6597811-6597833 CTGGACCCAGAGCTTCAGGCAGG + Intronic
901287708 1:8094310-8094332 CTGCAGGGTCAGCGTGAGGCTGG + Intergenic
901792671 1:11662499-11662521 CTGGAGGCCCAGCCACAGGCTGG + Exonic
902073483 1:13762863-13762885 ATAGAGGCACAGCTGCAGGCAGG + Intronic
902205456 1:14865105-14865127 CTGGATGCAAAGATTCAGGCAGG + Intronic
902374295 1:16023037-16023059 CTGGGGGCACAGCAAGGGGCTGG + Intronic
902828299 1:18992700-18992722 GTGGAGAAACAGGTTGAGGCTGG - Intergenic
903742239 1:25565030-25565052 CTGGAGGCACGGCCTCAGGCAGG - Intronic
903849138 1:26295843-26295865 CTGGAGGATCTGCTTGGGGCAGG - Intronic
904012610 1:27398462-27398484 CTGGAGGCACAGCACAGGGCAGG + Intergenic
904247660 1:29199299-29199321 CCGGAGGCAGAGCTTGCGGTGGG - Intronic
905013873 1:34764034-34764056 CTGGAAGCAGAGCCAGAGGCAGG + Intronic
905288943 1:36908224-36908246 CTGGAAGCAGAGCCTGAGGCAGG - Intronic
905688691 1:39927149-39927171 CTGGAACTACAGCTTGAGGCAGG - Intergenic
906552001 1:46672946-46672968 CTGGAGGAAGAACTTGAGGCGGG + Exonic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907977321 1:59444589-59444611 CTGGCTGCACAGCATGAGGTGGG + Intronic
909877547 1:80828158-80828180 ATGGAGGCCCAGATTGAGGGTGG - Intergenic
910410874 1:86943473-86943495 TTGGAGGCTGAGGTTGAGGCTGG + Intronic
911634437 1:100218307-100218329 CTAGAGGCACAGCATGAGATAGG - Intronic
914334473 1:146701921-146701943 CTTCAGGCACAGCTTGATCCAGG + Intergenic
914846483 1:151286587-151286609 CTGGAGGCTCAGCAGGAGACGGG + Exonic
915055925 1:153130423-153130445 CTCCAGGCACAGCTTCAGGTAGG + Intergenic
916059518 1:161089050-161089072 CTGGGGGCACTGCTGGAAGCTGG + Intronic
916253705 1:162764751-162764773 CTGGAGGCAGAGCTTGCAGTGGG + Intronic
916295857 1:163218974-163218996 CTGGAGTCAAAGCTTGTTGCTGG + Intronic
917240140 1:172939444-172939466 CTCGAGGCAGAGCCTGAGACAGG + Intergenic
918070437 1:181130257-181130279 CTGCAGGGACATTTTGAGGCAGG - Intergenic
919452510 1:197788160-197788182 CTGGAGGCCAAACTAGAGGCTGG + Intergenic
922869024 1:228884955-228884977 CCTGGGGCACAGATTGAGGCAGG - Intergenic
923978839 1:239297250-239297272 TTGGAAGCAGAGCTTGAGGAGGG + Intergenic
1062908804 10:1199174-1199196 CTGCAGGCCCAGCATGAGGCTGG + Intronic
1063456967 10:6190571-6190593 CAGGGGGGACTGCTTGAGGCTGG + Intronic
1064417154 10:15159836-15159858 TAGGAGCCACAGCTTGGGGCAGG + Intronic
1065170004 10:23017670-23017692 CAGGAGAATCAGCTTGAGGCTGG + Intronic
1066269981 10:33812952-33812974 CTGGGGACACTGCTTGTGGCTGG - Intergenic
1066340371 10:34526696-34526718 CTGGTGGCACAGCAGGAGGAGGG - Intronic
1066394010 10:35001435-35001457 CTGGAGGCTGAGGCTGAGGCAGG + Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1066612380 10:37263640-37263662 CAGGAGGCAGAGCTTCAGGTGGG + Intronic
1067286638 10:44912046-44912068 CTGGAGGGACAGGCTGAGCCTGG + Intronic
1069785052 10:70982387-70982409 CTCAAGGCAGAGCCTGAGGCAGG - Intergenic
1069878350 10:71576673-71576695 CTGGAGCCAGAGCCTCAGGCAGG + Intronic
1070560243 10:77560871-77560893 CTGGAGCCTCAGCTTGAAGAAGG - Intronic
1070785677 10:79160971-79160993 CTGGGGTCTCAGCTGGAGGCTGG - Intronic
1070806853 10:79275721-79275743 CTGGTGGTAGAGCCTGAGGCTGG - Intronic
1073242377 10:102066876-102066898 CTGAAGGCCCAGCTGGTGGCTGG + Exonic
1073457761 10:103647884-103647906 CAGGAGGCACTGGTTAAGGCAGG + Intronic
1074214123 10:111367530-111367552 ATGGAGGCACAGCACAAGGCAGG + Intergenic
1074550745 10:114439895-114439917 CTGCAGGGACAGCTTGACCCAGG + Intronic
1075268969 10:121032572-121032594 CCCGAGGCTCAGCTTGGGGCAGG + Intergenic
1075526938 10:123194952-123194974 ATGGAGGGACTGCTTGAGTCCGG - Intergenic
1076250850 10:128982774-128982796 CTGGATGCCCAGGTTGAGCCAGG + Intergenic
1076505995 10:130973063-130973085 CTGCAGGCTCGGCTTCAGGCAGG - Intergenic
1076648926 10:131973826-131973848 CTGGACGCACAGCATGAGTCTGG - Exonic
1076947232 10:133659693-133659715 GAGGATGCACACCTTGAGGCTGG - Intergenic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1078079829 11:8195865-8195887 CTGGAGGCTCAGCTAGGGGCTGG + Intergenic
1079689889 11:23405646-23405668 CTGGGGGCAGGGCCTGAGGCTGG + Intergenic
1080231165 11:30018290-30018312 CTGGAGTTACAGTTTGAGGAAGG + Intergenic
1080674261 11:34410390-34410412 CTGGAGGCAGAGCTTGCAGTGGG - Intergenic
