ID: 1138387771

View in Genome Browser
Species Human (GRCh38)
Location 16:56647994-56648016
Sequence GCTGCCAGTGCGCACCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138387771_1138387783 23 Left 1138387771 16:56647994-56648016 CCCCCAGGGTGCGCACTGGCAGC 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1138387783 16:56648040-56648062 CCCGTCTGCTGCGCACAGCCCGG 0: 1
1: 0
2: 0
3: 20
4: 196
1138387771_1138387779 -1 Left 1138387771 16:56647994-56648016 CCCCCAGGGTGCGCACTGGCAGC 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1138387779 16:56648016-56648038 CGCTAGGGAGGATCCTGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 53
1138387771_1138387778 -4 Left 1138387771 16:56647994-56648016 CCCCCAGGGTGCGCACTGGCAGC 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1138387778 16:56648013-56648035 CAGCGCTAGGGAGGATCCTGCGG 0: 1
1: 0
2: 1
3: 14
4: 168
1138387771_1138387780 0 Left 1138387771 16:56647994-56648016 CCCCCAGGGTGCGCACTGGCAGC 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1138387780 16:56648017-56648039 GCTAGGGAGGATCCTGCGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138387771 Original CRISPR GCTGCCAGTGCGCACCCTGG GGG (reversed) Intronic
900287523 1:1908788-1908810 GCTGCCACTGCGCCCCGAGGTGG + Intergenic
900694531 1:4001645-4001667 GCCGCCAGTGGGCACTCTGATGG + Intergenic
901134845 1:6986506-6986528 GATGCCAGTGCCCGCCCTGGAGG + Intronic
902511961 1:16971578-16971600 GCAGACTGAGCGCACCCTGGAGG + Exonic
902515288 1:16986618-16986640 GCTCCCAGTGCCCTTCCTGGTGG - Exonic
903413647 1:23167565-23167587 GAGGCCAGTGCTCACCCTTGCGG - Intronic
903659679 1:24969516-24969538 GCTGGCAGTGCGACTCCTGGAGG - Intergenic
903750046 1:25616265-25616287 GCTGGCAGCCCGCGCCCTGGCGG - Intergenic
905694597 1:39965395-39965417 GCTTCCAGTACCAACCCTGGGGG - Intronic
907044841 1:51294387-51294409 GCTGCCAGTGCCTGCTCTGGTGG - Exonic
907223111 1:52921565-52921587 GATCCAAGTGCGCGCCCTGGCGG - Exonic
907333465 1:53686031-53686053 GGGGCCAGTGAGCAGCCTGGTGG - Intronic
914958839 1:152188765-152188787 CCTGCAAGTGCGCCCCCTGCTGG - Intergenic
924780372 1:247141756-247141778 GCACCCAGTGCGGACCCTTGGGG - Intronic
1065300827 10:24319626-24319648 GGGGCTAGAGCGCACCCTGGTGG + Intronic
1066013693 10:31217255-31217277 GCGGCCCGTGAGCACCCTGCAGG - Intergenic
1066034493 10:31467943-31467965 GCTGCCAGGGTGGACACTGGAGG + Intronic
1068574029 10:58663483-58663505 GATACCAGTGCACAGCCTGGGGG - Intronic
1070772631 10:79091191-79091213 GCTGCCATTGCACATCATGGTGG - Intronic
1070801205 10:79245358-79245380 GATGCCAGTGGGCTCCCTGAAGG + Intronic
1072710801 10:97714483-97714505 GGTGCCAGGGCGCACCCGCGCGG - Exonic
1076056983 10:127383828-127383850 GCTCCCACTGGGCAGCCTGGAGG - Intronic
1076317445 10:129552279-129552301 GCTGGCAGTGCACACCCGGTGGG + Intronic
1076672434 10:132130695-132130717 GCTGCCAGTGACCATGCTGGGGG + Intronic
1076722469 10:132398728-132398750 GCTGCCAGTTCCCACGCCGGGGG - Intronic
1077093046 11:788239-788261 GCTGCCAGTGGGGGGCCTGGGGG - Exonic
1077296050 11:1826765-1826787 CCTGGCAGTGCGCTCCCTGGAGG - Intergenic
1077298390 11:1836439-1836461 GCTGCCAGGGGCCACCCTGCAGG + Exonic