1081222839 11:40483236-40483258 CTGGAGACAAAGCTAGAGGGAGG + Intronic
1081461022 11:43273112-43273134 CTGGAATCAGAGCCTGAGGCAGG + Intergenic
1081743196 11:45455281-45455303 CTGGATGCAGAGCCTGAGGCAGG - Intergenic
1083289919 11:61684110-61684132 CTGAAGGCACAGCTTGTCACTGG + Intronic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1085283876 11:75347544-75347566 AAGGACGCACAACTTGAGGCTGG + Intronic
1085538371 11:77241819-77241841 CTGTAGTCTCAGCCTGAGGCAGG + Intronic
1086212533 11:84338131-84338153 TTGGAAGCACAGTTTGAGACAGG + Intronic
1087723082 11:101688695-101688717 CTGGGAGAACAGTTTGAGGCTGG - Intronic
1088089911 11:106025380-106025402 GTGGAAGGACTGCTTGAGGCTGG - Intergenic
1088647248 11:111927000-111927022 CTGGAGGCGGAGCTGGAGGGGGG + Intergenic
1088696468 11:112370392-112370414 CTGGGGGTCCAGCCTGAGGCTGG + Intergenic
1089083534 11:115797746-115797768 GTGGAGACAAAGCTGGAGGCAGG + Intergenic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090565042 11:127980983-127981005 CTGGGGGCACAGTATTAGGCAGG - Intergenic
1090751611 11:129750841-129750863 CTGGAGGCACAGGGAGCGGCTGG + Intergenic
1090860868 11:130651309-130651331 CTGGAGGATCAGCTGGGGGCTGG - Intergenic
1091642724 12:2249880-2249902 CGGGAGGCGGAGCTTGAGGCAGG - Intronic
1096169436 12:49455499-49455521 GTGGGGGCACTGCTTGAGCCCGG - Intronic
1096186287 12:49583662-49583684 CTGGAGTCTCAGCCTTAGGCTGG + Intronic
1096565463 12:52473990-52474012 CTCGAGTCAAAGCTGGAGGCAGG - Intergenic
1097058256 12:56263646-56263668 CAGGAGGCTGAGGTTGAGGCAGG - Intergenic
1097081262 12:56432841-56432863 CAGGAGGCAGAGGCTGAGGCAGG + Intronic
1097942181 12:65322547-65322569 CTGGAGGCTGAGGCTGAGGCAGG + Intronic
1098977799 12:76921299-76921321 CTGGAGGCAGTGGTTGAGGGTGG + Intergenic
1099075684 12:78104479-78104501 CTGGATTCACAGTTAGAGGCAGG - Intronic
1099410974 12:82327358-82327380 GTGGAGGGATTGCTTGAGGCTGG - Intronic
1100283523 12:93141073-93141095 CTTGGGGCACAGCCTCAGGCAGG + Intergenic
1100659498 12:96681675-96681697 CAGGAGGCAGAGGCTGAGGCAGG - Intronic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1101852223 12:108412831-108412853 GTGGAAGGATAGCTTGAGGCCGG + Intergenic
1103038089 12:117672696-117672718 CTGGAGGCAGAGGTTGTGGTGGG - Intronic
1103200301 12:119082677-119082699 CTGGAGGCCCAGGGTGGGGCTGG - Intronic
1103219816 12:119234378-119234400 CTGGAGGCAGAGAAAGAGGCCGG - Intergenic
1103262971 12:119604713-119604735 CTTGAGCCAGAGATTGAGGCTGG - Intronic
1103459188 12:121090145-121090167 CTGCAGGCCCAGCCTGGGGCCGG + Intergenic
1104469466 12:129018075-129018097 ATGGAGGGTCAGCTTGAGGGTGG - Intergenic
1104703899 12:130928345-130928367 CTGCAGGCACAGCTGGATCCAGG - Intergenic
1104962279 12:132493905-132493927 CTGCAGGCACACCCTGAGCCAGG - Intronic
1105218888 13:18307432-18307454 CTGGAGGCAGAGCCTGGGGGAGG - Intergenic
1105303110 13:19152530-19152552 CAGGAGGCACAGGCTGAGCCTGG + Intergenic
1106022303 13:25926992-25927014 CGGGAGGCACAGCAGGATGCAGG - Intronic
1106125845 13:26899506-26899528 CTGGAGGCAGAGCTGCAAGCCGG - Intergenic
1106138799 13:26993708-26993730 CTGCAGGGACAGCTTTAGCCAGG - Intergenic
1108002046 13:45912664-45912686 CTGGAAGCACAGCTTGAAGATGG - Intergenic
1108573218 13:51769923-51769945 CTGGAGCCAGAGCGTGTGGCTGG - Intronic
1109606329 13:64702859-64702881 CAGGAGGCAGAGGCTGAGGCAGG - Intergenic
1109873794 13:68371250-68371272 CAGGAGGCAGAGGTTGAGGTGGG - Intergenic
1110462478 13:75760278-75760300 TTGGAGGCAGCTCTTGAGGCAGG + Intronic
1111919417 13:94394831-94394853 CAGTAGGCACAGTTAGAGGCTGG + Intronic
1112229008 13:97569052-97569074 CTGGAAGCCCAGCCTGGGGCTGG + Intergenic
1113037040 13:106062007-106062029 CAGGGAGCACAGCCTGAGGCAGG - Intergenic
1113582043 13:111436862-111436884 CTAGAGGCACTACTTGAAGCAGG + Intergenic
1114989107 14:28264695-28264717 CTGGACGCACAGCATGAGTCTGG + Intergenic
1115804901 14:37039858-37039880 CTTGAGGCTAAGCTTGAGGCAGG + Intronic
1116773390 14:49152660-49152682 GTGGAGGCACAGCTCTAGGTAGG - Intergenic
1117531027 14:56661012-56661034 CTGAAGGAAAAGCTGGAGGCGGG + Intronic
1119387405 14:74266227-74266249 CTGGAGGGCCAGCAGGAGGCTGG - Intergenic
1119562164 14:75599211-75599233 CTGGAGGCACAGCATGGGGGAGG - Intronic
1120064404 14:80023455-80023477 CTGGAGGTACAGTTTGAAGTCGG + Intergenic
1121339170 14:93094741-93094763 CTGCAGGCACAGGGAGAGGCAGG + Intronic
1122207790 14:100156825-100156847 CTGGGGGAACAGCTTGTGCCGGG + Intronic
1122574153 14:102731338-102731360 GTGGAGCCACAGCTACAGGCAGG + Intergenic
1122804313 14:104248905-104248927 CTGCAGGCAGAGGTTGAGGAGGG - Intergenic
1123029539 14:105445179-105445201 ATGGAGACACAGGTTGAGGTTGG + Intronic
1123057177 14:105576023-105576045 CTGGAGGCTCAGATGGAGACGGG - Intergenic
1123081067 14:105695868-105695890 CTGGAGGCTCAGATGGAGACGGG + Intergenic
1123213649 14:106785353-106785375 CTGCAGGCCCAGCAGGAGGCCGG - Intergenic
1124306040 15:28579955-28579977 CAGGAGGCACAGCTTGCAGTGGG - Intergenic
1124416041 15:29473950-29473972 CAGGAGGCCCAGCTTGATGTGGG - Intronic
1125263015 15:37848942-37848964 CTGGAGGCACAGCTTCATTAAGG - Intergenic
1125385352 15:39130929-39130951 CTGGAGGCAAAGGTGGGGGCGGG - Intergenic
1125592202 15:40861822-40861844 CTGGAGGCTGAGGCTGAGGCAGG - Intergenic
1125689080 15:41582019-41582041 GAGGAGGCAGAGATTGAGGCAGG - Exonic
1126378745 15:48023832-48023854 CAGGAGCCACAACTGGAGGCAGG + Intergenic
1127261162 15:57327172-57327194 CGGGAGGGAGGGCTTGAGGCTGG + Intergenic
1128430808 15:67591490-67591512 CTGTAGTCCCAGCTGGAGGCTGG - Intronic
1128645521 15:69376022-69376044 CTGGATGCTGAGCTTGAGGCAGG + Intronic
1128807084 15:70539101-70539123 GTGCAGGCACAGCTTGTTGCTGG + Intergenic
1129701214 15:77769589-77769611 CTGGAGGCAAGGATGGAGGCAGG + Intronic
1130211783 15:81930658-81930680 GTGGAAGGACAGCTTGAGCCAGG - Intergenic
1130798812 15:87239292-87239314 CTGGGGGCATAGCATGAGGAGGG + Intergenic
1131148900 15:90034761-90034783 CTGCAGGCAAAACCTGAGGCAGG - Intronic
1131937652 15:97524214-97524236 CTGGAAGCAGAGGGTGAGGCTGG - Intergenic
1132095961 15:98985092-98985114 CTGGACGCAGAGCTTGAGGAGGG + Intronic
1132408456 15:101559580-101559602 CTGAAGGCACTGCTTCAGGTGGG + Intergenic
1132673438 16:1111967-1111989 CGGGAGGCACGGCTTGTGCCAGG + Intergenic
1132826360 16:1907541-1907563 CTGGAGGGTCAGGGTGAGGCGGG - Intergenic
1132885866 16:2181681-2181703 CTTGGGGCCCAGCTTGGGGCTGG + Intronic
1132907721 16:2291703-2291725 CTGGAGGAACAGCCTGGGGTGGG - Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1132975620 16:2709825-2709847 CTGGGTGCCCAGCATGAGGCCGG + Intergenic
1133209829 16:4257445-4257467 CTGGAGGCAGAGGTGGGGGCTGG + Exonic
1133322908 16:4925235-4925257 CTGGAGGGCCAGCTTGGGGGAGG + Intronic
1133896079 16:9930174-9930196 CTAGAGGCACAGCTTGATCTAGG - Intronic
1133964027 16:10518502-10518524 CTGGAGGCAACTCTTGAGGTTGG + Intergenic
1134269657 16:12722611-12722633 CTGTAGTCCCAGCGTGAGGCAGG + Intronic
1134518763 16:14908062-14908084 CTGGAGGCAGAGCTGGAGACAGG - Intronic
1134555165 16:15158154-15158176 CTGGAGGCAGAGGTGGAGACAGG + Intergenic
1134706434 16:16306715-16306737 CTGGAGGCAGAGCTGGAGACAGG - Intergenic
1134961106 16:18405395-18405417 CTGGAGGCAGAGCTGGAGACAGG + Intergenic
1134965408 16:18487998-18488020 CTGGAGGCAGAGCTGGAGACAGG + Intronic
1135544343 16:23355652-23355674 CTGGAGGCAGAGCCTGAGGCAGG + Intronic
1135568299 16:23529027-23529049 CTTGAGGCACAGCTTAATGCAGG - Intronic
1136188364 16:28601123-28601145 CTGGAGGCGCGGCCTGAGGTGGG - Intergenic
1136190836 16:28614117-28614139 CTGGAGGCGCGGCCTGAGGTGGG - Intronic
1136294002 16:29291544-29291566 CTGGAGTCACACCGTGTGGCTGG + Intergenic
1136316066 16:29455249-29455271 CTGGAGGCAGGGCCTGAGGTGGG + Intronic
1136430643 16:30194591-30194613 CTGGAGGCAGGGCCTGAGGTGGG + Exonic
1136461926 16:30416855-30416877 CAGGAGGGACTGCTTGAGCCAGG + Intronic
1137930628 16:52584052-52584074 CTGGAGGCACAGGGTGAGGGAGG - Intergenic
1138295350 16:55880514-55880536 CTGAAAGCAGAGCCTGAGGCAGG - Intronic
1138318461 16:56090533-56090555 CAGGTGGGACAGGTTGAGGCAGG - Intergenic
1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG + Intronic
1138388016 16:56649333-56649355 CTGGAGGCAGGGCTTGAGCCAGG + Intronic
1138391186 16:56670809-56670831 CTGGAGTCTGAGCTTGAGCCAGG + Intronic
1138393044 16:56683867-56683889 CTGGAGGCAGGGCTCGAGCCAGG + Intronic
1139526807 16:67521721-67521743 CTGGGGACACCGCCTGAGGCTGG - Intronic
1139941993 16:70612092-70612114 CTGGAAGCAGAGCCTGAGACAGG - Intronic
1139999148 16:71009311-71009333 CTTCAGGCACAGCTTGATCCAGG - Intronic