1078180084 11:9004055-9004077 GCAGCCAGTGCGCGCGCGGGGGG + Intergenic
1083934278 11:65862272-65862294 GATCCCTGTGCTCACCCTGGGGG - Exonic
1087117983 11:94544493-94544515 GCTGCCTGTTCGCGCCATGGGGG + Exonic
1089140925 11:116283293-116283315 GTTGCCAGTGCTCAGCCTGCAGG + Intergenic
1117446097 14:55805112-55805134 GCTGGCAGTGCCCACTCTGTTGG + Intergenic
1118313117 14:64707168-64707190 GCTGCCAGGGCCCCCGCTGGAGG - Intronic
1122595481 14:102887413-102887435 GCTGGGAGGGCACACCCTGGGGG - Intronic
1122880892 14:104689973-104689995 GCGGCCAGTGCGCGCTCGGGCGG - Intronic
1122910721 14:104826577-104826599 GCTCCCCGCGCGCCCCCTGGCGG + Intergenic
1122920352 14:104877424-104877446 CCTGCCAGTAGGCAGCCTGGAGG + Intronic
1123439585 15:20280939-20280961 GCTGCCAGTGCTCACGAGGGAGG - Intergenic
1125514499 15:40310175-40310197 CCTTCCACTGCCCACCCTGGAGG - Intergenic
1129200905 15:73998645-73998667 GCTGCCAGTCCCCACGCAGGTGG + Intronic
1129269229 15:74410740-74410762 GCTGCCAGTGCTGAGCCTCGCGG + Exonic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1132549752 16:549481-549503 GCCGCCCGTGCCCACCCTGCAGG - Intronic
1132578259 16:673801-673823 CCTGCCACGGCCCACCCTGGGGG - Exonic
1132783554 16:1641932-1641954 GTTCCCAGTGCACAGCCTGGTGG + Intronic
1132851710 16:2027636-2027658 CCTGCCTGTGCGTACCCAGGAGG + Intronic
1132934665 16:2474486-2474508 GAGGTCAGTGCGCTCCCTGGCGG - Intergenic
1133158155 16:3890306-3890328 GTTCCTAGTGGGCACCCTGGCGG - Intergenic
1136466805 16:30449937-30449959 GGTGACAGGGCGCCCCCTGGAGG - Intergenic
1137562217 16:49510239-49510261 GCTGCCAGTGCCCCTCTTGGAGG - Intronic
1138387771 16:56647994-56648016 GCTGCCAGTGCGCACCCTGGGGG - Intronic
1141834959 16:86532379-86532401 GGTGCTGGTGCTCACCCTGGAGG + Exonic
1143457083 17:7075291-7075313 GCTGCCAGTCAGATCCCTGGGGG + Intronic
1144435284 17:15234436-15234458 CCTTCCAGTGACCACCCTGGTGG - Intronic
1144455156 17:15412681-15412703 GCTGTCAGTGCGCATGGTGGTGG - Intergenic
1147245735 17:39119263-39119285 ACTGCCTGGGCTCACCCTGGAGG - Intronic
1147656927 17:42096402-42096424 GCTGCCAGTCCTCTCCCTGTGGG - Intergenic
1151194881 17:72424370-72424392 TCTGCCAGTGTGAACCCTGGTGG + Intergenic
1158350933 18:56563808-56563830 GCAGCCAGTCAGCCCCCTGGTGG + Intergenic
1159518996 18:69495153-69495175 GCTTCCACTGCGTTCCCTGGGGG - Intronic
1160633285 18:80262344-80262366 TGTGCCAGTGCGCCCCCTGCTGG - Intergenic
1160827636 19:1088249-1088271 GCTGGCATCTCGCACCCTGGTGG + Exonic
1161069600 19:2253520-2253542 GCTCCCAGACCCCACCCTGGCGG + Intronic
1161702689 19:5804143-5804165 GCTCCCACAGCGCTCCCTGGCGG - Intergenic
1162919247 19:13890399-13890421 GCTGCTAGTGGAGACCCTGGGGG - Exonic
1167049533 19:47069939-47069961 GGTGCCAGTGCCCACGCTGCAGG - Intronic
1167287476 19:48606703-48606725 GCGGCCAGTGGGAACCCTGAGGG + Intronic
924958451 2:11534-11556 TCTGCCAGTGCGCCCCTTGCTGG + Intergenic
925149817 2:1607329-1607351 GCTGCCAGGACACAGCCTGGCGG + Intergenic
925268221 2:2582259-2582281 GCTGCCAGTGTTCCCCCTGGGGG - Intergenic
927187233 2:20490626-20490648 GCTCACACTGCGCACCCTGCAGG + Intergenic
931908591 2:66869776-66869798 GCTGCAAGTGAAAACCCTGGGGG + Intergenic
936521352 2:113213784-113213806 GCTGCCAAAGGGCACCCTGAAGG + Intergenic