1140922444 16:79551566-79551588 AGGGAGGCACAGCTTCAGGAAGG - Intergenic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1142128458 16:88421529-88421551 CTGGAGGGACAGCTGGCAGCTGG + Intergenic
1142174909 16:88640686-88640708 CTCAAGGCACTGCTTGAGGAAGG - Intergenic
1142776588 17:2144831-2144853 CTGGAATCCCAGCTTTAGGCAGG + Intronic
1142889347 17:2932941-2932963 CTCCAGGCACAGGTCGAGGCTGG + Intronic
1143129999 17:4672026-4672048 GGGGAGGCAGAGCTGGAGGCAGG + Exonic
1144375831 17:14640154-14640176 GTGGAAGCACAGTTAGAGGCAGG + Intergenic
1144580221 17:16454615-16454637 CAGGAGGCAGAGGTTGAGGTGGG + Intronic
1145277776 17:21445035-21445057 CTGGTGGCAGTGCTGGAGGCCGG + Intergenic
1145315606 17:21730914-21730936 CTGGTGGCAGTGCTGGAGGCCGG + Intergenic
1145714044 17:27002853-27002875 CTGGTGGCAGTGCTGGAGGCCGG + Intergenic
1145882151 17:28360185-28360207 CAGGAGGATCACCTTGAGGCTGG - Intronic
1146362004 17:32184742-32184764 TTGGAGGCAGAGGTGGAGGCGGG - Intronic
1146445331 17:32928220-32928242 CGGGAGCCACAGCCTGAGGTGGG + Exonic
1147301329 17:39530761-39530783 CAGGAGGCTCTGCTTCAGGCTGG - Exonic
1147596692 17:41722615-41722637 CTAGAGAGACAGCTGGAGGCTGG + Intronic
1147768488 17:42852172-42852194 CTGGAGGCCCAGTTTGAGGCCGG + Exonic
1147771076 17:42868104-42868126 CTGGAGGCCCAGTTTGAGGCCGG + Intergenic
1148087647 17:45004091-45004113 CTGGTGCCTCAGCATGAGGCCGG + Intergenic
1148858033 17:50589781-50589803 CTGGAGCCTCAGCCTGAGCCCGG - Intronic
1149545601 17:57501255-57501277 CTGGAGGAACGGCTTGACTCCGG + Intronic
1149581413 17:57752940-57752962 ATGCAGGTACAGCTTGAGACTGG - Intergenic
1149792156 17:59488751-59488773 CTTCAGGCACAGCTTGACTCAGG + Intergenic
1149810482 17:59665129-59665151 GTGGAGGGATAGCTTGAGCCTGG + Intronic
1150114307 17:62531929-62531951 TTGGAGGCCCAGCTTGAAGTGGG + Intronic
1150133538 17:62681781-62681803 GTGGAGGCCCAGCTGGGGGCCGG + Intronic
1150157686 17:62868017-62868039 CTGGTTGCACAGCCTCAGGCAGG + Intergenic
1152320104 17:79603926-79603948 GTGCAGGGACAGCCTGAGGCCGG - Intergenic
1152896531 17:82914470-82914492 GTGCAGACACAGCTGGAGGCCGG - Intronic
1152971622 18:167597-167619 ATGGAAGGACTGCTTGAGGCTGG - Intronic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1154132513 18:11749745-11749767 AGTGAGGCCCAGCTTGAGGCTGG + Intronic
1154197657 18:12278401-12278423 CTGCAGGCACAGCTGGACGAAGG + Intergenic
1154218913 18:12434961-12434983 CTGCAGCCTCAGCTTGATGCCGG + Intergenic
1155074378 18:22342002-22342024 CTGGAGGCATAGGCTGAGGCTGG + Intergenic
1155077891 18:22378461-22378483 CTGGAAGGATCGCTTGAGGCTGG - Intergenic
1157718985 18:49908989-49909011 CTGGAGGGGCAGCCTGGGGCTGG - Intronic
1158355394 18:56612944-56612966 CTGGAGGGACCACTTGAGCCTGG - Intronic
1158451529 18:57570324-57570346 CTTGAGCCACAGCTTTAAGCAGG + Intronic
1160471030 18:79133892-79133914 CTGGAGTCAGAGCTGGAGCCAGG - Intronic
1160742741 19:694971-694993 CTGGAGGGACGGCCTGAGTCAGG + Intronic
1160984589 19:1832452-1832474 CTGCAGGGACAGCGGGAGGCCGG + Intronic
1160987701 19:1847038-1847060 CTGTAGGCACAGCTGTCGGCAGG + Intronic
1161319583 19:3634735-3634757 ATGGAGGCAGAGCCCGAGGCAGG - Intronic
1161666138 19:5578254-5578276 CTGGAGGCGCAGGTGGAGGCTGG - Intergenic
1161963520 19:7535427-7535449 CTGGGGGCAGGGCTTGAGGCAGG + Intronic
1162561948 19:11422209-11422231 TTGGAGGCGGAGCTTGAGACGGG + Intronic
1162758587 19:12874798-12874820 CTGGGGGCACAGCTTCAGCAGGG - Exonic
1162854698 19:13459399-13459421 CTGGAGGCAAAGGCTGAAGCTGG - Intronic
1164677556 19:30111875-30111897 GTGGAGGCAACTCTTGAGGCAGG + Intergenic
1165216446 19:34277179-34277201 CAGGAGGCACGACATGAGGCTGG + Intronic
1166916018 19:46196571-46196593 CTGGAGGCTCAGCTGGGGTCGGG - Intergenic
1166983880 19:46648678-46648700 CTGGAGGCAGAGCTGAAGGCAGG + Exonic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167215552 19:48162093-48162115 CTGCAGGCACAGCTGGATCCAGG - Intronic
1167745830 19:51351360-51351382 CTTCAGGCACAGCTTGATCCAGG - Intronic
1168187400 19:54708908-54708930 CTGCAGGCAGAGCCTGGGGCTGG - Intergenic
925104817 2:1282487-1282509 CAGAAGGCCCAGCTTCAGGCTGG + Intronic
925315799 2:2922188-2922210 CTGGAGGGTCAGCATGAGGCTGG - Intergenic
925367752 2:3322723-3322745 CTGGAGGCAGAGCTCAAAGCCGG + Intronic
925416504 2:3673470-3673492 CTGGAGTCAGAGCCTGGGGCAGG + Intronic
925712410 2:6754208-6754230 CTGGACCCACTGCTTGAGGCTGG - Intergenic
925912781 2:8584006-8584028 CTGGAGGCCCTCCCTGAGGCTGG - Intergenic
927164464 2:20303309-20303331 CTGGGAGCACTGCTTGAGCCTGG + Intronic
928213633 2:29342954-29342976 CAGGAGGCAGAGCTTGCAGCGGG - Intronic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
930798600 2:55419676-55419698 CTGGAGGCGAGGCTTGAGGGCGG - Intronic
931311347 2:61084026-61084048 CTGAAGGTACAGGTTGTGGCTGG - Intronic
931573800 2:63698529-63698551 CTGTTGGCACAGACTGAGGCTGG + Intronic
935173163 2:100626393-100626415 TTGGAGGTCCAGCTTCAGGCTGG + Intergenic
935607187 2:104982972-104982994 CTGGTGGCCAAGTTTGAGGCAGG + Intergenic
935679076 2:105620455-105620477 CTGGGGGCAGAGCTTGTGGCAGG - Intergenic
935865825 2:107386679-107386701 CTGAAGGAACAGCTGGATGCTGG - Intergenic
935954911 2:108366376-108366398 CTGGAGGCTGTGCTTGAGGAGGG + Intergenic
937224924 2:120363247-120363269 CCTGAGGCAGAGCTGGAGGCAGG + Intergenic
937307252 2:120879882-120879904 GTGGAGGCTCAGCTAGAGGCTGG - Intronic
937416904 2:121722239-121722261 TTGGAAGCACAGTTTGAGGTTGG + Intergenic
937506747 2:122546236-122546258 TTTGAGGCAAAGTTTGAGGCGGG - Intergenic
938342420 2:130544410-130544432 GAGGAGGCAGAGCTGGAGGCAGG + Intronic
938347412 2:130576299-130576321 GAGGAGGCAGAGCTGGAGGCAGG - Intronic
938551042 2:132382741-132382763 CTGGAGGTGCAGCTTCTGGCAGG - Intergenic
938582547 2:132660077-132660099 CTGGAGACAGTGCTAGAGGCGGG - Intronic
940908320 2:159188510-159188532 CTGAGGCCACAGCTTGCGGCTGG - Intronic
941936968 2:170989762-170989784 CTGTAGTCCCAGCTTGAGCCCGG + Intergenic
942267670 2:174244715-174244737 CAGGAGAAACAGCTTGAGCCCGG - Intronic
947544858 2:231003382-231003404 CTGGAAGCAGAGCCTGAGACTGG + Intronic
947844353 2:233232200-233232222 CTGGAAGCAGAGCCTGAGCCTGG + Intronic
948661056 2:239506666-239506688 ATGAAGGCAGAGCCTGAGGCGGG - Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1168992048 20:2103228-2103250 CTGGTGGCGCCGCTTGAGGCTGG - Exonic
1169374699 20:5057152-5057174 CTAGAAGCAGAGCCTGAGGCGGG - Intergenic
1169639534 20:7734842-7734864 CAGGAGGCAATGCATGAGGCTGG - Intergenic
1169916290 20:10686944-10686966 CTGGGGGCAGAGCTGGGGGCGGG - Intergenic
1170634580 20:18093294-18093316 CTTGAAGCACAGCTTGATTCAGG - Intergenic
1170662883 20:18360092-18360114 CTGGAGGACAAGCCTGAGGCTGG - Intergenic
1171146401 20:22787540-22787562 CTGGTGTCACTGCTGGAGGCAGG - Intergenic
1171247697 20:23625912-23625934 CTGGGGGCACAGAATGAGGCTGG - Intergenic
1171311841 20:24150989-24151011 CTGGAGGCAGAGTTTGAGGCTGG - Intergenic
1171465263 20:25323632-25323654 CTGCAGGCCCAGCCTCAGGCAGG + Intronic
1171824065 20:29878625-29878647 CTGGAGGAGCAGGTTGGGGCGGG - Intergenic
1172211242 20:33200030-33200052 GGGGAGGCACAGGTTGTGGCAGG - Intergenic
1172277194 20:33686197-33686219 CTGGAGGCCCTGCTCGGGGCCGG - Exonic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172390163 20:34560336-34560358 CTGGAGGCACAGGGCCAGGCAGG - Exonic
1172461986 20:35126120-35126142 TTGGAGGGACAGGTTGAGGATGG - Intronic
1172635514 20:36407245-36407267 ATGGGGGAACCGCTTGAGGCTGG + Intronic
1172764243 20:37342697-37342719 GTGGAGGGACAGCAGGAGGCAGG + Intergenic
1172897117 20:38308016-38308038 CTTCAGGTTCAGCTTGAGGCAGG + Intronic
1173023296 20:39285749-39285771 CTAGAAGCAGAGCCTGAGGCAGG + Intergenic
1173472074 20:43332041-43332063 CTGGAGGAACTGCATCAGGCGGG + Intergenic
1173585176 20:44176911-44176933 CTGGAGTCACACATGGAGGCTGG - Intronic
1174751776 20:53118353-53118375 CTGAAAGCAGAGCCTGAGGCAGG + Intronic
1174843922 20:53924948-53924970 CGGGAGGCAGAGGTTGAGGTGGG - Intergenic
1175248918 20:57597280-57597302 CTGGGGCCACAGCTGGAAGCCGG + Intergenic
1175304187 20:57964798-57964820 CTGCAGGCACAGCTGGATCCAGG + Intergenic
1175418322 20:58816093-58816115 CTTGAGACATAGCTTGAGGTGGG - Intergenic
1175596633 20:60239766-60239788 CTGGAGGGAAAGCCTGAGGGTGG + Intergenic
1175705121 20:61171084-61171106 CTGGAGTTACAGCTAGAGGAAGG - Intergenic
1175983152 20:62751452-62751474 CTGCAGGCGCAGCTTGACCCAGG + Intronic
1176034591 20:63030005-63030027 GTGGAGGCAGAGCCTGGGGCTGG + Intergenic
1176423551 21:6534003-6534025 CTGGAGGCAGACCTGGAGGCAGG + Intergenic
1178280238 21:31276120-31276142 CTGGAGGCTGAGCTTGAAGACGG + Intronic