937856186 2:126673446-126673468 GCTGCCAGTGTGCTCTCGGGAGG + Intronic
937896428 2:126979811-126979833 GCTGGCAGTGGCCACCATGGTGG + Intergenic
938074289 2:128323492-128323514 GGTGCCAGTGCCCTTCCTGGAGG + Intergenic
938341841 2:130541148-130541170 GCTGCCCGTGCCCAGCGTGGGGG + Intronic
938347989 2:130579563-130579585 GCTGCCCGTGCCCAGCGTGGGGG - Intronic
938638607 2:133255659-133255681 GCTGCCACTGCCCACCCAAGGGG - Intronic
939992589 2:148889375-148889397 GTTGCCAGTCAGCACTCTGGGGG + Intronic
941717273 2:168777216-168777238 GCTGACAGTGCGGAGCCTGGGGG + Intergenic
946422014 2:219570638-219570660 CCTGGCACTGCGCATCCTGGCGG - Exonic
948321393 2:237072513-237072535 GGTGCCACAGCGCCCCCTGGTGG + Intergenic
948551448 2:238775553-238775575 GCTGCCACCTCCCACCCTGGGGG - Intergenic
1168997975 20:2146766-2146788 GCTGCGAGTGAGTGCCCTGGTGG - Exonic
1169207191 20:3747232-3747254 CCTGCCTGTGGACACCCTGGAGG + Intronic
1170593217 20:17786874-17786896 GGTGCCAGTGCAGACCCAGGAGG - Intergenic
1173329901 20:42067127-42067149 GCTGCCAGAGAGCATCATGGAGG + Intergenic
1174674599 20:52341218-52341240 GCTTCCAGTGCTCTCCATGGGGG + Intergenic
1175172365 20:57089764-57089786 GCAGCCACAGGGCACCCTGGAGG + Intergenic
1175863874 20:62164239-62164261 GCCGCCAGTGCTCACCGTCGGGG - Exonic
1175974633 20:62704371-62704393 GAGGCCAGGGCTCACCCTGGTGG - Intergenic
1176201451 20:63862646-63862668 GCTGCCAGCGCGCAGCCAGCGGG - Exonic
1176229723 20:64026051-64026073 CCTGCCACTGCGTACCCGGGCGG - Exonic
1179541243 21:42084367-42084389 GCTGCCTGTGCACACGGTGGGGG - Intronic
1181513831 22:23400634-23400656 GCTGCCAGTCAGCACCCACGGGG + Intergenic
1182552523 22:31107793-31107815 GCTGCCTGGCCGCATCCTGGGGG - Exonic
1183313072 22:37121992-37122014 GGTGCCAGTGAACACTCTGGTGG - Intergenic
1184476513 22:44725034-44725056 GCTGCCACTGCGGACCATGGAGG + Intronic
1184696089 22:46139854-46139876 GCTGCCAGTGCTCACGAGGGAGG - Intergenic
1185074503 22:48676092-48676114 GCTGCCTGTGAGCCCTCTGGGGG - Intronic
949893074 3:8747649-8747671 GCTGCCTGTGCTCTCCCTTGGGG + Intronic
950684620 3:14607510-14607532 GGTGCCAGTGGGCTCTCTGGGGG + Intergenic
953667848 3:44938833-44938855 GCTACAAGTGAGCACCGTGGTGG - Intronic
953899298 3:46830265-46830287 GCTGCCCCTGGGCATCCTGGTGG - Intronic
954219353 3:49143569-49143591 GCTGGCAGTGCCCACTGTGGGGG + Intergenic
961317667 3:126051523-126051545 GCTGCCACTGAGCACCCTGTGGG + Intronic
962268530 3:133961011-133961033 GCAGCCAGGCCTCACCCTGGAGG - Intronic
962345306 3:134614425-134614447 GCTGCCAAGGAGCACCCTGGAGG + Intronic
968079397 3:195835834-195835856 GCTGCCAGTGAGGGCCCTGCTGG - Intergenic
968279056 3:197461674-197461696 ACTGCCAGTGCTCACCTGGGTGG + Intergenic
969701861 4:8772035-8772057 ACTTCCTGTGTGCACCCTGGTGG + Intergenic
973169056 4:47116381-47116403 TCTGCCAGTGCTCAACCTGGTGG + Intronic
983834203 4:172369548-172369570 GCTGCATGGGAGCACCCTGGGGG + Intronic
983919776 4:173333724-173333746 GCTGCCAGGGCGGGCGCTGGCGG + Intronic
985476524 5:82409-82431 GCTCCCACTGAGCTCCCTGGAGG + Intergenic
985538577 5:477496-477518 GCTGCCATTGTGTGCCCTGGGGG + Intronic
985639278 5:1056038-1056060 ACTCCCAGGGAGCACCCTGGGGG + Intronic