1178660742 21:34505521-34505543 CTGGAGGGAGAGTGTGAGGCAGG + Intergenic
1179597165 21:42450669-42450691 TTGGCTGCCCAGCTTGAGGCCGG - Intergenic
1179649039 21:42794721-42794743 CTGCAGGCACAGCTGAAAGCTGG + Intergenic
1179699045 21:43142319-43142341 CTGGAGGCAGACCTGGAGGCAGG + Intergenic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181125862 22:20702261-20702283 CTGCAGGCGCTGGTTGAGGCAGG - Intergenic
1181466682 22:23114146-23114168 CTGGTGGCTCAGCTGCAGGCTGG + Intronic
1181855327 22:25777460-25777482 CTGGAGGCAGATCTGGAGGCAGG + Intronic
1182797208 22:32999739-32999761 CTGGAGGCAGAACTAGAGGGAGG + Intronic
1182837716 22:33357718-33357740 CGGGAGGCAGAGGTTGAGGGGGG + Intronic
1183859331 22:40658107-40658129 CAGGAGGCAGAGCATGATGCAGG - Intergenic
1184181614 22:42831874-42831896 GTGGAAGCACTGCTTGAGCCTGG - Intronic
1184743448 22:46442492-46442514 CAGGAGCCACAGCTGGGGGCAGG - Intronic
1185116348 22:48940421-48940443 CAGGAAGCACAGCCTGAGGCAGG + Intergenic
1185161557 22:49232929-49232951 CTGGGGGCACAGGCTGGGGCAGG + Intergenic
1185322620 22:50208955-50208977 CTGCAGGGCCAGCTTGGGGCGGG + Intronic
1185393152 22:50573404-50573426 CTGGAGGCACAACTAGGGGAGGG - Intronic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
951864610 3:27294264-27294286 GTGCAGGCACAGCTGCAGGCTGG - Intronic
953690415 3:45112952-45112974 CTGGAAGCAGAGCCTGAGACAGG - Intronic
954317672 3:49810129-49810151 CTGAAGCCACTGCTGGAGGCAGG - Exonic
954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG + Intergenic
956050676 3:65244934-65244956 CGGGAGGCAGAGCTTGCGGTGGG - Intergenic
956185011 3:66553926-66553948 GTGGATGCATAGCTTGAGCCTGG + Intergenic
956668623 3:71664966-71664988 CTTCAGGCACAGCTTGATCCAGG - Intergenic
957080224 3:75630723-75630745 GAGGATGCACACCTTGAGGCTGG + Intergenic
961306230 3:125960227-125960249 ATTGAGGCTCAGCCTGAGGCGGG + Intergenic
962060788 3:131924951-131924973 CTTGAAGCACAGCTTAAGTCAGG + Intronic
962860809 3:139399235-139399257 ATGGAGGCAGAACTTGAGACAGG - Intergenic
963463269 3:145644851-145644873 GTGGAAGGACAGCTTGAGCCTGG - Intergenic
963897868 3:150705241-150705263 CGGGAGGATCAGCTTGAGCCGGG - Intergenic
964773660 3:160252479-160252501 AAGGAGGGACAGCTTGAGGCAGG + Intronic
965726989 3:171728202-171728224 CAGGAGGCAGAGGCTGAGGCAGG + Intronic
965781399 3:172289741-172289763 GCGGAGGCACATCCTGAGGCTGG - Intronic
966464299 3:180212814-180212836 CTGGAGACACAGCCTGGGGATGG - Intergenic
966624964 3:182005860-182005882 CTGGAGAGGCAGCTCGAGGCAGG + Intergenic
966807557 3:183818866-183818888 CTGGAGGGAGAGGATGAGGCTGG + Intronic
967534773 3:190589669-190589691 TTGGCTGCACATCTTGAGGCGGG + Intronic
968545452 4:1195500-1195522 CTCCAGGCACAGCTCGAGGTTGG + Intronic
968546139 4:1199978-1200000 CTGGAGGCTGGGCTTCAGGCTGG - Intronic
968966629 4:3772255-3772277 CTGCAGGCCCATCTCGAGGCTGG + Intergenic
969038397 4:4274498-4274520 CAGGAGGCTGACCTTGAGGCTGG - Exonic
969298164 4:6281584-6281606 GTGGTGGCACAGCCTGAGGTAGG + Intronic
969532349 4:7736914-7736936 CAGGAGGCAAAACTTGGGGCTGG + Intronic
969629085 4:8324943-8324965 CAGGATGCACAGCTGGAGGGTGG + Intergenic
970030808 4:11672540-11672562 GTGGAAGCTCAGATTGAGGCAGG - Intergenic
970974131 4:22023413-22023435 CTGGGGACACAGGTTGAGGCTGG + Intergenic
973014367 4:45119042-45119064 CAGGAGGAACAGCATGAGGGAGG + Intergenic
973533551 4:51857547-51857569 CTGGGAGCACAGCTTGATGTGGG + Intronic
974935809 4:68408717-68408739 CAGGAGGCTCAGGCTGAGGCAGG - Intergenic
975057273 4:69949763-69949785 CTAGAGGCAAAGCTTTAGGGAGG + Intergenic
976676323 4:87707754-87707776 CAGCAGGCACTGCTTTAGGCAGG - Intergenic
977223762 4:94370381-94370403 CTGGAGGCTCTGAATGAGGCAGG + Intergenic
979667386 4:123327345-123327367 TAGGAGGCACTGTTTGAGGCTGG - Intergenic
980354229 4:131723529-131723551 ATGGAGCCACAGCTCGACGCAGG + Intergenic
980354768 4:131726035-131726057 ATGGAGCCACAGCTCGACGCAGG + Intergenic
980355303 4:131728512-131728534 ATGGAGCCACAGCTCGACGCAGG + Intergenic
980355852 4:131731013-131731035 ATGGAGCCACAGCTCGACGCAGG + Intergenic
980356388 4:131733504-131733526 ATGGAGCCACAGCTCGACGCAGG + Intergenic
980356927 4:131735992-131736014 ATGGAGCCACAGCTCGACGCAGG + Intergenic
980357467 4:131738484-131738506 ATGGAGCCACAGCTCGACGCAGG + Intergenic