991093506 5:62715496-62715518 GCAGCCAGGGCCCTCCCTGGAGG + Intergenic
992149884 5:73892426-73892448 TCTGCCTGTGTGCACCCTGCCGG + Intronic
997690794 5:135826191-135826213 GCTGGCAGGGAGCAGCCTGGTGG - Intergenic
998252095 5:140560364-140560386 GCTTCCAGTGCGCAGCCTTCTGG - Exonic
1000278517 5:159761746-159761768 GCTTCCAGTGCGCTCCCTTAGGG - Intergenic
1001897968 5:175397535-175397557 GCAGCCAGTGGGAACCATGGGGG - Intergenic
1002754752 6:148405-148427 TGTGCCAGTGCGCCCCCTGCTGG + Intergenic
1003551565 6:7106704-7106726 GCAGCCAGTGCGAAGCGTGGTGG + Intergenic
1005834124 6:29695095-29695117 GCTGCCTGTGCTCACCATTGTGG - Intergenic
1005954292 6:30652840-30652862 GCTGCTAGTGGGAGCCCTGGTGG + Exonic
1011639852 6:89408628-89408650 GCAGCCTGTGCGCACCCTTAGGG - Intronic
1012306394 6:97663340-97663362 GCTGCCAGTGTGCCCCCATGGGG - Intergenic
1013740706 6:113280566-113280588 GCTACCAGTCTGCAGCCTGGAGG + Intergenic
1013836750 6:114343025-114343047 GCTGCCAGTCCACACCCTCCCGG + Exonic
1015854560 6:137609669-137609691 GCTGCCTCTGGACACCCTGGAGG - Intergenic
1018926540 6:168210885-168210907 GCTGCAAGTGCACACCCAGCTGG - Intergenic
1019552642 7:1610743-1610765 GCTGGCAGACCGCAGCCTGGGGG + Intergenic
1019827311 7:3295026-3295048 GCTCCCAGTCCACATCCTGGGGG - Intergenic
1020002678 7:4764706-4764728 GCTGCCTGTGGCCACCCTGATGG + Exonic
1023861949 7:44221769-44221791 GCTGCCAGTGAGCGCCCCGGAGG - Intronic
1024043981 7:45575071-45575093 GCTGCCCGTGCGCAGCCTGCTGG + Exonic
1025992127 7:66504333-66504355 GCTGCCAGTGTTGCCCCTGGAGG + Intergenic
1029907931 7:104111080-104111102 GCGGCCAGTGGGGACCCTGTGGG - Intergenic
1031744264 7:125473747-125473769 GCTGCCAGTGTGGATGCTGGAGG + Intergenic
1034182137 7:149147377-149147399 GCGGCCAGCGCGCCCCCTGCCGG - Intronic
1034952840 7:155312717-155312739 CCTGACAGTGCCCACTCTGGTGG - Intergenic
1037450694 8:19013712-19013734 GCGGCCCGCGCGCACCCTGGCGG + Intronic
1038808051 8:30812612-30812634 GCTCCGAGCGCGCAGCCTGGAGG + Exonic
1040464176 8:47679096-47679118 GGTGCCAGAGGGCACCCTGGTGG - Intronic
1041671635 8:60497559-60497581 GCTGGCAGTACTCACCATGGCGG + Intergenic
1045249810 8:100474031-100474053 GCTGCCCCTGGGCACACTGGCGG - Intergenic
1047777657 8:128086776-128086798 GCAGCCAGGGCCCACCCTGTAGG - Intergenic
1049257830 8:141623324-141623346 GCTGCAAGTTGGCTCCCTGGCGG + Intergenic
1049494720 8:142924330-142924352 GCAGGCAGAGGGCACCCTGGTGG + Intergenic
1054792900 9:69272440-69272462 CCTGCCAGTGCTCAGGCTGGTGG - Intergenic
1059335206 9:113564798-113564820 GCTGCCACCCCCCACCCTGGGGG + Intronic
1060192274 9:121600429-121600451 GCTTCCAGTGCTCAGCCTGGTGG + Intronic
1060527017 9:124326505-124326527 GCTGCCCCTGAGGACCCTGGAGG - Intronic
1061537242 9:131257802-131257824 CCTGCCAGTGCCCTGCCTGGAGG - Intergenic
1061727238 9:132588627-132588649 GCTCGCAGTGCGAGCCCTGGAGG + Intronic
1061856259 9:133443433-133443455 GCGGCCAGTGCGCTGCGTGGAGG + Exonic
1185623140 X:1465531-1465553 GAGGCCGGTGCGCACCCTGAAGG - Exonic
1199615123 X:149649968-149649990 TCTGACAGTGGGCACCCTGGAGG - Intergenic
1199980339 X:152917244-152917266 GATGCCGGTGAGCTCCCTGGAGG - Intronic
1200835160 Y:7725562-7725584 GCAGGCAGTGGGCACCATGGTGG + Intergenic