980358006 4:131740973-131740995 ATGGAGCCACAGCTCGACGCAGG + Intergenic
980358538 4:131743464-131743486 ATGGAGCCACAGCTCGACGCAGG + Intergenic
980359080 4:131745937-131745959 ATGGAGCCACAGCTCGACGCAGG + Intergenic
980359619 4:131748408-131748430 ATGGAGCCACAGCTCGACGCAGG + Intergenic
980360160 4:131750900-131750922 ATGGAGCCACAGCTCGACGCAGG + Intergenic
980360701 4:131753375-131753397 ATGGAGCCACAGCTCGACGCAGG + Intergenic
980361244 4:131755855-131755877 ATGGAGCCACAGCTCGACGCAGG + Intergenic
980361784 4:131758330-131758352 ATGGAGCCACAGCTCGACGCAGG + Intergenic
980362327 4:131760810-131760832 ATGGAGCCACAGCTCGACGCAGG + Intergenic
981162767 4:141518690-141518712 CTGGGGACACAGCTTCTGGCAGG - Intergenic
981841159 4:149113940-149113962 TTGGAGGCAGAGCTGGAGGATGG + Intergenic
983356037 4:166658206-166658228 CTAGAGGCAAAGCCTGAGACAGG - Intergenic
985379475 4:189377201-189377223 CTGGATGCTCAGCTGGAGGTAGG + Intergenic
985450690 4:190060493-190060515 GAGGATGCACACCTTGAGGCTGG - Intergenic
989594812 5:43146481-43146503 CTGGAGGCTGAGGCTGAGGCAGG + Intronic
991996676 5:72394555-72394577 CTGGTGGCACAGGATGGGGCTGG + Intergenic
992057126 5:73001166-73001188 GTGGAGGGATAACTTGAGGCTGG + Intronic
992400513 5:76407071-76407093 GTGGGAGGACAGCTTGAGGCTGG - Intronic
996843348 5:127872568-127872590 CTGGATGGACATCTTCAGGCAGG - Intergenic
999264945 5:150260617-150260639 CTGGAAGCAGAGCCTGAGTCAGG - Intronic
1000197306 5:158972182-158972204 CTGGGGACACAGATTGAGGTGGG - Intronic
1001043444 5:168353330-168353352 CTGGAAGGACAGCATGAGACTGG - Intronic
1001066777 5:168541122-168541144 GTGGAAGGACAGCTTGAGCCTGG + Intergenic
1001410091 5:171505317-171505339 CTGGAGGCACTGGTTGCGGCTGG + Intergenic
1001515762 5:172354238-172354260 CTCGAAGCACAGATTGAAGCAGG - Intronic
1001654414 5:173338582-173338604 CTGGAGGCCCAGCATGTGGTGGG + Intergenic
1001999938 5:176191883-176191905 CTGGGGGTGCAGCCTGAGGCGGG - Intergenic
1001999953 5:176191924-176191946 CTGGGGGTGCAGCTTGATGCAGG - Intergenic
1002089610 5:176796764-176796786 CTGGAGCCACAGGGTGTGGCCGG - Intergenic
1002470377 5:179431436-179431458 CTGGAGCCACAGCATCAGCCAGG - Intergenic
1003181523 6:3795964-3795986 CTGCAGCCACAGCTGGAGTCTGG + Intergenic
1006078592 6:31550761-31550783 CAGGAGGCAGAGGTTGAGGTGGG - Intronic
1007315811 6:40987959-40987981 CTGCAGTCTCATCTTGAGGCTGG + Intergenic
1007406819 6:41640129-41640151 CCGGAGGGACAGCTGGGGGCAGG + Intronic
1007938423 6:45754571-45754593 CCCGAGGCACACCTTGCGGCTGG + Intergenic
1008777704 6:55061601-55061623 GTGGAGGCACAGGCTGTGGCAGG + Intergenic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1010927068 6:81755574-81755596 GTGGAAGCACAGCATGAAGCTGG + Intergenic
1011259734 6:85458408-85458430 CTGGATGACCAGCTTCAGGCAGG + Intronic
1011260830 6:85468278-85468300 ATAGAGGCAGAGCTGGAGGCAGG + Intronic
1011278173 6:85650168-85650190 CAGGAGGCAGAGGTTGTGGCGGG - Intergenic
1012442108 6:99270423-99270445 CTGGTGGCACAGCTTGGGAAGGG - Intergenic
1012863174 6:104586271-104586293 GTGGGAGCATAGCTTGAGGCTGG - Intergenic
1013396819 6:109748975-109748997 ATGGAGGCAAAGCTTGGGGTGGG + Intronic
1014080679 6:117282800-117282822 CTGCAGGCAGAGCTTTTGGCAGG - Intergenic
1016040653 6:139428792-139428814 GTGGAGGGACTGCTTGAGCCCGG - Intergenic
1016409829 6:143771347-143771369 CTGTAGTCCCAGCTTGAGCCTGG - Intronic
1016836545 6:148483027-148483049 CTGGAAGCACAGCCTGAGATAGG + Intronic
1016840216 6:148517999-148518021 CTAGAGGCACAACCTGTGGCAGG - Intronic
1017055588 6:150433017-150433039 CTGGCTGCAGAGCTTGACGCTGG - Intergenic
1017995381 6:159527637-159527659 CTGGAGCCACAGCCTGGGGTAGG - Intergenic
1018138178 6:160799066-160799088 GTGTAGGCAAAGCCTGAGGCCGG - Intergenic
1018548508 6:164964496-164964518 CTGTAGGAACAGCTTGACCCAGG - Intergenic
1018822300 6:167382929-167382951 CTGGAGGGTCAGCTCGAGGCCGG - Exonic
1019127424 6:169850100-169850122 GTGGGGACACAGCTGGAGGCAGG - Intergenic
1019353104 7:564340-564362 CTGGCGGCGGAGGTTGAGGCTGG - Intronic
1019580543 7:1759795-1759817 CTCGAGGCAGAGCCTGAGACAGG + Intergenic
1019705494 7:2495450-2495472 CTGGAGGCAGGGGTGGAGGCAGG + Intergenic
1019906998 7:4072464-4072486 CTGGGGGCACAGGGTGATGCTGG - Intronic
1020212476 7:6166858-6166880 GAGGAGGAACAGCTGGAGGCTGG - Intronic
1020247602 7:6442007-6442029 GTGGAGACACAGCTTCAGCCAGG + Intronic
1021608732 7:22435367-22435389 CTGGAGGGACAGCACGAAGCTGG + Intronic
1022846171 7:34212233-34212255 CTGTAGCCACAGAATGAGGCAGG - Intergenic
1028735958 7:94212353-94212375 CTGAAGGCACCACTTGAGGCTGG - Intergenic
1028905759 7:96152356-96152378 CGGGAGGCAGAGCCTGAGGCAGG + Intronic
1029272400 7:99385075-99385097 CTGTAGTCCCAGCCTGAGGCAGG - Intronic
1030533207 7:110735751-110735773 CTGTAGTCCCAGCTTGAGCCTGG + Intronic
1030587539 7:111439281-111439303 CTGGAGGGGAAGCTTGAGACTGG - Intronic
1030924686 7:115437550-115437572 CTGTAGTCCCAGCCTGAGGCAGG - Intergenic
1032044012 7:128587700-128587722 CTGGAGGCCCAGCTTGAAGTGGG + Intergenic
1032268499 7:130384353-130384375 CTGCAGGCACAGCTTGGGATGGG - Intronic
1032303239 7:130709209-130709231 GTGGAGGAATAGCTTGAGCCAGG + Intergenic
1032547994 7:132759496-132759518 CTGGAGGCACTGCTTGCCACAGG - Intergenic
1032868071 7:135949090-135949112 GTTGAGGCACAGCTTGACCCTGG - Intronic
1033741226 7:144277208-144277230 CTGGAGCAGCAGTTTGAGGCGGG + Intergenic
1033752677 7:144372406-144372428 CTGGAGCAGCAGTTTGAGGCGGG - Exonic
1035825928 8:2644028-2644050 TGGGAGGCCAAGCTTGAGGCTGG + Intergenic
1035911712 8:3574312-3574334 CAGGAGGCAGAGCTTGAAGTGGG - Intronic
1036503156 8:9331933-9331955 ATGGAGGGAAAGCTTGAAGCTGG - Intergenic
1037323324 8:17664506-17664528 CTGCAGGCAGAGCTGGAGGCAGG - Intronic
1037992965 8:23333527-23333549 CTGGGGGCCCAGCTTGCAGCTGG + Exonic
1038244770 8:25845337-25845359 CAGGAGGCAGAGGCTGAGGCAGG - Intronic
1038726052 8:30083226-30083248 GGGGAGGCACGGCTGGAGGCGGG + Intergenic
1039862228 8:41468866-41468888 CTGGAGAGACAGGGTGAGGCTGG - Intergenic
1041307161 8:56473235-56473257 TTGGATGCACAGATGGAGGCCGG + Intergenic
1041465326 8:58152634-58152656 ATGGCGGCACACTTTGAGGCAGG - Intronic
1041843477 8:62298722-62298744 CTGGAGGAACAGATTTAGGTTGG - Intronic
1043231564 8:77808643-77808665 CTGCAGGCACCATTTGAGGCAGG - Intergenic
1044791680 8:95853870-95853892 CTAGGGTCACAGCTTGTGGCTGG + Intergenic
1047350828 8:124071972-124071994 TTGGAGACACAGCTTTAGGGAGG - Intronic
1048016321 8:130500588-130500610 CTGGAAGCAGAGCCTGAGGCAGG - Intergenic
1048219212 8:132526114-132526136 CTGGGGGCACCTCTTTAGGCTGG - Intergenic
1048765827 8:137843416-137843438 CTGGAGGCAGAGGTCGAGGAGGG - Intergenic
1049532573 8:143161841-143161863 CCGGAAGCAGAGCCTGAGGCAGG + Intergenic
1049601547 8:143510013-143510035 CAGGAGGGGCAGCTTGGGGCAGG + Intronic
1050219633 9:3372657-3372679 CTGGAGGCAGAGGTTGAGGCAGG - Intronic
1051315548 9:15826734-15826756 CTGGAGCCTCAGCTGAAGGCTGG - Intronic
1051535644 9:18154414-18154436 CCGTAGGCACAGCTAGAGGCTGG + Intergenic
1053023981 9:34715482-34715504 CTGGATGCAGAGCTTGGGGAAGG + Intergenic
1053073622 9:35115426-35115448 TTGTAGGCCCAACTTGAGGCAGG - Intronic
1053202751 9:36163832-36163854 TTAGAGGCATAGCTTGAGACTGG - Exonic
1054337225 9:63817734-63817756 CTGGAGGAGCAGGTTGGGGCGGG - Intergenic
1054883715 9:70173027-70173049 CTTCAGGCACAGCTTGATGCAGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060183101 9:121547283-121547305 CAGGAGGCTGAGCTTGAGCCTGG - Intergenic
1060209284 9:121700047-121700069 CTGGGGGCACAGCCTGAGGCTGG + Intronic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1061404257 9:130384892-130384914 CAGGAGGCACAGGGGGAGGCTGG + Intronic
1061681517 9:132244873-132244895 CTAGAGGCAGAACTTGAGACAGG + Intergenic
1061744936 9:132732733-132732755 CTACAGGCACAGCTTGAACCAGG - Intronic
1062233734 9:135498133-135498155 CTGACGGCACAGCTTGTGGGTGG - Intronic
1203377132 Un_KI270442v1:385055-385077 CTGGAGGAGCAGGTTGGGGCGGG - Intergenic
1187505854 X:19877883-19877905 GTGGGGGCACTGCTGGAGGCTGG - Intronic
1187813161 X:23202815-23202837 CAGGAGGGACAGATAGAGGCAGG + Intergenic
1189038116 X:37513621-37513643 TTGGAAGCGGAGCTTGAGGCAGG - Intronic
1189986326 X:46556792-46556814 CAGGAGGCAGAGGTTGCGGCAGG - Intergenic
1190833505 X:54080047-54080069 CTGTGGGAAAAGCTTGAGGCAGG + Intronic
1195907601 X:109861052-109861074 CTGAAGGCTCAGCTTGGGGAAGG - Intergenic
1198444589 X:136699747-136699769 CTGGAGAACCATCTTGAGGCGGG + Intronic
1200225732 X:154416321-154416343 CGGGAGGCGGAGCTTGAGGCAGG + Intronic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic