ID: 1138389926

View in Genome Browser
Species Human (GRCh38)
Location 16:56662884-56662906
Sequence GGGGCAGGTGGGAGGCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1651
Summary {0: 1, 1: 3, 2: 19, 3: 166, 4: 1462}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138389912_1138389926 21 Left 1138389912 16:56662840-56662862 CCGAGGTGAGGCTGGGGTTTCTA 0: 1
1: 0
2: 1
3: 20
4: 230
Right 1138389926 16:56662884-56662906 GGGGCAGGTGGGAGGCATGGTGG 0: 1
1: 3
2: 19
3: 166
4: 1462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138389926 Original CRISPR GGGGCAGGTGGGAGGCATGG TGG Intronic
900175846 1:1291040-1291062 GGGGCAGGATAGAGGCATGAGGG - Intronic
900178156 1:1299715-1299737 AGGGCAGGTGGGAGACAGGCAGG + Intronic
900366052 1:2312456-2312478 GGGGCAGGAGGGCGGGTTGGGGG - Intergenic
900471897 1:2859203-2859225 GGGGAAGGAGGGAGGAAAGGAGG + Intergenic
900550621 1:3252613-3252635 GGGGCTGGTGGGCAGCAGGGTGG + Intronic
900552676 1:3264541-3264563 GAGGCAGGGGAGGGGCATGGAGG + Intronic
900577415 1:3390155-3390177 GGGGGATGCGGGAGGCAGGGAGG + Intronic
900641793 1:3691105-3691127 GAGGCAGGTCCCAGGCATGGAGG + Intronic
900681652 1:3920078-3920100 GGGGAAGGAGGGAGGGAGGGCGG - Intergenic
900685316 1:3944481-3944503 GGGGCATGTGGGAGGGACAGAGG - Intergenic
900726437 1:4219316-4219338 GGCTCCGGTGGGAGGCAGGGTGG + Intergenic
900884581 1:5405316-5405338 GGGGCAATTGGGAGGCAATGGGG - Intergenic
900955205 1:5882565-5882587 AGGGCATGTGGGCGACATGGAGG - Intronic
900993606 1:6108863-6108885 GTGGAAGGACGGAGGCATGGAGG + Intronic
900993617 1:6108898-6108920 GTGGAAGGATGGAGGCATGGAGG + Intronic
901199174 1:7457056-7457078 GGGGCGGGTGAGGGGCACGGCGG - Intronic
901253109 1:7796675-7796697 GGGGAAGAAGGGAGGCAGGGAGG + Intronic
901324916 1:8360348-8360370 GGGGCAGGTCGGAGGGGTGATGG + Exonic
901635419 1:10668069-10668091 GGTGGAGGTGGGAGGCGTGTGGG + Intronic
901636409 1:10672275-10672297 GGGGCATGTTGGAGGCTGGGCGG - Intronic
901676424 1:10888619-10888641 GGGGCAGGAGGGAGGCGAGAGGG + Intergenic
901677158 1:10892230-10892252 GGTGCCAGTGGGAGCCATGGAGG - Intergenic
901739823 1:11334745-11334767 GGGGCAGGCAGGGGGCATTGAGG + Intergenic
901827154 1:11869720-11869742 GGGGCAGGAGGAAGCCAGGGTGG + Intergenic
901936003 1:12627560-12627582 TAGGCAGGAGGCAGGCATGGGGG - Intergenic
902328552 1:15718668-15718690 GGGGCAGGGTGGGGGCAGGGTGG + Intronic
902331293 1:15732319-15732341 GGGGCAGGGGAGAGGCAGGCTGG - Intronic
902333621 1:15742807-15742829 GGGGCGGGAGGGAGGCAGCGAGG - Intronic
902466497 1:16621805-16621827 GGGACAGCTGGGAGGACTGGAGG - Intergenic
902542741 1:17166219-17166241 GGGGATGGTGGTGGGCATGGTGG - Intergenic
902756442 1:18552418-18552440 GGGGCAGGAGGAAGACATGATGG - Intergenic
902771670 1:18648756-18648778 AGGGCAGCGGGGAGCCATGGAGG + Intronic
902838418 1:19060664-19060686 CTGGGAGGTGGGGGGCATGGTGG - Intergenic
902838432 1:19060706-19060728 GTAGAAGGTGGGGGGCATGGTGG - Intergenic
902903314 1:19535273-19535295 GGGGCAGGAGGGGAGCTTGGAGG - Intergenic
902914387 1:19627729-19627751 GGGGCAGGGGAAAGGCATGGAGG + Exonic
903049611 1:20590844-20590866 GGGGCAGGTGGTGGTGATGGGGG + Intronic
903063614 1:20686215-20686237 GGGGGTGGTGGGAGGCCTTGGGG - Intronic
903268885 1:22175489-22175511 GAGGCAGTTGGCAGGCATGGGGG + Intergenic
903314261 1:22488817-22488839 AGGGGAGGATGGAGGCATGGAGG + Intronic
903376636 1:22870495-22870517 GGGGCAGGAGGGAGGGACAGAGG + Intronic
903406776 1:23103904-23103926 GGGGAAGGAGGGAGGGAGGGGGG + Intronic
903486384 1:23692078-23692100 GGGGCAGATGGGGTGAATGGAGG + Intronic
903809725 1:26028616-26028638 GGGGTAGGTGGGAGGAACAGAGG + Intronic
903996477 1:27308053-27308075 AGGGAGGGTGGGAGGCAGGGAGG - Exonic
904037834 1:27568359-27568381 GGGGCAGGTGGGCTGGAAGGTGG + Intronic
904197161 1:28794464-28794486 TGGGCAGGGGGCAGCCATGGTGG - Intergenic
904304962 1:29582718-29582740 GGAGAAGATGGGAGCCATGGAGG - Intergenic
904396417 1:30225295-30225317 GGGGCAGGTGGGTGACCTTGGGG - Intergenic
904600650 1:31670953-31670975 AGGTCGGGTGGCAGGCATGGTGG - Intronic
904612180 1:31731854-31731876 AGGGCAGGTGGGGGGCTTAGGGG - Intronic
904788205 1:32998347-32998369 AGGGCAGGTGGGAGGCAGCAGGG - Intergenic
904840310 1:33368241-33368263 GGGGCAGGTGTAAAGTATGGAGG + Intronic
904887523 1:33752251-33752273 GGGCCTGGTGGGACTCATGGGGG + Intronic
904891692 1:33784218-33784240 GGGGCAGTGGGGAGCCATGGAGG + Intronic
905067182 1:35193291-35193313 GTGAGAGGCGGGAGGCATGGGGG + Intergenic
905139382 1:35829694-35829716 GGGCATGGTGGCAGGCATGGTGG + Intronic
905259267 1:36706112-36706134 GGGGCAGTTTGGGGGAATGGAGG - Intergenic
905308488 1:37034407-37034429 GGGGCAGGTGGGAGCCCGCGCGG - Intergenic
905325591 1:37149503-37149525 GTGGCAGGCAGGAGGCCTGGTGG + Intergenic
905362655 1:37431114-37431136 GGTGCAGGGGAGAGGCAAGGAGG + Intergenic
905370193 1:37478975-37478997 GGGGCAGCTGGGGGCCATGGAGG - Intronic
905548790 1:38819461-38819483 GGGGAAGGTGGGAGCCCGGGGGG + Intergenic
905656697 1:39690534-39690556 GGGGGAGGGAGGAGGTATGGAGG + Intronic
905706941 1:40067609-40067631 GGGGGAGGAGGGGGGCATGGTGG - Exonic
905810862 1:40912243-40912265 GGGTAAGGTGGGAAGCAAGGTGG + Intergenic
905915192 1:41679542-41679564 GGGACTGGTGGCAGGGATGGAGG + Intronic
905943749 1:41884792-41884814 GGGGCAGGTGGGTGGGTGGGTGG - Intronic
906140434 1:43531099-43531121 GGGGCTGGTGGGGGGCCGGGGGG - Intronic
906144758 1:43553412-43553434 GAGGAAGGTGGCAGTCATGGGGG - Intronic
906150123 1:43582753-43582775 GGGGTGCGTGTGAGGCATGGGGG + Intronic
906202396 1:43968371-43968393 GGGGTGGGTGGGTGGCAGGGAGG + Intergenic
906212750 1:44021233-44021255 GGAGCAGCTGGGATGCTTGGGGG - Intronic
906511063 1:46410703-46410725 GGCCCTGGGGGGAGGCATGGAGG + Intronic
906545931 1:46619440-46619462 GAGGCAGGTGGAAGGGTTGGGGG + Intergenic
906694410 1:47814470-47814492 GGGGCTTTGGGGAGGCATGGAGG + Intronic
906747962 1:48234798-48234820 GGGGCAGGTTGGAGGTAAGCAGG + Intronic
906945631 1:50292011-50292033 GGGCCAGATGGGAGGCAGGGGGG + Intergenic
907118546 1:51990090-51990112 GGGTGCGGGGGGAGGCATGGAGG - Intronic
907296906 1:53461229-53461251 GGGGCAGCGGGGAGGTCTGGAGG + Intronic
907301590 1:53490247-53490269 GAGGAAGGTGGGAGACAGGGTGG - Intergenic
907319561 1:53594070-53594092 GGGGCTGGGGTGAGGCCTGGCGG + Intronic
907332152 1:53678332-53678354 GGGGGGGGTGGGGGGCAGGGGGG + Intronic
907423721 1:54365039-54365061 GGGGCAGGAGGGAGGGAAGAGGG + Intronic
907439922 1:54472841-54472863 GGGGCTGGAGGAAGGCATAGGGG - Intergenic
907502069 1:54887867-54887889 GAGGCAGATGGGAGGCCCGGAGG + Intergenic
907807668 1:57837760-57837782 GGTGGAGGTGGTAGGGATGGTGG - Intronic
908022936 1:59917002-59917024 AGGGCAGGTGCCAGGCATGGAGG + Intronic
908177136 1:61566711-61566733 GGGGCAGGTGGGAGGTATTTGGG - Intergenic
908470253 1:64437162-64437184 GGGGCAGGCGGGGGGCATGGGGG + Intergenic
908627090 1:66057600-66057622 GGGGAAGGTGAAAGGCAAGGAGG + Intronic
911161041 1:94683577-94683599 GGGGCAGGAGGCTGCCATGGTGG - Intergenic
911163977 1:94708988-94709010 GGGGAAGGAGGGAGGGAAGGAGG + Intergenic
911284087 1:95969128-95969150 GGGCCTGGTGGGAGGGTTGGGGG - Intergenic
911725601 1:101238276-101238298 GGGGCTGGGGGTGGGCATGGGGG + Intronic
912121263 1:106474352-106474374 GGGACAGGAGGGAGGCTGGGAGG + Intergenic
912663875 1:111561509-111561531 GGGGAAGGAGGGAGGAAGGGAGG + Intronic
912694775 1:111832960-111832982 GGGGCAGGTGGGAAGCAAGAGGG + Intronic
912745063 1:112239286-112239308 GGGGCAGGTCAGATGCACGGGGG + Intergenic
912798419 1:112706661-112706683 AGGCCAGGAGGGAGGTATGGCGG - Intronic
913685457 1:121227764-121227786 TGGGCAAGTGGGAAGCATGGAGG - Intronic
914037304 1:144015368-144015390 TGGGCAAGTGGGAAGCATGGAGG - Intergenic
914152151 1:145052564-145052586 TGGGCAAGTGGGAAGCATGGAGG + Intronic
914376397 1:147077344-147077366 GGGGCAGGTGGGAGGCGCGCGGG - Intergenic
914394725 1:147254391-147254413 GGGGAAGGTGGGAGGAAGTGAGG + Intronic
914521943 1:148425582-148425604 GAAGCTGGTGGGAGTCATGGCGG - Intergenic
914790808 1:150876314-150876336 GGGGCAGGTGGGAGTTGAGGGGG - Intronic
914918505 1:151832450-151832472 GGGGCAAGGGGCAGGCCTGGAGG + Intergenic
914934977 1:151970787-151970809 GGGGCAGGTGGGGGGCATTGGGG + Intergenic
915101966 1:153507295-153507317 GTGGGAGGAGGGAGACATGGGGG - Intergenic
915280110 1:154816651-154816673 GGGGCAGGAGTGAGGAAGGGAGG - Intronic
915322868 1:155065460-155065482 GGAGCAAGTGCCAGGCATGGGGG - Intronic
915358133 1:155268841-155268863 GGGGCCGGAGGGAGGCGGGGTGG + Intronic
915475780 1:156152018-156152040 GGGGCAGGAGGGAGGACTGAGGG + Intronic
915495852 1:156282404-156282426 TGGGTAGGTGGGAGGTTTGGAGG - Intronic
915508527 1:156372631-156372653 GAGGCAGGCGGGATGGATGGTGG + Intronic
915593111 1:156881701-156881723 GGGGCTGCTGGGAGCTATGGGGG - Intronic
916673598 1:167046790-167046812 GGGGCAGCTGGGAAGTGTGGGGG + Intergenic
916779419 1:168008856-168008878 GGGGCAGGGTGGAGGCGGGGTGG - Intronic
917740491 1:177957790-177957812 GGGGAGGGTGGGAGGGAGGGTGG - Intronic
918237159 1:182591864-182591886 GGGGCAGGGGCTGGGCATGGTGG - Intergenic
918273313 1:182924830-182924852 GGGGAAGGAGGGAGGAAGGGAGG + Intronic
918373693 1:183887179-183887201 GGGGAAGGAGGGAGGGAGGGAGG - Intronic
918659094 1:187067320-187067342 GTGCCAGGTGGGAGGCAGGGTGG + Intergenic
919490278 1:198197941-198197963 GGGGCAGGTGGTGGGTATGGAGG + Intronic
919745829 1:201008727-201008749 TGGGCAGGTGGGAGGCTTGGTGG - Intronic
919843471 1:201626278-201626300 GGGGCGGGTGGCAGGGAGGGAGG - Intronic
919850848 1:201671369-201671391 GGGGCAGGAAGCAGGTATGGAGG - Intronic
919919358 1:202159205-202159227 GGGGCAGATGGAAGGAAGGGAGG + Intronic
920044828 1:203126591-203126613 TGGGTAGCTGGGAGGCAGGGAGG - Intronic
920171091 1:204073048-204073070 GGGGGAGGAGGGAGGGAGGGTGG - Intergenic
920190357 1:204189923-204189945 GGGGGATAAGGGAGGCATGGGGG - Intergenic
920284412 1:204869136-204869158 GGGGCTGGAGGGAGCCAGGGTGG + Intronic
920305672 1:205016688-205016710 GGGGCTTGTGGGTGGCTTGGTGG - Exonic
920441648 1:205984884-205984906 GGGGCTGGGAGGAGGCAGGGAGG - Intronic
920472775 1:206246322-206246344 TGGGCAAGTGGGAAGCATGGAGG - Intronic
920958985 1:210647551-210647573 GGGGGCGGTGGGAAGCAGGGAGG - Intronic
921685306 1:218082982-218083004 GGGGCTGGTGGGAGTCAGTGGGG - Intergenic
921738585 1:218656974-218656996 GGGGGAGGGGAGAGACATGGGGG - Intergenic
921805291 1:219447021-219447043 GGGGCGGGTGGGGGGCACGGTGG - Intergenic
922046244 1:221948830-221948852 GGGGGAAGAGGGAGGAATGGTGG - Intergenic
922703242 1:227774556-227774578 GGTGTAGGTGAGAGGCAAGGGGG + Intronic
922726083 1:227923698-227923720 GACCAAGGTGGGAGGCATGGTGG - Intronic
922809061 1:228406073-228406095 TGGGCGGGTGGGAGGTTTGGGGG - Intronic
922816380 1:228452601-228452623 GGGTCAGGGAGGAGGCATGAGGG - Intergenic
922907643 1:229186730-229186752 GGGGCAGGAGGCAGGTAGGGAGG - Intergenic
923306268 1:232691699-232691721 TGGGCAGGTGAGAGGGATTGGGG - Intergenic
923784500 1:237054315-237054337 GGGGGAGGGGGGAGGCGGGGAGG - Intronic
924289366 1:242523046-242523068 GGGGCAGATGGGAAGCAGGTCGG + Intronic
924501840 1:244645492-244645514 GAGGCGGGTGGGAGGGGTGGAGG - Intergenic
924623190 1:245679971-245679993 GAGCCAGGCGGGAGGGATGGAGG - Intronic
924675219 1:246169118-246169140 GGTGTAGGTGGGAGGGATGTAGG - Intronic
924832296 1:247609890-247609912 GGGGCCTGTCGGAGGCATGGAGG + Intergenic
924949028 1:248865855-248865877 GGGGCATATGGGAGACAGGGAGG + Intergenic
1062908934 10:1199634-1199656 TGGGCAGGTGGGCGGCCAGGTGG + Intronic
1062924099 10:1301577-1301599 AGGGAAGGAGGGAGGAATGGAGG - Intronic
1063160764 10:3416428-3416450 GTGGGAGTTGGGAGCCATGGAGG + Intergenic
1063294214 10:4786520-4786542 AAGGCAGGTGGGAGGCATCACGG + Intergenic
1063348434 10:5333384-5333406 GGGGCCTGTCGGAGGGATGGGGG + Intergenic
1063371299 10:5524665-5524687 GCGGCAGGTGGGAGACGGGGAGG + Exonic
1063434265 10:6017974-6017996 GGGGTAGGGGGGAGGCAGGGTGG + Intronic
1063881673 10:10538239-10538261 GAGGCAGGAAGGAGACATGGGGG - Intergenic
1063964450 10:11335722-11335744 GGGGATGTTGGGAGGCATGGGGG + Exonic
1064066335 10:12185227-12185249 GGGGAAGGGGTGGGGCATGGAGG + Intronic
1064208953 10:13347750-13347772 GGGGAAGGAGGGAGGGAGGGCGG - Intronic
1064261300 10:13788431-13788453 GGGCCATGTGGGAGGCATTGGGG - Intronic
1064321487 10:14309659-14309681 GAGGCAGGAGGGGGGCCTGGAGG - Intronic
1064551018 10:16500891-16500913 TGGGGAGATGGCAGGCATGGTGG - Intronic
1065104820 10:22372419-22372441 GGGCAAGGTAGGAGGGATGGTGG + Intronic
1065852985 10:29806033-29806055 GGGACAGGGGTGAGGCAGGGTGG + Intergenic
1065856965 10:29838856-29838878 GGGGAAGGGGGGAGGGAGGGGGG + Intergenic
1065967123 10:30779483-30779505 GGTGAATGTGGGAGCCATGGGGG + Intergenic
1066061048 10:31723970-31723992 GTGGCAGTTGGGGGGCACGGGGG - Intergenic
1066076290 10:31881024-31881046 GGGGAAGGTGGGGGGAATTGAGG - Intronic
1066221161 10:33336666-33336688 CGGGCAGGCGGGAGGCGAGGCGG + Intergenic
1066358649 10:34709648-34709670 GGCGGAAGTGGGAGCCATGGAGG + Intronic
1067090708 10:43264671-43264693 GGGGCAGCAGGGAGGGGTGGGGG + Intronic
1067295180 10:44971567-44971589 GGCCCTGGTGGGGGGCATGGGGG - Intronic
1067341211 10:45405889-45405911 GTGGCAGGAGTGGGGCATGGTGG - Intronic
1067476932 10:46573557-46573579 GGGGCAGGAGTGAGCCATGGAGG + Intergenic
1067555597 10:47267720-47267742 GGGGCAGGAGGGAGGCAGCAAGG - Intergenic
1067617806 10:47768224-47768246 GGGGCAGGAGTGAGCCATGGAGG - Intergenic
1067684059 10:48456816-48456838 GGGGAAGGAGGGAGGGAGGGAGG - Intronic
1067789483 10:49277041-49277063 GGGTCTGGTGGGAGGAAAGGTGG - Intergenic
1067829841 10:49605249-49605271 GGGAAGGGTGGGAGGCATTGTGG + Intergenic
1068096630 10:52499457-52499479 GCGGCTGCTGGGAGGGATGGGGG + Intergenic
1069060413 10:63888820-63888842 TGGCCAGGTGGGAGGCTTTGGGG + Intergenic
1069617613 10:69816179-69816201 AGGCCAGGTGGTAGTCATGGAGG + Intronic
1069706280 10:70460649-70460671 GGGCCAGGGTGGAGGCAGGGAGG - Intergenic
1069735186 10:70649332-70649354 GGTGCAGGTGGGGTGCCTGGAGG + Intergenic
1069748641 10:70731949-70731971 GGGACTGGAGGGAGGCATTGTGG + Intronic
1069828797 10:71270365-71270387 AGGGAGGGTGGGAGGCAGGGAGG + Intronic
1069942385 10:71964515-71964537 GGGGCGGGCCGGAGGGATGGAGG - Exonic
1069959599 10:72072111-72072133 TGGGGAGGTGGGAGCCCTGGAGG - Intronic
1070048381 10:72862360-72862382 GGGGCTGGTGGAAGGAGTGGTGG - Intronic
1070165736 10:73896423-73896445 AGGGTAGGTGGCAGGCACGGTGG - Intergenic
1070321118 10:75355467-75355489 GGGGCAGCAGGGAGGTATCGTGG - Intergenic
1070566067 10:77604868-77604890 GGGGGAGGGTGGAGGCAGGGAGG - Intronic
1070657834 10:78283377-78283399 GCTGCAGGTGGGAGGCCTGCAGG + Intergenic
1071541107 10:86485051-86485073 GGGGGAGATGGGAGGGACGGGGG - Intronic
1071713605 10:88073785-88073807 GGGGAAGGTGGGGGGCACTGCGG - Intergenic
1072051495 10:91708298-91708320 GGGGCAAGTGGGAGGTAGGTAGG + Intergenic
1072544256 10:96422471-96422493 GGGACAGGAGGGAGGGAAGGAGG - Intronic
1072610026 10:97011651-97011673 GGGCCAGCAGTGAGGCATGGTGG - Intronic
1073105916 10:101032053-101032075 GGCGCAGGTGGGCGGTGTGGAGG - Intronic
1073147403 10:101289828-101289850 GGGGCAGGTGTGAAGCAGAGTGG - Intergenic
1073245978 10:102090520-102090542 GGGACAGGTGGGAGGACTGGAGG - Intergenic
1073250745 10:102119293-102119315 GGGGCAGGTGGGGGGGGCGGAGG - Intronic
1073797657 10:107005331-107005353 GGGGCGGGGGGTAGGGATGGGGG + Intronic
1073832865 10:107406477-107406499 GGGGAAGGTGTGAAGAATGGAGG - Intergenic
1074369325 10:112886876-112886898 GGGGCTGGTGAGATGCAAGGCGG - Intergenic
1074397384 10:113109000-113109022 GGGACAGTTGGCAGGTATGGTGG - Intronic
1074843864 10:117379614-117379636 GGGGAAGGTGGGAGGCTTTTGGG + Intergenic
1074908290 10:117884187-117884209 TGGCCAGGTGGGAGGAATGTGGG - Intergenic
1075038591 10:119089592-119089614 GGACCAGGTGGTAGCCATGGAGG - Intergenic
1075148036 10:119899977-119899999 GGGGCAGGAGAAAGGGATGGGGG - Intronic
1075686320 10:124367576-124367598 GGGGAAGGAGGTGGGCATGGAGG - Intergenic
1075686331 10:124367606-124367628 GGGGAAGGAGGTGGGCATGGAGG - Intergenic
1075686344 10:124367639-124367661 GGGGAAGGAGGTGGGCATGGAGG - Intergenic
1075686352 10:124367660-124367682 GGGGAAGGAGGTGGGCATGGAGG - Intergenic
1075819907 10:125298038-125298060 GGGGCATGTGGAAGGCTTGAAGG + Intergenic
1075839510 10:125487762-125487784 GGGTCAGCAGGGAGGCCTGGGGG + Intergenic
1076158528 10:128222668-128222690 TGGGCGTGTGGGAGGGATGGAGG + Intergenic
1076530648 10:131142206-131142228 GGGGCAGGTGGGATCCAGGTGGG + Intronic
1076625726 10:131820656-131820678 GAGGCAGGTGGAGGGAATGGGGG - Intergenic
1076676460 10:132149762-132149784 GGGGCAGGGGTGAGGTAGGGCGG - Intronic
1076676473 10:132149789-132149811 GGGGCAGGGGTGAGGTAGGGTGG - Intronic
1076676486 10:132149816-132149838 GGGGCAGGGGTGAGGTAGGGCGG - Intronic
1076790617 10:132775043-132775065 GGGGCAGGGAGGAGGGACGGAGG + Intronic
1076839854 10:133040611-133040633 GGGGCAGGTGGCAGGGGGGGGGG + Intergenic
1076999071 11:313570-313592 GGTGCAGGTCAGAGGCCTGGTGG - Intronic
1077050566 11:564555-564577 AGGGCAGGGGCCAGGCATGGTGG + Intergenic
1077153637 11:1082093-1082115 GGGGCAGGAAGGTGGCCTGGAGG + Intergenic
1077158826 11:1103489-1103511 GGGGACGGTGGGAGCCGTGGGGG - Intergenic
1077159344 11:1105635-1105657 GAGGCAGGAGGGAGGCAGGAGGG - Intergenic
1077185199 11:1232620-1232642 TGCGGAGGTGGGAGGCATCGGGG - Intronic
1077224655 11:1434781-1434803 GGGGCATGTTGGAACCATGGGGG - Intronic
1077239334 11:1502463-1502485 GTGCCTGGTGGGAGTCATGGGGG - Intergenic
1077287182 11:1772891-1772913 GGGGCTGGTGGGGGGAAAGGTGG + Intergenic
1077311613 11:1891322-1891344 GGGGAAGGAGGGAGTCCTGGGGG + Intronic
1077321057 11:1942130-1942152 GAGGAAGGTGGGAGGGAGGGGGG + Intergenic
1077322099 11:1947148-1947170 GGGACAGGAGGGGGGCAGGGAGG + Intergenic
1077324690 11:1958687-1958709 GAGGCCTGTGGGAGACATGGGGG - Intronic
1077373585 11:2195006-2195028 GTGGCAGGTGGCAGGCATGCTGG + Intergenic
1077378048 11:2214839-2214861 GGGGCAGGTGGCAGGGCAGGTGG - Intergenic
1077404121 11:2375210-2375232 GGGGCAGGTGTGAGCCTGGGAGG - Intergenic
1077555331 11:3223299-3223321 GGGGCGCGTGGGAGGCTGGGTGG - Intergenic
1077555822 11:3225561-3225583 GGGGCAGGTGGGAGCCTGGACGG + Intergenic
1077753952 11:5005401-5005423 GGGGGAAGGGGGAGGCATGTAGG - Intergenic
1077974628 11:7234945-7234967 GGGGAAGGTGGGGGTGATGGGGG + Intergenic
1078147957 11:8734999-8735021 GGGGCAGGGGGGCGGGAGGGCGG + Intronic
1078439682 11:11353870-11353892 GGGGTTGGTGGGAGGCAATGTGG + Intronic
1078487738 11:11739744-11739766 GGGGCACGGTGGAGGCATGGTGG + Intergenic
1078488576 11:11747722-11747744 AGGGAAGGAGGGAGGCAGGGAGG + Intergenic
1078536389 11:12178465-12178487 GGGGTGGGGGGCAGGCATGGGGG + Intronic
1078546168 11:12248534-12248556 TGGGCAAGTGGGAGGGGTGGGGG + Intronic
1078720185 11:13877219-13877241 AGGGCAGGTGGCAGGGAAGGAGG - Intergenic
1078852780 11:15179555-15179577 GGGGCCTGTGGGAGGAGTGGGGG - Intronic
1079022889 11:16924022-16924044 TGGGGAGGTGGGAGGGACGGGGG - Intronic
1080112051 11:28579474-28579496 GGGGCAAGAGGGAGGCACAGTGG - Intergenic
1080117323 11:28635503-28635525 AGGGCAGGAGGGAGGGAGGGAGG + Intergenic
1080173181 11:29330719-29330741 GGGGTTGGTGGGAAGCATGACGG - Intergenic
1080443775 11:32318546-32318568 GGTGCTGGTGGGAGGCAAAGAGG - Intergenic
1080466708 11:32504132-32504154 GGGGCATGGGGGAGGGAGGGAGG + Intergenic
1080886966 11:36376506-36376528 GGGGGAGGAGGGAGGGACGGAGG + Intronic
1081296179 11:41392528-41392550 GGGGGAGGTGGTGGGTATGGGGG - Intronic
1081403317 11:42667617-42667639 GGGGTAGGAGGGAGGCATGTAGG + Intergenic
1081411226 11:42760632-42760654 GGGGCGGGGGGCAGGCGTGGGGG - Intergenic
1081504115 11:43697010-43697032 GCGGGGGGTGGGAGGCAAGGGGG + Intronic
1081572174 11:44298499-44298521 TGGGCAGGTGGCAGGAATGGGGG + Intronic
1081582428 11:44361333-44361355 GGGGCCGCTGGGAGGACTGGAGG - Intergenic
1081606789 11:44532122-44532144 TGGGGAGGTGGGAGGCTGGGAGG - Intergenic
1081701150 11:45153528-45153550 TGGACATGGGGGAGGCATGGGGG + Intronic
1081811426 11:45916344-45916366 GGAGAAGGTGAGAGGGATGGAGG - Intronic
1081891369 11:46545170-46545192 GGGGGTGGTGGTGGGCATGGTGG + Intronic
1081915980 11:46730492-46730514 GGAGCAGTAGGGAGGCCTGGGGG + Intronic
1081982458 11:47276572-47276594 TTGGGAGGTGGCAGGCATGGTGG + Intronic
1082941125 11:58706615-58706637 GGTGCTGTTGGGGGGCATGGTGG + Intronic
1083308921 11:61774804-61774826 GGGGCGAGAGGGAGGCAGGGAGG - Intronic
1083334191 11:61913323-61913345 GGGACAGGTGGGAACCAAGGTGG + Intronic
1083683017 11:64359899-64359921 GGGCCTGCTGCGAGGCATGGGGG - Intronic
1083894515 11:65613480-65613502 GGGCCAGGTGGGTGGCCAGGTGG - Exonic
1084031310 11:66482293-66482315 GGGACAGGTGGTAGGCATAGAGG - Exonic
1084113960 11:67031109-67031131 GGGGCAGGGTGGGGGCAGGGGGG - Intronic
1084180054 11:67441667-67441689 GGGGCTGCTGGGATGTATGGAGG + Intronic
1084204601 11:67584314-67584336 GGGGCGGGGAGCAGGCATGGCGG - Intronic
1084399701 11:68936514-68936536 GCGGCAGGAGGGAGGCCAGGAGG + Exonic
1084403074 11:68956122-68956144 GGGGCAGGGTGGTGGCCTGGGGG + Intergenic
1084417704 11:69042989-69043011 GGGGCAGGCAGGAGGACTGGTGG + Intergenic
1084453015 11:69251184-69251206 AGGGCAGGTGGGAGGCGGTGGGG + Intergenic
1084456669 11:69271673-69271695 GTGGCAGGTGGAAGGAGTGGTGG - Intergenic
1084473884 11:69378046-69378068 GGGTTAGGTGTGAGGCATGGGGG - Intergenic
1084490657 11:69476548-69476570 GGGGGAGGTGGTGGCCATGGGGG - Intergenic
1084593956 11:70106167-70106189 TGGGCAGGAGGGAGGGTTGGTGG + Intronic
1085253663 11:75159923-75159945 TGGGCAGGTGAGAGGCCAGGGGG + Intronic
1085316243 11:75546816-75546838 GGGGCAGGAGGGTGGCATATGGG + Intergenic
1085514485 11:77104411-77104433 GGGGCAGGGCGAAGGCGTGGTGG + Intronic
1085806680 11:79643117-79643139 AGGGCAGGAGGGAGGGCTGGAGG + Intergenic
1085810156 11:79672643-79672665 TGGGCAGTGGGGAGCCATGGAGG + Intergenic
1086681807 11:89681868-89681890 GGGGGTGGTGGGGGGCAGGGAGG + Intergenic
1086791072 11:91038703-91038725 GAGGCAGGAGGGAGAAATGGAGG + Intergenic
1087527157 11:99330175-99330197 GAGGGAGGAGGGAGGCAAGGAGG + Intronic
1087572596 11:99948899-99948921 GGGGCAGGTGGAATGCAATGAGG - Intronic
1088391871 11:109323755-109323777 GGGGGAGGTGGGAGGGAGGGAGG - Intergenic
1088699282 11:112397691-112397713 GGGGCAGGTGGGTGGCTCGAAGG - Intergenic
1089128165 11:116191880-116191902 GGAGGGGGTGGGAGCCATGGAGG + Intergenic
1089156933 11:116409716-116409738 GGGGGAGGGAGGGGGCATGGAGG + Intergenic
1089262617 11:117232828-117232850 GGGTCGGGTGGGGGGCGTGGAGG + Intronic
1089275966 11:117336376-117336398 GGGGCAGGCGGTGGGTATGGAGG + Intronic
1089466575 11:118689881-118689903 GGGGCTGCTGGGAGGCAGAGCGG - Intergenic
1089751679 11:120655838-120655860 GGAGCAGGTGGCGGGCTTGGTGG + Intronic
1089775572 11:120833084-120833106 GGGGCAGCTGGGAGGGAGGGAGG - Intronic
1089786132 11:120908596-120908618 GGGGAAGGTGGCAGGCAGGCGGG + Intronic
1089814814 11:121162762-121162784 AGGGCAGGTGGAAGGCAGAGCGG + Intronic
1089821231 11:121228080-121228102 GGGCCTGGTGGGAGGCATTTGGG - Intergenic
1090315114 11:125779407-125779429 GGGGCAGAGGAGAAGCATGGAGG - Intergenic
1090357071 11:126147236-126147258 GGGGCAGTAGGGAGGGAGGGAGG - Intergenic
1090807101 11:130209588-130209610 GGGGCAGGAGGGCGGCAGGTGGG + Intronic
1090952726 11:131487771-131487793 GGGGAAGGCTGGAGCCATGGAGG + Intronic
1091293620 11:134456904-134456926 CTGGCAGGTGGGAGGAGTGGGGG + Intergenic
1091299613 11:134498968-134498990 GCTGCACATGGGAGGCATGGAGG - Intergenic
1202805115 11_KI270721v1_random:2461-2483 GGGACAGGAGGGGGGCAGGGAGG + Intergenic
1202807669 11_KI270721v1_random:13864-13886 GAGGCCTGTGGGAGACATGGGGG - Intergenic
1091888314 12:4032246-4032268 GGGGAAGCTGGGTGGCCTGGGGG - Intergenic
1092170120 12:6369266-6369288 GTGGCAGGAGGGAGGCGTGTAGG - Intronic
1092237982 12:6821750-6821772 GGGGGAGGAGGGAGGCCCGGGGG + Exonic
1092252111 12:6905279-6905301 GGGGGAGGTGGGAAGAATGGGGG + Intronic
1092291156 12:7160186-7160208 GAGGCAGGTGGGAGGCAGGTGGG - Intergenic
1092291160 12:7160197-7160219 AGGACAGGTGGGAGGCAGGTGGG - Intergenic
1092291173 12:7160233-7160255 GAGGCAGGTGGGAGGAGAGGTGG - Intergenic
1092291176 12:7160244-7160266 AGGACAGGTGGGAGGCAGGTGGG - Intergenic
1092291184 12:7160267-7160289 GAGGCAGGTGGGAGGCAGGCGGG - Intergenic
1092291193 12:7160290-7160312 GAGGCAGGTGGGAGGAGAGGTGG - Intergenic
1092291196 12:7160301-7160323 AGGACAGGTGGGAGGCAGGTGGG - Intergenic
1092291201 12:7160313-7160335 GAGGCAGGTGGGAGGACAGGTGG - Intergenic
1092291204 12:7160324-7160346 GAGGCAGGTGGGAGGCAGGTGGG - Intergenic
1092291208 12:7160335-7160357 GAGGCAGGTGGGAGGCAGGTGGG - Intergenic
1092510263 12:9147614-9147636 GGGACAGGGGGGAAGCCTGGGGG + Intergenic
1092880699 12:12885683-12885705 GGGGCGGGGGGGCGGCAGGGAGG + Intergenic
1092948840 12:13481426-13481448 GGGGCAGGTGAGGTGCTTGGTGG + Intergenic
1093109549 12:15132970-15132992 GGGGCAGGGCGGGGGCAGGGAGG - Intronic
1093233562 12:16578395-16578417 GGGTCAGGTAGAAGGGATGGAGG + Intronic
1093488769 12:19681515-19681537 GGGGCTGTTAGGGGGCATGGTGG - Intronic
1093692295 12:22121980-22122002 GGCGCAGGATGGGGGCATGGTGG + Intronic
1093760373 12:22903135-22903157 GGGGGAGGGGGGAGGGATAGTGG + Intergenic
1093955131 12:25207953-25207975 GGGGCATGTGGAAGGTAGGGAGG + Intronic
1094317437 12:29149215-29149237 GGGGAAGGTCGGAGGGAGGGTGG + Exonic
1094512801 12:31106300-31106322 GGGGCAGGTGCAAGGGCTGGGGG - Intergenic
1095399729 12:41800667-41800689 GGGGGAGATGGGAGGCATGGAGG - Intergenic
1095946607 12:47757528-47757550 GGTGGAGGTGGGAGGTATGGGGG - Intronic
1096071194 12:48776394-48776416 GGTCCAGGTGGGGGGGATGGGGG - Intronic
1096106494 12:48999308-48999330 GGGGCGGGTGGGAGGGTGGGGGG - Exonic
1096238184 12:49943734-49943756 GAGGCAGCTGGGAGCCATTGTGG - Intergenic
1096252339 12:50041160-50041182 GAGGCAGGAGGGAAGCACGGAGG - Intergenic
1096499147 12:52054900-52054922 GGGGCCGGTGGGAGGACTGAAGG - Exonic
1096618172 12:52846390-52846412 GGGGGTCTTGGGAGGCATGGTGG - Intronic
1096709318 12:53443606-53443628 GGGGCAGGCGGTGGGTATGGAGG - Exonic
1096716146 12:53492852-53492874 AGGCCAGGAGGGAGGGATGGCGG + Intronic
1096749038 12:53747263-53747285 GAGGCAGGAGGCAGGCATGATGG + Intergenic
1096810213 12:54164558-54164580 GGCGCAGGAGGGAGGCCAGGGGG - Intergenic
1097166156 12:57087731-57087753 GGGGCTGGGGTGGGGCATGGCGG - Intronic
1097169099 12:57102558-57102580 CAGGCAGGTGGGAGGGATGAAGG - Intronic
1097233846 12:57527005-57527027 GGGGCAGGAAAGAGGCAAGGAGG - Exonic
1097407774 12:59211991-59212013 GGGGAAGGTGGGATGAATGAGGG - Intergenic
1097823109 12:64147411-64147433 GGGGAAGGTGGGGGACAGGGAGG - Exonic
1100170920 12:91974219-91974241 GGGACAGATGGCAGGAATGGAGG - Intergenic
1100875218 12:98954915-98954937 TGGGCAGGAGGGAGGGAGGGAGG - Intronic
1100885803 12:99068679-99068701 GATGCAGGTGGGAGGGGTGGGGG + Intronic
1101106846 12:101448858-101448880 GGGGCGGGTGGGGGGATTGGGGG + Intergenic
1101138774 12:101773304-101773326 GGAGCAGGTGGAGAGCATGGGGG - Intronic
1101356198 12:103979620-103979642 GGGGAAGGAGAGTGGCATGGGGG + Intronic
1101696791 12:107134662-107134684 GGGGGAGGAGGGGGGAATGGGGG - Intergenic
1101717451 12:107322851-107322873 AGGGCAGGTGGGATGCCTGAAGG - Intronic
1102015110 12:109643117-109643139 GAGGGAGCTGGGAGCCATGGTGG - Intergenic
1102159126 12:110754550-110754572 TGGGCAGATGGAAGGGATGGTGG - Intergenic
1102179476 12:110901567-110901589 GTGGCAGGTGGGAGGGAGGTGGG - Intronic
1102425080 12:112837859-112837881 GGGGAAGGAGGGAGGGAAGGAGG - Intronic
1102462150 12:113106480-113106502 GGGGCAGTGGGGAGGCAAAGAGG - Intronic
1102834185 12:116038538-116038560 GGAGCAAGTGGCAGTCATGGTGG + Intronic
1102959881 12:117085511-117085533 GGGGCCAGTGGGAGGCAGGGTGG - Intronic
1103238913 12:119397801-119397823 GGGGAAGGGGGGAGGGAGGGGGG + Intronic
1103410854 12:120710528-120710550 GGGGCTGGTGGCTGGCAAGGAGG + Exonic
1103463719 12:121125088-121125110 AAGGCAGGTGGGTGGGATGGTGG - Intergenic
1103873256 12:124106470-124106492 GGGGCAGGGGAGAGGTGTGGCGG + Intronic
1103946956 12:124532204-124532226 GGGGCATGGGGGAGACAAGGGGG - Intronic
1103983220 12:124750272-124750294 AGGGCAGGCAGGAGGCATTGGGG - Intergenic
1104276722 12:127335446-127335468 GGTGGAGCTGGGAGGCATGCAGG + Intergenic
1104727217 12:131085412-131085434 TGGGGAGGCGGGAGGCAGGGAGG + Intronic
1104780482 12:131416717-131416739 GGGGAAGGTCCCAGGCATGGTGG + Intergenic
1104895717 12:132162670-132162692 TGGGGAGGTGGGAGGCAGGTAGG + Intergenic
1105007382 12:132729619-132729641 GGGGGAGGGGGGAGGGAAGGTGG + Intronic
1105015875 12:132786639-132786661 GGGCCAGGTGGGAGGTGCGGGGG - Intronic
1105368839 13:19785300-19785322 GGAGCACCTGGGAGGGATGGGGG - Intergenic
1105446579 13:20462208-20462230 GGGGCAGGAGGAGGGCCTGGTGG + Intronic
1105516016 13:21091347-21091369 GGTCCAGATGGGAGGCACGGTGG + Intergenic
1106578729 13:30999779-30999801 GAGGCAGGTGGAAGGCAGTGGGG + Intergenic
1107546031 13:41434419-41434441 AGGGCAGGTTGGATGCAGGGAGG + Intergenic
1107884693 13:44865721-44865743 GGGGCAGGTGAGAGGCAACCTGG - Intergenic
1108530735 13:51324973-51324995 TGGGCTGGTGGGGGGCACGGTGG - Intergenic
1108731184 13:53237599-53237621 GGGGCAGGGGCTGGGCATGGGGG + Intergenic
1108798740 13:54067078-54067100 GGGGCAGGTGGGGGTCAGGGTGG - Intergenic
1109756775 13:66771327-66771349 GGGGCTGAAGGGAGGAATGGAGG - Intronic
1110309969 13:74037408-74037430 GATGCATGTGGTAGGCATGGGGG - Intronic
1110921209 13:81088206-81088228 GTGGAAGGTGGGAGGAAGGGTGG + Intergenic
1111011417 13:82320154-82320176 GGGGCAGGGGGGAGGTGTGCAGG - Intergenic
1111446174 13:88348042-88348064 AGGGAAGGAGGGAGGCAGGGAGG + Intergenic
1112682966 13:101788157-101788179 GGGGCAGGGGGCAGGGGTGGTGG - Intronic
1113314445 13:109163503-109163525 GAGGGAGGTGGGAGGGAGGGAGG - Intronic
1113541087 13:111110255-111110277 GGGGAAGGCTGCAGGCATGGTGG + Intergenic
1113663057 13:112120165-112120187 GGGAAGGGTGGGAGGCAGGGTGG + Intergenic
1113663068 13:112120210-112120232 GGGAAACGTGGGAGGAATGGAGG + Intergenic
1113676356 13:112210053-112210075 GGGGCAGGTGGGGTGCAGGCAGG + Intergenic
1113676374 13:112210097-112210119 GGGGCAGGTGGGGTGCAGGCAGG + Intergenic
1113676392 13:112210141-112210163 GGGGCAGGTGGGGTGCAGGCAGG + Intergenic
1113676432 13:112210251-112210273 GGGGCAGGTGGGGTGCAGGCAGG + Intergenic
1113782816 13:112986473-112986495 TGGGGAGGTGGGAGGTTTGGGGG - Intronic
1113794726 13:113050638-113050660 GGGGGCGGTGGGAGCCGTGGGGG + Intronic
1113899609 13:113788885-113788907 GGGGCAGGAGGGAGGGAGGGAGG - Intronic
1114069113 14:19094214-19094236 GGGGCAGGCGGCAGGCAGTGGGG + Intergenic
1114093147 14:19305789-19305811 GGGGCAGGCGGCAGGCAGTGGGG - Intergenic
1114524394 14:23359209-23359231 GGGACAGAAGGGAGGCAGGGAGG + Intronic
1115562662 14:34597150-34597172 GGGGCAGGTGGGTGGAGGGGAGG - Intronic
1115645139 14:35364054-35364076 GGGGCAGGTGGGATGGGGGGTGG + Intergenic
1116145390 14:41061432-41061454 TGGCCTGGTGGGAGGCCTGGTGG + Intergenic
1117369373 14:55062817-55062839 TGGTCCGGTGGGAGGCACGGAGG - Exonic
1117971008 14:61250803-61250825 GGGGGAGGTTGTAGGCATGTGGG + Intronic
1117986006 14:61386740-61386762 AGTGCTGGTGGGAGGCAGGGAGG + Intronic
1118378867 14:65201458-65201480 GGGCCAGGTGGGAAGGACGGGGG + Intergenic
1118720324 14:68589473-68589495 GGGGCTTGTGGCAGTCATGGGGG - Intronic
1118750812 14:68806869-68806891 GGGACTGGTGGGAGGGAGGGTGG + Intergenic
1118762721 14:68890434-68890456 GTGGGAGATGGGAGGTATGGTGG - Intronic
1118979077 14:70701612-70701634 GGGGGAAGAGGGAGGGATGGGGG + Intergenic
1119188836 14:72664617-72664639 GGGGCAGGTGGGAGGTGGTGAGG - Intronic
1119380848 14:74227341-74227363 GGGGCATCTGGGAGTCATCGAGG + Intergenic
1119437806 14:74609620-74609642 GTGGCAGGAGGGGGGCCTGGAGG - Intronic
1119502631 14:75143557-75143579 GGCTGTGGTGGGAGGCATGGAGG - Intronic
1119738738 14:77000251-77000273 GGGCCAGGAGGGAGGCACAGGGG + Intergenic
1119888725 14:78166217-78166239 GGGGCAGGTTGGGAGCCTGGAGG + Intergenic
1120219620 14:81717472-81717494 GTGGCAGGTGGGAGTCAGGAAGG + Intergenic
1120526707 14:85584917-85584939 GTGGGAGGTGGGTGGCAGGGCGG + Intronic
1121030511 14:90654682-90654704 GGGGCAGGTGCAAGGCTAGGTGG + Intronic
1121085941 14:91146157-91146179 GGGGCATGGGCCAGGCATGGTGG - Intronic
1121155343 14:91678074-91678096 TTGGCAGGTGGGGGGCAAGGGGG + Intronic
1121307824 14:92917971-92917993 GGGGAGGGTGTGAGGCATTGGGG - Intergenic
1121624707 14:95375307-95375329 GGGGAAGGAGGGAGGGAGGGAGG - Intergenic
1121671178 14:95711854-95711876 GGCGCAGGAGTGAGGAATGGAGG - Intronic
1121674520 14:95741564-95741586 GTGGCAGGTGGCAGGTGTGGAGG - Intergenic
1122112234 14:99510600-99510622 TGGGTAGGCGGGAGGCGTGGGGG - Exonic
1122359924 14:101153084-101153106 GGGCCTGGAGGGAGGCCTGGGGG - Intergenic
1122369368 14:101220823-101220845 GGGGCAGGTGGGAAGGAGGGAGG - Intergenic
1122631423 14:103109312-103109334 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631437 14:103109348-103109370 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631451 14:103109384-103109406 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631465 14:103109420-103109442 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631479 14:103109456-103109478 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631493 14:103109492-103109514 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631521 14:103109565-103109587 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631535 14:103109601-103109623 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631549 14:103109637-103109659 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122811527 14:104291743-104291765 GGGCCAGGAGCGAGGCCTGGAGG - Intergenic
1123003121 14:105307235-105307257 GAGGCAGGTGGGACTCATGATGG - Exonic
1123020401 14:105395331-105395353 GGGGAAGGTGTGAGGCGGGGTGG - Exonic
1123027804 14:105436574-105436596 GGGGGAGGTGGCAGGCACGACGG - Intronic
1123038333 14:105480320-105480342 TGAGCAGGAGGGAGGGATGGGGG + Intergenic
1123068087 14:105628183-105628205 GGGGCAGGTGGGGGGGCAGGAGG - Intergenic
1123842320 15:24260880-24260902 GGTGTAGGTGGGATCCATGGAGG + Intergenic
1124155954 15:27225576-27225598 AAGGCAGGTGGGAAGCATAGAGG - Intronic
1124277239 15:28336279-28336301 AGGGCAGGTGGGGGGCCTGTGGG + Intergenic
1124305462 15:28575327-28575349 AGGGCAGGTGGGGGGCCTGTGGG - Intergenic
1124410231 15:29430710-29430732 GAGGAAGGAGGGAGGAATGGAGG + Intronic
1124426718 15:29569839-29569861 GGGGCAGGGGGCAGGCAAGGGGG - Intronic
1124483692 15:30098365-30098387 GGGGGGGGCGGGAGGGATGGCGG + Intergenic
1124519887 15:30398861-30398883 GGGGGGGGCGGGAGGGATGGCGG - Intergenic
1124538767 15:30567362-30567384 GGGGGGGGCGGGAGGGATGGCGG + Intergenic
1124661366 15:31553375-31553397 GAGCCAGGTTGGGGGCATGGTGG + Intronic
1125004956 15:34806925-34806947 GGTGGTGGTGGGGGGCATGGAGG - Intergenic
1125508414 15:40280525-40280547 GGGGGAGCTGGGAGGCGTGGAGG + Intronic
1125694275 15:41622038-41622060 GGGGAGGGTGGGGGGCGTGGCGG + Intronic
1127061435 15:55189958-55189980 CGGGCCGGTGCCAGGCATGGTGG + Intronic
1127503845 15:59579434-59579456 GGGGCCTGTGGGAGGGGTGGGGG - Intergenic
1127507471 15:59610614-59610636 AGGGAAGGAGGGAGGGATGGAGG - Intronic
1127834181 15:62776862-62776884 GGGGCTGGTTGGGGGCATGGTGG + Exonic
1128249020 15:66152000-66152022 TGGGCAGGTGGGAGGGGTGAAGG - Intronic
1128335137 15:66780936-66780958 TGGGGAGGTGGGAGGCACCGAGG - Intronic
1128511471 15:68316336-68316358 GGGGCAGGGAGGAGGCGAGGAGG - Intronic
1128793761 15:70450452-70450474 GGGGGAGGTGGGGGGTTTGGTGG - Intergenic
1128799576 15:70489133-70489155 TGGGAAGGTGGGAGTCACGGAGG + Intergenic
1129108444 15:73324044-73324066 GGGGCAGGTGGGGGGTGTTGGGG - Intronic
1129210559 15:74065631-74065653 GTGGGGGGTGGGAGGGATGGCGG - Intergenic
1129232824 15:74206193-74206215 GGGGCAGGTGGGAGGCAATGGGG - Intronic
1129272516 15:74426898-74426920 TGGGCAGTTAGGAGCCATGGTGG - Intronic
1129356594 15:74995983-74996005 GGGGCTGGCGGGGGGGATGGAGG - Intronic
1129403452 15:75299698-75299720 GTGGGGGGTGGGAGGGATGGCGG + Intergenic
1129409280 15:75339926-75339948 TGGGCAGGTGGGAGGCAGTCAGG - Intronic
1129466833 15:75728772-75728794 TGGGAGGGTGGGAGCCATGGAGG + Intergenic
1129720402 15:77874982-77875004 AGGGAGGGTGGGAGCCATGGAGG - Intergenic
1129727759 15:77910268-77910290 GTGGGGGGTGGGAGGGATGGCGG - Intergenic
1129840118 15:78738592-78738614 GTGGGGGGTGGGAGGGATGGCGG + Intergenic
1129869026 15:78929123-78929145 GGGGCAGGTGGGGGGAAGGAGGG + Intronic
1130008773 15:80130052-80130074 GGGGTAGTTGGGAGCCATTGAGG + Intronic
1130151204 15:81313074-81313096 GGGGCAGGAGGCAGGAAGGGTGG + Exonic
1130255935 15:82326075-82326097 GGGGAAGGTGGCAGGAGTGGAGG + Intergenic
1130282546 15:82531235-82531257 GTGGAGGGTGGGAGGGATGGCGG + Intergenic
1130375340 15:83323981-83324003 GGGGCAGGTGGAGGCCTTGGAGG - Intergenic
1130704986 15:86224645-86224667 GTGGAAGGTGGGAGGCAAGCAGG + Intronic
1130813536 15:87406748-87406770 GGGGGAGGAGGGAGGGAGGGAGG + Intergenic
1130968420 15:88714371-88714393 GGGGCAGGTGGTGGGGAGGGTGG - Intergenic
1131046867 15:89322077-89322099 TGGGCAGGTGAGGGCCATGGTGG - Intronic
1131356606 15:91750877-91750899 GGTGGAGGTGGTAGGGATGGTGG + Intergenic
1131742490 15:95409407-95409429 AGGGCAGCTGGGAGGCATTTTGG + Intergenic
1131764472 15:95660439-95660461 GGGGCAGGAGGGAGGGCAGGGGG - Intergenic
1131806239 15:96125625-96125647 AGGCAAGGTGGGAGGCAAGGCGG - Intergenic
1131838087 15:96409880-96409902 GGGGCTGGTGGGCGGCGCGGCGG - Intergenic
1132185218 15:99797656-99797678 GTGGGGGGTGGGAGGGATGGCGG + Intergenic
1132431770 15:101766899-101766921 GTGGGGGGTGGGAGGGATGGAGG - Intergenic
1132531294 16:451327-451349 GGTGCAGGGGTGAGGCAGGGGGG - Intronic
1132588793 16:717406-717428 GGGGCTGGTAGGAGGGAGGGTGG + Exonic
1132591564 16:728447-728469 GGGGCCGGCGGGAGGCGGGGTGG - Intronic
1132658326 16:1050524-1050546 GGGGCAGGTGGGATGCCTGTGGG + Intergenic
1132675523 16:1119783-1119805 GGGGCAGCAGGGGGGCATCGGGG - Intergenic
1132691067 16:1182187-1182209 GTGGCAGGTGGGAGGCTCTGCGG + Intronic
1132700118 16:1218710-1218732 GGGGCAGGTGGGAGGGAGGATGG + Intronic
1132715846 16:1289444-1289466 GGGGGAGGGGGGAGGGAGGGAGG + Intergenic
1132881391 16:2163176-2163198 GGGGCAGGGAGAAGGCATGCGGG - Intronic
1133076646 16:3285256-3285278 TGGGCAGGTGGGAGGGAGGAGGG + Intronic
1133100186 16:3474697-3474719 GGGGCAGGTGCAAGGTGTGGAGG - Intronic
1133102320 16:3486848-3486870 GGGGCAGGTGTGGGGCAGGGTGG - Exonic
1133461558 16:5990640-5990662 GGGGAAGGTGGGTGGGAGGGAGG + Intergenic
1133463014 16:6003468-6003490 GGGCCGGGTGGGAGGGGTGGTGG - Intergenic
1133564219 16:6978039-6978061 GGGGCAGGTTAGAGGGAGGGCGG - Intronic
1133608771 16:7413588-7413610 GGGGCAGGCAGGGGGCAGGGGGG - Intronic
1134135648 16:11674787-11674809 TGGGCAGGTGGGAGGCAGGGAGG - Intronic
1134223848 16:12376446-12376468 GTGGCAGGGGCCAGGCATGGTGG + Intronic
1134432527 16:14224188-14224210 GGGCCTGGTGGGAATCATGGGGG - Intronic
1134449222 16:14353740-14353762 GAGGCAGGAGGGAGGGAGGGAGG + Intergenic
1134519342 16:14911594-14911616 GGGGCCGGCGGACGGCATGGCGG - Intronic
1134685381 16:16154829-16154851 GGCAAAGATGGGAGGCATGGTGG - Intronic
1134707012 16:16310249-16310271 GGGGCCGGCGGACGGCATGGCGG - Intergenic
1134960528 16:18401875-18401897 GGGGCCGGCGGACGGCATGGCGG + Intergenic
1135222471 16:20624846-20624868 GGGGCAGGTGGGTGGAATGGGGG - Intronic
1135601154 16:23784716-23784738 GGTGCAGGTGGGAGGCTCAGAGG + Intergenic
1135728041 16:24872297-24872319 TGGGCAGGAGGGAGGGATGGCGG - Intronic
1135771426 16:25221150-25221172 AGGGCTGGAGGGAGGCTTGGAGG + Intronic
1135927700 16:26709853-26709875 GGGGGAGGGGGGAGGGAGGGAGG + Intergenic
1136030037 16:27496020-27496042 GGGCCAGGTGGGAGGCGTCTGGG + Intronic
1136030612 16:27500021-27500043 GGGGCAGCGGGTAAGCATGGGGG - Intronic
1136400047 16:30011979-30012001 CGGGCAGGGGGGCGGCTTGGGGG - Intronic
1136564412 16:31061487-31061509 GTGGCAGGTGGTGGGCATGACGG - Exonic
1137305244 16:47192583-47192605 GGGGCAGGTGGGTGGTTGGGGGG - Intronic
1137561461 16:49504995-49505017 AGGGCAGGTGGGAGGCAGGAAGG + Intronic
1137589886 16:49687043-49687065 TGGGGAGGTGGCAGACATGGAGG - Intronic
1137614021 16:49836359-49836381 GGGGGAGGGGGTTGGCATGGAGG + Intronic
1137637785 16:50002219-50002241 AGGGAAGGTGGGAGGGATGTAGG - Intergenic
1137774021 16:51040897-51040919 AGGGAAGGAGGGAGGGATGGGGG + Intergenic
1138114519 16:54349885-54349907 GGGCCTGGTGGGAGGCGTGTGGG + Intergenic
1138144476 16:54596341-54596363 GGGGAAGGGGCAAGGCATGGAGG - Intergenic
1138389206 16:56657986-56658008 GGGGCAGGTGGAAGGCGTGGTGG - Exonic
1138389926 16:56662884-56662906 GGGGCAGGTGGGAGGCATGGTGG + Intronic
1138391873 16:56676117-56676139 GGGGCAGGTGGGAGGCGTGGTGG - Exonic
1138422599 16:56909415-56909437 GGGGATGGTGGTAGGGATGGGGG - Intronic
1138539753 16:57680637-57680659 AGGGCGGGAGGGAGACATGGTGG - Intronic
1138600552 16:58051562-58051584 AGGGAAGGTGGGAGGGAGGGAGG + Intergenic
1138607452 16:58098174-58098196 GGGGCAGGTGAGAGGAAAGAGGG - Intergenic
1138619801 16:58201710-58201732 GGGGGAGGTGCCAGGCAGGGAGG + Intergenic
1139351965 16:66342620-66342642 GGGGCATGTGTCAGGCAAGGCGG + Intergenic
1139356022 16:66367425-66367447 GGTGCTGGTGGGAGGAATGGTGG - Intronic
1139375719 16:66495291-66495313 AGGGAGGGTGGGAGGCAGGGAGG - Intronic
1139505319 16:67395569-67395591 GGGGAAGGTGGAAGTCAAGGAGG + Intronic
1139530537 16:67540377-67540399 GGGGCAGGTGGGGGGCTGGAGGG + Intronic
1139622554 16:68158428-68158450 GGGTCAAGTGGGATGCCTGGAGG - Intronic
1139668623 16:68475833-68475855 GGGGCAGGAGGGCAGCAAGGGGG - Intergenic
1139670699 16:68491022-68491044 AGGGGTGGTGGGAGGGATGGGGG + Intergenic
1140225137 16:73071010-73071032 GGGGCGGGGGGGAGGGTTGGGGG - Intergenic
1140476203 16:75240293-75240315 GGGGCAGGCCTGAGGCTTGGAGG + Intronic
1140517404 16:75553970-75553992 GGGGATGGTGGGAGGAATTGGGG - Intronic
1141028816 16:80570765-80570787 GGGGAAGGTGGGAGTGGTGGGGG - Intergenic
1141170214 16:81686215-81686237 GGGACAGGTGGGAGGAAAGGAGG + Intronic
1141503509 16:84460504-84460526 AGGGCAGGTGCGATGCCTGGGGG + Intronic
1141558108 16:84849292-84849314 CGGGCAGGTAGGAGGGAGGGAGG - Intronic
1141630275 16:85283923-85283945 TGGGCAGGAGGGAGACGTGGTGG - Intergenic
1141705403 16:85661825-85661847 GGGGCAGGTGGCTGGCATGCAGG - Intronic
1141767460 16:86067963-86067985 GGGAGGGGTGGGAGCCATGGGGG + Intergenic
1141837972 16:86555153-86555175 AGGGCAGGTGGGGGGCCTGGCGG - Exonic
1141854787 16:86673657-86673679 AGGGAAGGAGGGAGGTATGGAGG - Intergenic
1141952007 16:87345321-87345343 GGGGAGGGCGGGAGGCAGGGTGG + Intronic
1142228682 16:88889333-88889355 GGGGGTGGTGGGAGGGAGGGAGG + Intronic
1142282317 16:89154970-89154992 GGGGCAGGTGGGGGTCTGGGTGG - Exonic
1142356225 16:89603473-89603495 GGGGCTGGAGGGAGGCACTGGGG + Intergenic
1142359213 16:89618953-89618975 GGGGCAGGGGGGCTGCAGGGAGG - Intronic
1142375806 16:89706623-89706645 GAGGCAGGTGGCAGGGCTGGTGG - Intergenic
1142418187 16:89954380-89954402 GGTGCTGGTGGGAGTCAGGGTGG + Intronic
1142420711 16:89967838-89967860 GGGGCAGGTGGGGGAGATGCTGG - Exonic
1142484266 17:236560-236582 GGGGCAGATGGTTGGCTTGGAGG + Intronic
1142593176 17:1016601-1016623 GGGGTAGGGGCCAGGCATGGTGG - Intronic
1142613835 17:1123962-1123984 GGGGCAGGTGGGAGGCAAGGGGG - Intronic
1142614249 17:1125571-1125593 GGGGCTGCTGGGAGGCGGGGAGG + Intronic
1142839115 17:2613384-2613406 GGGGGAGGTGGCTGTCATGGGGG + Intronic
1142903551 17:3027766-3027788 GGAGCAGAGGGGAGGGATGGAGG + Intronic
1142957814 17:3533123-3533145 GGGCCAGGGTGGAGGCAGGGAGG - Intronic
1142961174 17:3553382-3553404 AGGGCAGTGGGGAGCCATGGAGG - Intronic
1143027850 17:3951565-3951587 GTGGCAGGTGGGAGGCACTGGGG - Exonic
1143028783 17:3955820-3955842 GGGGCAGGCAGGAGGCATCATGG - Intronic
1143033755 17:3982662-3982684 GAGGCTGGGTGGAGGCATGGAGG - Intergenic
1143055367 17:4158224-4158246 GGGGCAGGTGAGGAGGATGGCGG - Intronic
1143189552 17:5031712-5031734 GGGGTGGGTGCGAGGCGTGGGGG + Intergenic
1143375261 17:6463432-6463454 AGGGAAGGAGGGAGGCAGGGAGG + Intronic
1143406028 17:6677717-6677739 AGGGCAGGTCTGAGGCTTGGTGG - Intergenic
1143410825 17:6707374-6707396 TGGGAAGGAGGGAGGCAGGGAGG - Intronic
1143513633 17:7408554-7408576 CGGGCAGGCGGGCGGCAGGGTGG - Exonic
1143659015 17:8313292-8313314 GGGACAGGAGAGAGGCAGGGGGG + Intronic
1143673728 17:8415111-8415133 GAGGCAGGAGGGAGGGAGGGAGG - Intronic
1143732022 17:8886766-8886788 GGGTCAGGTGAGGGGCATGGAGG - Intronic
1144066120 17:11625695-11625717 GTGGCAGGTGGCAGGGATGTGGG - Intronic
1144647823 17:16987442-16987464 GGGGGAGGAGGGAGGGAGGGAGG + Intergenic
1144662112 17:17077864-17077886 GGGGCAGGTGGCAGGAAAAGAGG - Intronic
1144710691 17:17399644-17399666 GAGGGAGGTGGGAGCCCTGGAGG - Intergenic
1144752124 17:17656185-17656207 GGGGCTGGTGGGAGGTGTTGGGG - Intergenic
1144756942 17:17685628-17685650 GGGACAGGATGGAGGCAGGGAGG - Intronic
1144816985 17:18041188-18041210 GGGGCGGGGGGGAGGCAGTGGGG - Intronic
1144960105 17:19039976-19039998 AGGGCAGTTGGGAGCCATGGAGG - Intronic
1144975055 17:19134548-19134570 AGGGCAGTTGGGAGCCATGGAGG + Intronic
1144995538 17:19265658-19265680 GGAGCAGGTGAGAGGCATAAGGG - Intronic
1145007180 17:19344465-19344487 GGGCCAGGCGGGAGGCCAGGAGG + Intronic
1145166396 17:20615877-20615899 GGGGCAGGTGGGGGAGATGCTGG - Intergenic
1145261784 17:21358846-21358868 GGGGCAGCAGGGAGGCCTGCAGG + Intergenic
1145786484 17:27597203-27597225 GTGGCTGGTGGGAGGCAGGTGGG + Intronic
1145809522 17:27756136-27756158 GGGGAAGGTGGCGGGCAAGGGGG + Intergenic
1145878947 17:28340208-28340230 GCGGCAGGTGGCAGGGAAGGGGG - Intronic
1146520345 17:33521312-33521334 GGGGGAGGTGGGAGGTAAAGAGG + Intronic
1146642602 17:34552656-34552678 GAGGCAGATGGTAGCCATGGAGG + Intergenic
1146878931 17:36432203-36432225 GGGGAGGGTGGGAGGCCTTGGGG - Intronic
1146882871 17:36453349-36453371 GGGGAGGGTGGGAGGCCTTGGGG - Intergenic
1147342054 17:39758522-39758544 GGGGAAGGTGGGTGGCATCTTGG + Intergenic
1147384671 17:40074264-40074286 GTGGCAGGTGGGAGGGCTGGGGG - Exonic
1147419351 17:40314457-40314479 GGGGCAGGTGGGAGAGTGGGTGG + Intronic
1147597088 17:41724329-41724351 GGGGGCGGTGGGTGGGATGGTGG - Exonic
1147662760 17:42125758-42125780 GGGGCAGCGGGCAGGCAAGGGGG + Exonic
1147727376 17:42574700-42574722 GGGGAAGGAGGGAGGGAGGGAGG - Intronic
1147755209 17:42762899-42762921 AGGGGAGGAGGGAGGCCTGGTGG - Exonic
1147793528 17:43027447-43027469 GGGGTGGCTGGGAGGGATGGGGG - Intronic
1147946674 17:44084270-44084292 GGGGCAGGTGGCAGGGAGAGAGG + Intronic
1147946871 17:44085290-44085312 GGGGCAGGTTTGTGGCAGGGTGG - Intronic
1147971253 17:44219947-44219969 GGGGCAGCTGGGAGGAGGGGCGG + Intronic
1148154364 17:45414248-45414270 GGGGGAGGGGGAAGGAATGGTGG - Intronic
1148735891 17:49864645-49864667 GGAGAAGGTGGGAGGGTTGGGGG + Intergenic
1148754388 17:49965093-49965115 GGGGCCGGTGGGTGGGATGGAGG + Intergenic
1148795874 17:50196417-50196439 GGGGCAAGATGGAGGCCTGGGGG - Intronic
1148809849 17:50283526-50283548 GTGGCAAGTGTGGGGCATGGAGG - Intergenic
1149333128 17:55606962-55606984 TGGGAGGGTGGGAAGCATGGAGG - Intergenic
1149333601 17:55611053-55611075 AGGGCAGGAGGGAGGGAGGGAGG - Intergenic
1149439202 17:56661345-56661367 TGGGGAGGTGGGAGGCAGTGAGG - Intergenic
1149497773 17:57131184-57131206 GGGGGAGGTGGAAGGCGGGGAGG - Intergenic
1149535645 17:57431458-57431480 GAGGCAGGTGGTAGGTTTGGGGG + Intronic
1149571275 17:57674085-57674107 GGGGATGGAGGGAGGGATGGGGG - Intronic
1149865487 17:60149049-60149071 GAGGCAGCTTGGGGGCATGGGGG + Intergenic
1149866549 17:60154238-60154260 GGGGTGGGTGGGAGGGGTGGGGG + Intronic
1150029413 17:61716698-61716720 GGGGTAGGGGGGAAGCAAGGTGG - Intronic
1150164590 17:62929336-62929358 GGAGCAGTTGGGGGTCATGGAGG + Intergenic
1150218688 17:63483989-63484011 GGGGGAAGTGGGAGGCAGAGAGG + Intergenic
1150267751 17:63842233-63842255 GAAGCAGCTGGGAGGCCTGGGGG - Intronic
1150285087 17:63949837-63949859 GGGGGGTCTGGGAGGCATGGGGG + Intronic
1150656229 17:67041635-67041657 GGAGCAGGTGGAAGGGCTGGAGG - Intergenic
1150725159 17:67645576-67645598 GGGGGAGGAGGGATGCAGGGGGG + Intronic
1150947793 17:69765903-69765925 GGGGCAGGAGGGGAGCAGGGAGG - Intergenic
1151226028 17:72648936-72648958 TGGGCAGCTGAGCGGCATGGTGG - Exonic
1151368215 17:73630697-73630719 CGGGGAGGTGGCAGGCCTGGGGG + Intronic
1151479445 17:74361699-74361721 GGGCCAGGTGCGGGGCAGGGTGG - Intronic
1151658736 17:75507887-75507909 GGGCCAGCTGGGAGGCGGGGGGG - Intronic
1151746099 17:76012648-76012670 GGGGCCTGTGGGAGGCAGGCAGG + Intronic
1152026876 17:77815675-77815697 GGGGCCAGTGGGAGGCAGGCTGG - Intergenic
1152273451 17:79339511-79339533 GGAGCTGGTGGGAGGGAAGGAGG + Intronic
1152280705 17:79383562-79383584 GGGGCAGGAGGCAGCCATCGGGG - Intronic
1152321014 17:79608930-79608952 GGGGCGTGGGGGCGGCATGGCGG - Intergenic
1152488005 17:80608161-80608183 GGGGCAGGTGGCAGGAGTGGGGG - Intronic
1152662929 17:81551339-81551361 GGGGAAGGTGGGAGGCCATGTGG - Intronic
1152783134 17:82235267-82235289 AGGGCCGGTGGGAGGCAAGGGGG + Exonic
1152814683 17:82400267-82400289 GGGGCATCTGTGAGGCCTGGAGG - Intronic
1152863416 17:82709108-82709130 GGAGCAGGGGGAGGGCATGGGGG - Intergenic
1152863496 17:82709323-82709345 GGGGCAGGGGTGGGTCATGGGGG - Intergenic
1152863540 17:82709434-82709456 GGAGCAGAGGGCAGGCATGGGGG - Intergenic
1152919612 17:83059431-83059453 GGGGCAGGTGTTGGGCATTGGGG - Intergenic
1153151870 18:2105148-2105170 GTGGCATGTGGGAGCCATGAGGG - Intergenic
1153881074 18:9422230-9422252 GGGGCGGGTGGGAGGTGGGGAGG + Intergenic
1154043131 18:10878087-10878109 GGAGGATGTGGGAGGGATGGCGG - Intronic
1154154733 18:11934976-11934998 AGGGAAGGAGGGAGGGATGGAGG + Intergenic
1154250240 18:12738241-12738263 GGGGCACGTGGGAAGCTTGGCGG - Intergenic
1155101532 18:22615088-22615110 GAGGCAGCTGTGAGGCATGGGGG + Intergenic
1156052120 18:32950297-32950319 GGTGCAGGTGGGAAGAATAGAGG - Intronic
1156462265 18:37327658-37327680 GGGGGAGCGGGGAGGCAAGGGGG + Intronic
1156471791 18:37381720-37381742 AGGGCAGCAGTGAGGCATGGAGG - Intronic
1156623595 18:38882126-38882148 AGGGAAGGAGGGAGGGATGGAGG + Intergenic
1157134341 18:45039314-45039336 GGGGCTGGTGGGAGGCACTGTGG - Intronic
1157506408 18:48229824-48229846 GGGGCAGGTGTGGGGCACTGAGG + Intronic
1157523300 18:48360375-48360397 TGGGATGGTGGTAGGCATGGGGG + Intronic
1157590843 18:48835819-48835841 AGGGCAGGTGGGGGGCTTGGTGG - Intronic
1157664000 18:49470027-49470049 GGGGCAGGTGGTGGGTATGGAGG - Intergenic
1157700532 18:49759260-49759282 GGAGAAGGTGGTAGGCATTGGGG + Intergenic
1157814333 18:50720099-50720121 GGAGAAGGTGTGAAGCATGGAGG - Intronic
1158299821 18:56038750-56038772 AGGGCAGGTAGGAGACATGCTGG + Intergenic
1158300250 18:56043999-56044021 GGGCCAGGTGTGAGGCCAGGTGG + Intergenic
1158471805 18:57743664-57743686 GGCGCAGGTGGGAGATCTGGGGG + Intronic
1158525163 18:58206770-58206792 GGTGTTTGTGGGAGGCATGGTGG + Intronic
1158586011 18:58735669-58735691 AGGGTGGGTGGGTGGCATGGAGG + Intronic
1159987283 18:74858129-74858151 AGGGAAGGAGGGAGGCAGGGAGG - Intronic
1160022683 18:75192675-75192697 AGGGCAGGTAGGAGCCAGGGTGG - Intergenic
1160024741 18:75208559-75208581 GGGGGAGGAGGGAGGGCTGGAGG + Intronic
1160034151 18:75285877-75285899 GGGGCAGGTGGGGGGTGTGGGGG - Exonic
1160156448 18:76437336-76437358 GGGGCTGCTGGGCGGCAGGGAGG + Intronic
1160241184 18:77124426-77124448 GTGGGGGGTGGGAGGCGTGGTGG - Intronic
1160415017 18:78703692-78703714 GAGGCAGGACAGAGGCATGGCGG + Intergenic
1160680395 19:409328-409350 GGGGCCGGTGGGAGACAAGCAGG + Intergenic
1160723840 19:608923-608945 GGGGGAGCTGGGAGGGGTGGAGG + Intronic
1160797707 19:953459-953481 GGGGGGTGTGGGAGGCCTGGGGG - Intronic
1160809692 19:1008023-1008045 GGGGCAGTGGGGAGCCACGGAGG + Intronic
1160887230 19:1355502-1355524 GGTCCAGGTGGCAGGGATGGGGG - Intronic
1160946978 19:1648240-1648262 GGGGCAGAAGGCAGGCATGCAGG + Intronic
1160960300 19:1717959-1717981 GGGGCAGGTGGGTGGGTTGGTGG + Intergenic
1160960343 19:1718157-1718179 GGGGCAGGTGGGTGGGTTGGTGG + Intergenic
1161137127 19:2626424-2626446 AGGGCAGGAGGGAGCCATAGCGG - Intronic
1161195172 19:2982644-2982666 AAGGGAGGTGGGAGCCATGGAGG + Intronic
1161195424 19:2983693-2983715 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1161208960 19:3056497-3056519 GAGGCAGGTGGGAGGGAAAGAGG + Intronic
1161213355 19:3079863-3079885 AAGGAAGGTGGGAGCCATGGAGG + Intergenic
1161222876 19:3126091-3126113 GAGGGAGGTGGGAGCCCTGGAGG + Intergenic
1161238846 19:3210804-3210826 AGGGCAGCTGGGAGCCATGGAGG + Intergenic
1161257329 19:3316595-3316617 GAGGAAGGTGGGAGCCATGGAGG + Intergenic
1161258870 19:3324635-3324657 GAGGGAGGTAGGAGCCATGGAGG - Intergenic
1161270152 19:3385206-3385228 TGGGCAGGTGGGAGGGTTGGGGG - Intronic
1161273122 19:3401224-3401246 AAGGCAGGTGGGAGCCATAGAGG + Intronic
1161286481 19:3471107-3471129 GAAGGAGGTGGGAGCCATGGAGG + Intergenic
1161289430 19:3485109-3485131 GAGGAATGTGGGAGCCATGGAGG + Intergenic
1161324927 19:3659006-3659028 GGCGGAGGTGGGATGCAGGGTGG - Intronic
1161327293 19:3670005-3670027 GGGGCAGGCAGCAGGTATGGAGG + Intronic
1161329065 19:3677879-3677901 GGGGAGGGAGGGAGGGATGGAGG + Intronic
1161331958 19:3692740-3692762 AAGGGAGGTGGGAGCCATGGAGG - Intronic
1161332918 19:3696819-3696841 AAGGGAGGTGGGAGCCATGGAGG + Intronic
1161403190 19:4077992-4078014 GTGGCAGGTGGGCTGCAGGGAGG - Intergenic
1161428783 19:4218718-4218740 GGGGAAGGGGGGAGGGAAGGGGG - Intronic
1161431254 19:4233592-4233614 AAGGCAGGTGGGAGCCATGGAGG - Intronic
1161477711 19:4495654-4495676 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1161482976 19:4519889-4519911 GGAGAAGGTGGGAGCCATGGAGG - Intergenic
1161490359 19:4557862-4557884 GAGGAAGGTGGGAGCCACGGAGG - Intronic
1161492110 19:4567786-4567808 GAGGCAGGTGGGAGCCATGGAGG - Intergenic
1161493700 19:4576226-4576248 CAGGGAGGTGGGAGCCATGGAGG - Intergenic
1161503847 19:4633316-4633338 GAGGGAGGTGGGAGCCATAGAGG + Intergenic
1161505806 19:4642821-4642843 AAGGGAGGTGGGAGCCATGGAGG + Intronic
1161522208 19:4730943-4730965 GAGAGAGGTGGGAGCCATGGAGG - Intergenic
1161596679 19:5154259-5154281 GAGGGAGGTGGGAGCCATGGAGG + Intergenic
1161599192 19:5170523-5170545 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1161611502 19:5245692-5245714 GGCACAGGTGGGAGGCAGCGTGG - Intronic
1161619180 19:5289482-5289504 GAGGCAGGTGGGAGCCATGGAGG - Intronic
1161620950 19:5296802-5296824 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1161621396 19:5299174-5299196 GAGGGAGGTGGGAGCCATGGAGG - Intronic
1161623173 19:5309955-5309977 GAGGGAGGTGGGAGCCAGGGAGG - Intronic
1161630831 19:5354604-5354626 GAGGGAGGCGGGAGCCATGGAGG + Intergenic
1161634301 19:5377591-5377613 GAGGAAGGTGGGAACCATGGGGG + Intergenic
1161644478 19:5444629-5444651 GAGGAAGATGGGAGCCATGGAGG - Intergenic
1161649373 19:5474870-5474892 GAGGGAGGCGGGAGCCATGGAGG + Intergenic
1161650398 19:5480659-5480681 GAGGGAGGTGGGAGCCATTGAGG + Intergenic
1161663843 19:5563195-5563217 GAGGGAGGTGGGAGCCATGGAGG + Intergenic
1161664186 19:5565048-5565070 GAGGGAGGTGGGAGCCATAGAGG - Intergenic
1161717893 19:5887070-5887092 GGGGCTGGAGCCAGGCATGGTGG - Intronic
1161756450 19:6137544-6137566 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1161760555 19:6168065-6168087 GAGGGAAGTGGGAGCCATGGAGG - Intronic
1161815664 19:6498461-6498483 AAGGTAGGTGGGAGCCATGGAGG - Intronic
1161846954 19:6717159-6717181 TAGGAAGGTGGGAGCCATGGAGG + Intronic
1162063733 19:8111916-8111938 GAGGTAGGTGGGGGGCAAGGCGG - Intronic
1162087875 19:8259464-8259486 GGGGGAGATGGGAGCCATGGAGG + Intronic
1162087969 19:8259955-8259977 AAGACAGGTGGGAGCCATGGAGG - Intronic
1162146667 19:8616575-8616597 GGGGGAGGAGGGAGTCCTGGGGG + Intergenic
1162148637 19:8629478-8629500 TGAGGAGGTGGGAGCCATGGAGG + Intergenic
1162237704 19:9321725-9321747 GGGGGAGGAGGGTGGCAGGGGGG - Intergenic
1162304463 19:9863326-9863348 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1162308071 19:9887719-9887741 AGGGGAGATGGGAGCCATGGAGG - Intronic
1162315246 19:9934844-9934866 GGGGGTGTTGGGAGGAATGGAGG - Intronic
1162534088 19:11253057-11253079 GAGGGCGGTGGGAGCCATGGAGG + Intronic
1162569086 19:11460432-11460454 GAGGAAGGTGGGAGCCATAGAGG - Intronic
1162766774 19:12924607-12924629 GGGGCAGGGGTGGGCCATGGTGG - Intronic
1162782724 19:13014874-13014896 GGGGCTGGTGGTAGGCGAGGTGG + Intronic
1162806380 19:13139913-13139935 GAGGCAGATGAGAGGCAGGGAGG - Exonic
1162833188 19:13299533-13299555 TAGCCAGGTGGGAGCCATGGAGG - Intronic
1162871682 19:13591199-13591221 GAGTCAGGTGGGAGCCATGGAGG + Intronic
1162894663 19:13758000-13758022 GAGGAAGGTGGGAGCCATGGAGG - Intronic
1162897921 19:13776479-13776501 GGGTGAGGTGGAAGCCATGGAGG - Intronic
1162918754 19:13888338-13888360 GAGGCAGGTGGGAGGGGAGGAGG - Intronic
1162954414 19:14090414-14090436 GGGCCGGGCGGGAGGCATGGCGG - Exonic
1162999251 19:14355873-14355895 GGGTGAGGTGGGAGCCATAGAGG + Intergenic
1163034734 19:14564104-14564126 GGGGCAGGTGGGAGGAGGGTAGG + Intronic
1163064882 19:14785479-14785501 GGGTAAGGTGGGAGCCATAGAGG - Intergenic
1163093823 19:15041291-15041313 GGGGGAGGGGGGAGGGAGGGGGG - Intergenic
1163157083 19:15445466-15445488 AAGGCTGGTGGGAGGCCTGGGGG + Intronic
1163209441 19:15829712-15829734 GGGGGAAGAGGGAGGAATGGAGG - Intergenic
1163375451 19:16927595-16927617 GGTGCAGGATGGAGGCCTGGGGG - Intronic
1163442070 19:17327394-17327416 GGGGCAGCTGGGAGGCGAGAGGG - Intronic
1163458613 19:17423465-17423487 AGGGAAGGTGGGAGGGATGCTGG - Intronic
1163533006 19:17861693-17861715 GGAGCGGGTGGGTGGCATGGTGG + Intronic
1163675414 19:18653386-18653408 GGGGCAGGTGGGTGGGTGGGCGG - Intronic
1163715689 19:18870777-18870799 GGGGCAGGGTGAAGGCAAGGAGG - Intronic
1163919398 19:20274742-20274764 GGAGCAGGTGGCAGCCTTGGAGG - Intergenic
1164428499 19:28166362-28166384 GGTGCAGGTGGGATGCAAAGGGG + Intergenic
1164630541 19:29759056-29759078 GACCCAGGAGGGAGGCATGGAGG + Intergenic
1164789961 19:30968401-30968423 AGGCCAGGCGAGAGGCATGGAGG + Intergenic
1164908888 19:31989533-31989555 GGGGCAGGTGAGGTGCAAGGAGG - Intergenic
1164983087 19:32628600-32628622 GAGGCAGCTGGGGGGCAGGGAGG + Intronic
1165060149 19:33201213-33201235 GAGGCTGGGGGGAGGGATGGAGG + Intronic
1165071887 19:33260667-33260689 GGGCCGGGTGGGAGGCCTCGTGG - Intergenic
1165074470 19:33273284-33273306 GTGGCAGGTGGGTGGCCAGGAGG + Intergenic
1165335093 19:35164109-35164131 AGGGCAGGAGTGAGCCATGGAGG - Intronic
1165335851 19:35169139-35169161 AGGCCAGGAAGGAGGCATGGAGG - Intronic
1165376804 19:35448773-35448795 GGGGAAGCTGGGAGGCTTAGAGG - Intronic
1165380011 19:35472569-35472591 GGGGCAAGAGGCAGGAATGGAGG - Intergenic
1165764659 19:38343243-38343265 TGTGCAGGTGGGAGGGATGCTGG - Intronic
1166011092 19:39943425-39943447 GGGGCAGGCGGTGGGTATGGAGG + Intergenic
1166147008 19:40844867-40844889 AGGGGAAGTGGCAGGCATGGAGG + Intronic
1166151166 19:40876763-40876785 AGGGGAAGTGGCAGGCATGGAGG + Intronic
1166228205 19:41410545-41410567 GCGGCAGGCAGGCGGCATGGTGG - Intronic
1166320842 19:42017972-42017994 GGGAGAGTTGGGAGGGATGGGGG + Intronic
1166329340 19:42069528-42069550 GGGGAAGGAGGGAGGAAAGGAGG + Intronic
1166334360 19:42096253-42096275 TGGGCAGGTGGGTGGGATGCAGG + Intronic
1166398081 19:42457170-42457192 GAGGCAGGGGCCAGGCATGGTGG - Intergenic
1166552595 19:43676363-43676385 TGGGGAGGTGGGGGGGATGGGGG + Intergenic
1166563134 19:43746737-43746759 GGGGGTGGTGGGATGGATGGGGG + Intronic
1166673913 19:44727710-44727732 GAGGGAGATGGGAGCCATGGAGG - Intergenic
1166816089 19:45547073-45547095 GGGGAAGGAGGGAGGGAGGGAGG + Intronic
1167072784 19:47230571-47230593 GGGGCGGGGGGGCGGCACGGAGG - Intronic
1167107374 19:47438102-47438124 TGGTCAGGTGGGAGGCTGGGAGG - Intronic
1167140091 19:47644439-47644461 GGGGAAGGAGGGAGGGAGGGAGG - Intronic
1167153677 19:47725119-47725141 GAGGCATGTGGCAGGCTTGGGGG + Intronic
1167294249 19:48640027-48640049 GGGTGAGGTGGGAGGAATTGGGG + Intronic
1167465440 19:49648544-49648566 GGGGGGTGTGGCAGGCATGGTGG - Intronic
1167643861 19:50695459-50695481 GGGGGAGGGGCGAGGCTTGGAGG + Intronic
1167665485 19:50820945-50820967 GGGGCAGGTGGGGAGGGTGGGGG + Intronic
1167900911 19:52621653-52621675 GGGGGAAGTAGGAGGAATGGAGG - Intronic
1168404366 19:56103088-56103110 GGGTCAGGTGGGAGGCAGCGGGG + Intronic
1168405551 19:56108440-56108462 GAGGCAGCTGGGAGGACTGGAGG - Intronic
1168406981 19:56115640-56115662 GGTGCGGGTGGGAGGCATGCGGG - Intronic
1168469763 19:56630508-56630530 GGGTGAGGTAGGAGTCATGGAGG + Intergenic
1168507327 19:56947293-56947315 GGGGCAGGAGGAAGAGATGGGGG + Intergenic
1168563500 19:57403594-57403616 GGGGCTGGTGGAAGGCAGGAGGG - Intronic
1168627084 19:57927833-57927855 TGCACAGGTGTGAGGCATGGGGG - Exonic
925017599 2:543669-543691 GGGGAGGGTGGGAGGCAGGCAGG + Intergenic
925017613 2:543715-543737 TGGGAAAGTGGGAGGCAGGGAGG + Intergenic
925017660 2:543845-543867 TGGGAAAGTGGGAGGCAGGGAGG + Intergenic
925017668 2:543868-543890 CGGGAAGGTGGGAGGCAAGGAGG + Intergenic
925017677 2:543891-543913 CGGGAAGGTGGGAGGCAGGGAGG + Intergenic
925147664 2:1591849-1591871 GGGGCAGGTGGAGGGGCTGGAGG + Intergenic
925166098 2:1716608-1716630 GGGGCAAGGGGTTGGCATGGAGG + Intronic
925356743 2:3246967-3246989 GGGGAAGGAGGGAGGGAGGGAGG + Intronic
925356884 2:3248037-3248059 GGGCCTGGTGGGAGGTATTGGGG + Intronic
925419825 2:3703332-3703354 CGGGCAGGTGAGGGGCGTGGCGG - Intergenic
925448235 2:3946259-3946281 GGGGCAGGGGCCAGGCCTGGAGG + Intergenic
925737335 2:6975308-6975330 GGACCCGGTGGGAAGCATGGGGG - Intronic
925836104 2:7948576-7948598 GGGGCATGTAATAGGCATGGCGG - Intergenic
926679530 2:15653199-15653221 AGGGCAGCAGGGAGGCTTGGAGG - Intergenic
927194448 2:20538103-20538125 TGGTCAGCTGGTAGGCATGGAGG - Intergenic
927331245 2:21866566-21866588 GGGGCAGGGTGGGGGCATCGGGG + Intergenic
927343537 2:22010017-22010039 GGGCCTGGTGGGAGGCATTTAGG + Intergenic
927709036 2:25313958-25313980 GGGGCCGCTGGAGGGCATGGCGG + Exonic
927826526 2:26313345-26313367 GGGGCACGTGGGCAGCAGGGTGG + Intronic
927861148 2:26561053-26561075 CAGGCAGGTGGAAGGCAGGGTGG + Intergenic
927868129 2:26606030-26606052 AGGGCAGGGGGGAGGCGCGGGGG + Intronic
928105596 2:28468732-28468754 GGGGGAGGAGGGAGGGAAGGGGG + Intronic
928593923 2:32842919-32842941 GGGGCAGGTGGGTGGCGGGGCGG - Intergenic
928778154 2:34790969-34790991 GGGGGAAGAGGGAGGAATGGAGG - Intergenic
929471320 2:42196848-42196870 AGGGCAGGGTGGAGGCAGGGTGG - Intronic
929537022 2:42790146-42790168 AGCCCAGCTGGGAGGCATGGAGG + Intronic
929574064 2:43041338-43041360 GGGGCAGGAAGGTGGCAGGGAGG - Intergenic
929628468 2:43434453-43434475 GGTACAGGTTGGGGGCATGGCGG - Intronic
929668208 2:43850069-43850091 GGGTGTGGTGGCAGGCATGGTGG + Intronic
929773828 2:44915403-44915425 AGGGAAGGATGGAGGCATGGGGG + Intergenic
930019877 2:46995052-46995074 GGGGCAGAAGGCTGGCATGGTGG + Intronic
930118465 2:47740196-47740218 GGGCCTGGTGGGAGGCATTTGGG - Intronic
930609058 2:53521443-53521465 GGGACAGGGGCCAGGCATGGTGG + Intergenic
930637190 2:53819635-53819657 GGCGGGGGTGGGAGGCAAGGGGG + Intergenic
930680322 2:54250460-54250482 AGGGCAGGTGGGTGGGGTGGGGG + Intronic
930864063 2:56105621-56105643 GTGGCATGTGGGAGGAAAGGTGG + Intergenic
931014809 2:57964437-57964459 GGTGGAGGTGGAAGGGATGGAGG + Intronic
931220802 2:60286295-60286317 GGGGGAGGAGGGAGACATGTAGG - Intergenic
931746175 2:65293678-65293700 GAGGCAGGTGGGAGGATAGGCGG + Intergenic
931838885 2:66128332-66128354 CAGGCAGGTGGGCAGCATGGTGG - Intergenic
931842921 2:66173438-66173460 GGGTGAGGTGGGAGGGAAGGGGG + Intergenic
932435200 2:71699317-71699339 GGGGGAGGAGGGAGGAAAGGGGG - Intergenic
932457241 2:71857591-71857613 GGGGTAGGAGGGAGGGGTGGTGG - Intergenic
932459383 2:71872599-71872621 GGGGCTGGTGTCAGGCAGGGCGG + Intergenic
932481243 2:72040694-72040716 TGGGCAGTAGGGAGCCATGGTGG - Intergenic
932498038 2:72157017-72157039 GGGGCAGGTGGTAGGGAGCGAGG + Intergenic
932557331 2:72836119-72836141 GGGGCAGGTAGAAGGCATTGGGG - Intergenic
932791397 2:74656807-74656829 GGGTGAGTTGGGAGACATGGGGG + Intronic
932866340 2:75347086-75347108 GAGGCAGGTGGGAGGAAGAGAGG - Intergenic
933126853 2:78619821-78619843 GGGGGAGGGGGGAGGCGTGAGGG - Intergenic
933729171 2:85444513-85444535 AGGGCTGGTGGGGGGCATCGGGG - Intergenic
933779843 2:85794049-85794071 AGGGCTGGGGGGAGGCAGGGAGG - Intergenic
933990905 2:87633205-87633227 AGGGCAGGTGGGTGGGATGTCGG + Intergenic
934112448 2:88756336-88756358 GGGTCAGGGAGGAGGCAGGGTGG - Intergenic
934158682 2:89227607-89227629 GGGCCTGGTGGGAGGTTTGGGGG + Intergenic
934208592 2:89954820-89954842 GGGCCTGGTGGGAGGTTTGGGGG - Intergenic
934557998 2:95297489-95297511 GGGGTCGGGGGGAGGAATGGAGG + Intronic
934753620 2:96810282-96810304 GGGCCAGATGGGAGGCAGGGTGG - Exonic
934857416 2:97737911-97737933 GAGGCAGGTGGGCGGTGTGGTGG + Intronic
935172435 2:100620853-100620875 GGGGCAGGAGGTACGGATGGGGG - Intergenic
935292558 2:101622522-101622544 GGGGGCGGTGGGTGGCAGGGGGG - Intergenic
935706498 2:105861920-105861942 CGGGCAGGAGGGAGGGAGGGAGG - Intronic
935968071 2:108501451-108501473 GGTGCAGTTGGGTGGGATGGTGG + Intronic
935979788 2:108615455-108615477 GGGTCGGGTGGGGGGTATGGTGG + Intronic
936091139 2:109502040-109502062 AGGCGAGGTGGGTGGCATGGGGG + Intronic
936163663 2:110102797-110102819 GGGTCAGGGAGGAGGCAGGGTGG - Intronic
936233574 2:110724954-110724976 GAGGAAGGAAGGAGGCATGGAGG + Intergenic
936282616 2:111155549-111155571 GGGGAAAGAGGGAGGCATGTTGG - Intronic
936302937 2:111317618-111317640 AGGGCAGGTGGGTGGGATGTCGG - Intergenic
936397858 2:112142564-112142586 GGGTCAGGTGGGAGGCACTGAGG + Intronic
937125438 2:119472386-119472408 GGCCCAGGTGGGAGGCAGGATGG + Intronic
937275077 2:120679071-120679093 GGGGCAGGTGGGTGGAAACGAGG - Intergenic
937615856 2:123921425-123921447 AGGGAAGGAGGGAGGGATGGAGG + Intergenic
938027816 2:127965500-127965522 GGGGCAGGGAGTGGGCATGGTGG + Intronic
938063668 2:128269899-128269921 GGTGGGGGTGGGGGGCATGGAGG + Intronic
938102309 2:128505355-128505377 GTGACAGGTGGGAGGCAGGATGG + Intergenic
938104248 2:128519569-128519591 AGGACTGGTGGGAGGCAAGGGGG - Intergenic
938146412 2:128838381-128838403 GGGGCAGTTAGGAGGCAGAGGGG + Intergenic
938242768 2:129756080-129756102 CGGGCACGGGGGAGGCATGAAGG + Intergenic
938292616 2:130158168-130158190 GGAGCAGGTGGGAGGAATTGGGG - Intronic
938463937 2:131514803-131514825 GGAGCAGGTGGAAGGAATTGGGG + Intergenic
938598291 2:132811603-132811625 GGGGCAGGGGGCAGGGTTGGGGG - Intronic
938655819 2:133432446-133432468 GGAGCATTTGGGTGGCATGGAGG - Intronic
938911463 2:135889252-135889274 TAGGCAGGTGGCAGGGATGGAGG - Intergenic
939162283 2:138604768-138604790 GGAGGAGGAGGCAGGCATGGTGG + Intergenic
940015066 2:149095691-149095713 GGTGCAGGTGTGATGCAAGGGGG + Intronic
940207039 2:151214264-151214286 GAGGCTGGTGGGAGGCAGGTGGG + Intergenic
942364718 2:175212770-175212792 GGGCCTGGTGGGAGGCATTTGGG + Intergenic
942549633 2:177101717-177101739 GGGGCAGGTGGGGTGTATCGGGG + Intergenic
942951666 2:181728810-181728832 GAGGCTGATGGGAGCCATGGAGG - Intergenic
943931778 2:193863935-193863957 GGGGCAGGTGCGAGTCATTCAGG - Intergenic
944412601 2:199458340-199458362 GGGGCGGGTGGGAGGCAGGGAGG + Intronic
945019503 2:205556998-205557020 GGGCCAGGTGGGAATGATGGAGG - Intronic
945094871 2:206209532-206209554 GGGGCATGTGGGAGGGCTAGGGG - Intronic
945410574 2:209501447-209501469 GGGGCAGGAGTGTGGCAAGGGGG + Intronic
945431638 2:209771916-209771938 GGGGGAGGGGAGAGGCACGGGGG + Intergenic
945493097 2:210478896-210478918 GGGGGAGGAGGGAGGGAGGGAGG - Intronic
945814625 2:214589271-214589293 AGGACAGGTGTGAGGCATGTGGG - Intergenic
945881381 2:215328400-215328422 GGGGCAGATAGGAGGCAGGCAGG - Intronic
945923388 2:215778934-215778956 GAGACAGGTGGGAGGCAGGCAGG - Intergenic
946153607 2:217792703-217792725 TGGGGAGGTGGGAGGGTTGGGGG - Intergenic
946202302 2:218077629-218077651 GGGGCAGGTGTTAGCCATGTGGG - Intronic
946202805 2:218080758-218080780 GCAGCAGGTGGGAGGGAGGGAGG - Intronic
946333795 2:219024471-219024493 GGGGCGGGGGGGGGGCAGGGGGG + Intronic
946422586 2:219572864-219572886 ATGGCAGGTGGGAGGCATTTGGG + Intronic
946519059 2:220446568-220446590 GGGGAAGGGGGGAGGAAGGGAGG - Intergenic
946834951 2:223763501-223763523 GGGGCAGGTGGAGGGGGTGGAGG - Intronic
947113191 2:226742172-226742194 GGGACAGCTGGGAAGTATGGGGG + Intronic
947344764 2:229179275-229179297 GGGGCTGATGGGAGCCATGGAGG - Intronic
947534103 2:230930052-230930074 GGCCCAGGTGGGAGGCGGGGGGG - Intronic
947569597 2:231221914-231221936 GGTGGGGGTGGGAGGCATGGAGG + Intronic
947586825 2:231361691-231361713 GGGGCAGCTGGCATGCCTGGTGG - Intronic
947620603 2:231588199-231588221 GGGGAAGGAGGGAGGGAGGGAGG + Intergenic
947661194 2:231869958-231869980 GGGGGAGGGGGGAGGGAAGGAGG - Intergenic
947841691 2:233211877-233211899 GTGGCAGGTGGCAGGGCTGGGGG - Intronic
948021318 2:234736059-234736081 ATGGCAGGTGGGAGGTAAGGAGG - Intergenic
948141785 2:235678723-235678745 GGGGCGGGAGGGAGGCAGGCAGG - Intronic
948356757 2:237384439-237384461 GGTGCAGGGATGAGGCATGGAGG - Intronic
948503433 2:238411245-238411267 GGGGCAGGTGGGGGGCGTCAAGG + Intergenic
948695301 2:239730128-239730150 GGTGCAGGAGGCAGGCTTGGAGG + Intergenic
948765035 2:240215230-240215252 GCAGCAGGTGGAAGGCCTGGTGG + Intergenic
948830980 2:240598156-240598178 GGGGCAGGCAGGAGACGTGGGGG - Intronic
948857589 2:240737206-240737228 GGGGCAGGTGGGACCCTGGGGGG + Intronic
948911045 2:241002861-241002883 GGGAGAGGAGGGAGGCATTGGGG - Intronic
949028096 2:241775641-241775663 ACGGCAGGTGGGAGGGATGCCGG - Intergenic
949048907 2:241886521-241886543 GGGGCAGGTGGCAGACCTCGGGG + Intergenic
1168847463 20:955180-955202 GGTGAGGGTGGGAGTCATGGGGG + Intergenic
1169075992 20:2760076-2760098 GAGGCAGGTGAGAGGCCGGGCGG - Exonic
1169144094 20:3241115-3241137 GAGGCAGGTGGGAGGACTGAAGG - Intergenic
1169194438 20:3675598-3675620 AGGACAGGTGGGAGGTATGTGGG - Intronic
1169447774 20:5686886-5686908 AGCGCAGGTGGGAGGCATATGGG + Intergenic
1170129141 20:13000261-13000283 GGCACAGGTGGGTGGCAGGGAGG + Intergenic
1170813910 20:19696932-19696954 GGGGAAGGAGGGAGGGAGGGAGG + Intronic
1170950743 20:20933713-20933735 AGGGAAGGTGGGAGGCAGCGAGG + Intergenic
1171077839 20:22147254-22147276 ATGGCAGGTGGGAGGCCTGGGGG - Intergenic
1171136965 20:22703425-22703447 GGGGGAGGAGGGATGAATGGTGG - Intergenic
1171467388 20:25339655-25339677 ATGTCAGGTGGGGGGCATGGTGG - Intronic
1171488494 20:25500385-25500407 GGGGTAAGTGGGCGCCATGGGGG + Intronic
1171823195 20:29874214-29874236 GGGGCGGTTGGGAAGCACGGAGG - Intergenic
1171905976 20:30899928-30899950 GGGGCAGGGTGGGGGCAGGGCGG - Intergenic
1172167792 20:32909485-32909507 GGGGCAAGGGGGAGGCAGGGAGG + Intronic
1172221359 20:33277059-33277081 GGGGCGGGTGGCAGGGAAGGTGG - Intronic
1172221376 20:33277100-33277122 GGGGCGGGTGGCAGGGAAGGTGG - Intronic
1172221393 20:33277141-33277163 GGGGCGGGTGGCAGGGAAGGTGG - Intronic
1172221444 20:33277264-33277286 GGGGCGGGTGGCAGGGAAGGTGG - Intronic
1172221461 20:33277305-33277327 GGGGCGGGTGGCAGGGAAGGTGG - Intronic
1172221478 20:33277346-33277368 GGGGCGGGTGGCAGGGAAGGTGG - Intronic
1172221495 20:33277387-33277409 GGGGCGGGTGGCAGGGAAGGTGG - Intronic
1172346212 20:34202760-34202782 GGGGAAGATGAGAGGCATGAAGG - Intronic
1172751728 20:37256206-37256228 GAGACACGTGGTAGGCATGGAGG + Intronic
1172843599 20:37916351-37916373 AGAGCAGGTGGGAGGGAGGGAGG - Intronic
1173231779 20:41204148-41204170 GGGGCCCGTTGGCGGCATGGGGG + Exonic
1173249047 20:41354920-41354942 GGTGCAGGTGGGTGGCAGGGAGG + Intronic
1173305231 20:41841334-41841356 AGGGAGGGTGGGAGGAATGGAGG - Intergenic
1173513701 20:43650029-43650051 AGGGGAGGTGGGAGGAAAGGGGG + Intergenic
1173523197 20:43713914-43713936 GGAGGCGGTGAGAGGCATGGCGG + Intronic
1173579200 20:44135014-44135036 GGGGTAGGGGGGATGCCTGGGGG + Intronic
1173772204 20:45670496-45670518 GGGGCAGGGGGGAGGGGGGGTGG - Intergenic
1173817675 20:46000267-46000289 GGGGCGGGTGAGATTCATGGGGG - Intergenic
1173940781 20:46909351-46909373 GGTGCAGGTGGGAGGCAGTAAGG + Intronic
1174196069 20:48773774-48773796 GGGTAAGGTGGGAGCCATGGAGG + Intronic
1174200689 20:48804574-48804596 GGGTGAGGTGGGAGGCAGCGGGG + Intronic
1174289876 20:49500492-49500514 GGAGCAGGAGGGAGGCAGTGTGG - Intergenic
1174292958 20:49521941-49521963 GGGTCAGGTGGTGGCCATGGAGG - Intronic
1174330509 20:49813414-49813436 TGGGCAGGTGGTAGGAAAGGAGG + Intronic
1174397034 20:50253094-50253116 GGGCCAGGAAGGAGACATGGAGG + Intergenic
1174410325 20:50330889-50330911 GGGGCATGATGGAGGCATGGTGG + Intergenic
1174421267 20:50400554-50400576 GGGGTAGGTGAGAGCCATGGAGG + Intergenic
1174546960 20:51332831-51332853 GGGGCAGGGGCCAGGCACGGTGG - Intergenic
1174567387 20:51475386-51475408 GGGGCAGGTGGCAGGGATTTGGG - Intronic
1174985739 20:55449634-55449656 GGAACAGGTGGGAGGCAGGATGG + Intergenic
1175173403 20:57094770-57094792 GGGGCAGGTGGGAAGTAAGTAGG + Intergenic
1175388507 20:58612142-58612164 GGGGAAGGAGGGAGGGAGGGAGG - Intergenic
1175398517 20:58685006-58685028 GGGGCTGGGGCCAGGCATGGTGG - Intronic
1175400029 20:58694639-58694661 CGGGCAGGTGGGAGGGAGGTCGG + Intronic
1175406945 20:58741163-58741185 GGTGCGGGTGGGTGGCGTGGGGG - Intergenic
1175491703 20:59384432-59384454 GGGGGAGGTGGGGGGGAAGGAGG + Intergenic
1175828758 20:61950945-61950967 AGGGCTGGTGGGAGGGAGGGTGG - Intergenic
1175839019 20:62015004-62015026 TGGGCTGGTTGGGGGCATGGGGG - Intronic
1175858227 20:62134067-62134089 GGGGCAGGAGGGAGGCTGAGTGG + Intronic
1175870210 20:62205804-62205826 GGTGGAGGTGACAGGCATGGCGG - Intergenic
1175903973 20:62370912-62370934 GAGGCAGGTGGCAGCCCTGGGGG - Intergenic
1175968901 20:62674043-62674065 GGGGCAGGAGGGAATCAGGGTGG + Intronic
1175988142 20:62774519-62774541 TGGGCTGGCGGGAGGCATGGAGG + Intergenic
1175988548 20:62776440-62776462 GGGACAGGTGTGTGGGATGGAGG - Intergenic
1176027464 20:62993382-62993404 GGGGAGGCTGGGAGGCAGGGAGG + Intergenic
1176030412 20:63008711-63008733 AGGGCTGGTGGGGGCCATGGGGG + Intergenic
1176051108 20:63120192-63120214 GGGGCAGCTGGGAGCCTGGGAGG - Intergenic
1176126015 20:63475123-63475145 GGGACAGGGGGCAGGCATGCGGG - Intergenic
1176143885 20:63557006-63557028 GGGGATGGTGGGAGGCATCACGG - Intergenic
1176179421 20:63742455-63742477 GGGGAAGGCAGGCGGCATGGAGG - Exonic
1176295259 21:5068767-5068789 GGGGCAGGGGGGAGGCCTCCTGG - Intergenic
1176300384 21:5096380-5096402 GTGGCAGGCGGGTGGCATGAGGG - Intergenic
1178507137 21:33171425-33171447 GGGACAGGTGGGAGGAATACGGG - Intergenic
1178690658 21:34746983-34747005 AGGGCAGATGGGAGGGAGGGAGG - Intergenic
1178742952 21:35220219-35220241 GGGCCTGTTGGGAGGCAGGGTGG + Intronic
1179007670 21:37529482-37529504 AGGGAGGGAGGGAGGCATGGAGG + Intergenic
1179176343 21:39010766-39010788 GGAGCTGGAGGGAGGCCTGGGGG - Intergenic
1179476998 21:41653354-41653376 GGGGCTGGGGGAAGGAATGGTGG - Intergenic
1179514759 21:41898919-41898941 GGGGCAGGGGTGAGGCTGGGAGG + Intronic
1179633066 21:42690676-42690698 GAGGCAGGCTGGAGGCAGGGAGG - Intronic
1179788725 21:43743553-43743575 GGGGCAGGGGGGAGGGAGGTGGG - Intronic
1179861790 21:44193361-44193383 GGGGCAGGGGGGAGGCCTCCTGG + Intergenic
1179907951 21:44433929-44433951 GGGGCTGGGTGGAGGCAGGGAGG + Intronic
1179978010 21:44881647-44881669 GGGTCTGGGGTGAGGCATGGAGG + Intergenic
1180085818 21:45507417-45507439 GGGGCAGGTGCTGGGCAGGGAGG + Intronic
1180101690 21:45590615-45590637 GAGGCGGGGCGGAGGCATGGGGG + Intergenic
1180258310 21:46649368-46649390 GGGGCAGTTGGGAGGGTTAGAGG + Intronic
1180487587 22:15816777-15816799 GGGGCAGGCGGCAGGCAGTGGGG + Intergenic
1180581919 22:16845982-16846004 GGGGCAGGCGTGGGGCAGGGAGG - Intergenic
1181039269 22:20184281-20184303 AGGGCCTGTGGGATGCATGGGGG - Intergenic
1181283438 22:21735896-21735918 GGGGCAGGCGGGACGCGGGGCGG - Intergenic
1181412012 22:22730767-22730789 GGGCACTGTGGGAGGCATGGAGG - Intergenic
1181548262 22:23617801-23617823 GGAGCAGGCATGAGGCATGGAGG + Intronic
1181636968 22:24178960-24178982 GGGGCAGCTGAGAGGCTGGGAGG + Intergenic
1182043865 22:27259385-27259407 GAGGCAGGAGGAAGGCAGGGTGG - Intergenic
1182145419 22:27994154-27994176 GCGGCAGCTGAGAGGCGTGGTGG + Intronic
1182192426 22:28476132-28476154 GAGGCAGGTAGATGGCATGGGGG - Intronic
1182351348 22:29701788-29701810 GGTGCAGGTGGAGGGGATGGAGG - Intergenic
1182459220 22:30472207-30472229 GAGGCAGCTGGGAGGAAGGGAGG + Intergenic
1182618624 22:31605464-31605486 GGGGCATGTGGGAGGACTGCTGG - Intronic
1183330250 22:37216182-37216204 TGGGGGGGTGGGAGGGATGGGGG - Intergenic
1183362331 22:37389253-37389275 GGGGCCAGTGGGAGCCATTGTGG - Intronic
1183398635 22:37588014-37588036 GGGGCAGGAGGGATGGAGGGAGG - Intergenic
1183432190 22:37772574-37772596 GGGGCAGGAGGCAGGTATGAGGG - Intronic
1183477061 22:38041440-38041462 GGGGCAAGTGGAAGGCTTGTGGG + Intronic
1183511367 22:38237090-38237112 GGGGCAGCTGAGAGGCTGGGTGG - Intronic
1183638930 22:39081764-39081786 AAAGCAGGTGGGAGGCAGGGAGG - Intronic
1183663327 22:39233995-39234017 TGGGCAGGCGGGAGCCACGGAGG + Intronic
1183744673 22:39685735-39685757 GGGGGAGGTGGGAGCCGTGGAGG - Intronic
1184453688 22:44597447-44597469 GGGGCTGGTGCGGGGCCTGGGGG - Intergenic
1184493721 22:44825424-44825446 GGGGCAGCTGGCAGCCACGGAGG - Intronic
1184562573 22:45271935-45271957 GGGGAGGCTGGGAGGCATGAAGG - Intergenic
1184648823 22:45910382-45910404 GTGGCAGCTGGGAGACACGGTGG + Intergenic
1184694785 22:46133271-46133293 GGGGCAGATGGCTGGCATGCTGG + Intergenic
1184736031 22:46398276-46398298 GGGGCAGGTGGCTGGCATGGCGG + Intronic
1184751225 22:46487751-46487773 GGTGCAGGTGGGAGGTATTGGGG + Intronic
1184776466 22:46625951-46625973 GGAGGAGGAGGCAGGCATGGGGG + Intronic
1184796811 22:46737838-46737860 GGGGCAGGCGGGAGGGAGGCCGG - Intronic
1184814113 22:46857657-46857679 GGGGCAGGGGGAAGGATTGGGGG - Intronic
1184818816 22:46893341-46893363 GAGGCAGGCGGGATGGATGGAGG + Intronic
1184852936 22:47131158-47131180 GGGCCTGGTGGGAGGCATCTGGG - Intronic
1184866704 22:47205466-47205488 GGGGAAGGAGGGTGACATGGGGG - Intergenic
1184893443 22:47393318-47393340 GCTGGAGGTGGAAGGCATGGGGG + Intergenic
1184987572 22:48146030-48146052 GAGGCAGGAGGGAGGCAGGAAGG - Intergenic
1185092097 22:48781451-48781473 GGGGGAGGAGAGATGCATGGTGG + Intronic
1185175183 22:49322411-49322433 GGTGCAGGGGGCAGGGATGGGGG + Intergenic
1185269547 22:49922780-49922802 GTGGGGGGTGTGAGGCATGGGGG + Intronic
1185337149 22:50275843-50275865 GGGGCAGGTGGGGTGCTGGGCGG - Intronic
1185337565 22:50277556-50277578 GGGGCAGGTCTGGGGCAGGGAGG - Intronic
1185373838 22:50473145-50473167 AGGCCAGGTGGGAGGCGTGGTGG - Intronic
949367529 3:3299324-3299346 AGGGCAGTTGGAAGGCAAGGAGG - Intergenic
949404603 3:3701150-3701172 GAGGCAGGAGGAAGGCATGATGG - Intronic
950170322 3:10834671-10834693 GGGGCAGATGGAAGACATGCAGG + Intronic
950257297 3:11515971-11515993 AGGGCAGGGTAGAGGCATGGGGG + Intronic
950543437 3:13625523-13625545 GGGGAAGGTGGGAGCCCTGCTGG - Intronic
950557128 3:13702628-13702650 GGGGCAGGTGGAAGGGACTGAGG + Intergenic
950563398 3:13749091-13749113 GAGGAAGGTGGGAGCCATGGAGG - Intergenic
950664094 3:14484428-14484450 GGGGAAGGTGGGAGCCATGGAGG + Intronic
950675688 3:14553009-14553031 GGGAGAGGAGGGAGGCAGGGTGG - Intergenic
950768024 3:15288415-15288437 GAGGCAGTAGGGAGGGATGGAGG + Intronic
951054051 3:18126874-18126896 GGTGCAGATGTGAGGCATGAAGG + Intronic
951353952 3:21641375-21641397 GGGGGAGGTGAGAGGTATGTGGG + Intronic
951703878 3:25524621-25524643 GAGGAAGGAGGGAGGCAGGGAGG - Intronic
952254321 3:31682387-31682409 GGGGCAGGTGGAGGTCAGGGAGG - Intronic
952419387 3:33117750-33117772 GGAGAAGGTGGTAGGGATGGAGG - Intronic
952879309 3:37973427-37973449 GGGGCAGGTGGGAGCCATCCAGG - Intronic
952882678 3:37994485-37994507 GGGGCAGGAGGGAGCCGTGGAGG + Intronic
952969019 3:38639025-38639047 GGGTGAGGTGGGAGGCCAGGCGG - Intronic
953024117 3:39135012-39135034 GGGGGAGGCGGGGGGTATGGGGG - Intronic
953387516 3:42514937-42514959 TGGGAAGGTGGGAGGCACTGAGG + Intronic
953927347 3:46989209-46989231 GAGGCAGGCGGTAGCCATGGCGG + Intronic
954359966 3:50116470-50116492 GGGGCAGGTTGGCGGCCAGGTGG + Intronic
954378020 3:50205157-50205179 GGGGCTGGTCGGGGGAATGGCGG - Intergenic
954388019 3:50254593-50254615 GGGGCAGTGGTGAGGCCTGGGGG - Intronic
954397988 3:50303120-50303142 AGGGCAGGGGAGACGCATGGAGG + Exonic
954424086 3:50434274-50434296 GGGGCAGGGGGGCGGCACTGAGG - Intronic
954631843 3:52052008-52052030 GGGGAAGCTGGGAGGGTTGGAGG - Intronic
955747646 3:62155894-62155916 GGGGCTGGTGGAAGCCATGAAGG + Intronic
955885799 3:63596678-63596700 GAGGAATGTGGGAGGCATGCTGG + Intronic
957194601 3:77051324-77051346 CAGGGAGGTGGGAGGCAAGGGGG - Intronic
958888185 3:99752674-99752696 GGGGCATGTGGGGGGCGTGAGGG - Intronic
959022040 3:101198308-101198330 GGGGGAGGGGGGAGGGGTGGGGG - Intergenic
959383990 3:105678526-105678548 GGGGGAGGTGGGAGAGATGGAGG + Exonic
960035371 3:113097187-113097209 GTGGCAGGTGGTGGGCAAGGGGG - Intergenic
960637269 3:119796029-119796051 GGGGAAAGTGAGAGGCAGGGAGG - Intronic
961035480 3:123638728-123638750 GAGGCAGGAGGGAGGAACGGTGG - Intronic
961056660 3:123794401-123794423 AGGGAAGGAGGTAGGCATGGGGG + Intronic
961522492 3:127475135-127475157 GGTGCCTGTGGGAGGCATGTTGG + Intergenic
961658908 3:128458023-128458045 GCTGGAGGTGGGAGGCAGGGTGG + Intergenic
962016084 3:131441915-131441937 GGGACAGGTGGGAGGATTGGCGG - Intergenic
962364022 3:134765484-134765506 GGGGAAGGGAGGAGGCATGTAGG + Intronic
963061455 3:141230418-141230440 GGGCCAGGTGGGAGAGTTGGGGG + Intronic
963383840 3:144565935-144565957 TGGAGAGGTGGGAGGCATGGGGG - Intergenic
963602657 3:147391441-147391463 GAGGAAGGCGGGAGGGATGGAGG - Intronic
964609653 3:158598314-158598336 GGGACAGGAGGGAGGTGTGGGGG + Intronic
964623761 3:158739591-158739613 GTGGGAGGTGGGAGGCAGTGGGG + Intronic
964669582 3:159210066-159210088 GGGACAGTTGGGTGGCCTGGAGG + Intronic
964707523 3:159635316-159635338 GGGAGAGGTGGTAGGGATGGGGG + Intronic
965045887 3:163576532-163576554 GGGGGAGGGGGGAGGCAGGGAGG - Intergenic
965526040 3:169719439-169719461 GGAGCCTGTGGGAGGCAGGGCGG - Intergenic
965942465 3:174201329-174201351 AGGGAAGGTGGGAGGAATGAAGG + Intronic
966926048 3:184645309-184645331 GGGGCAGGTGGAAGGCCTGGTGG - Intronic
966973925 3:185069037-185069059 GGGGCATGTGGCAGGGACGGTGG + Intergenic
967033701 3:185631579-185631601 GGGGAAGGGGGGAGGGAGGGTGG - Exonic
967203364 3:187095375-187095397 GGGACAGGTGTGAGGCTGGGAGG + Intergenic
967386127 3:188912736-188912758 GGGGCAGGAGGGAGAGAGGGGGG + Intergenic
967727968 3:192879608-192879630 GTGGCAGGTTGGAAGCAGGGAGG + Intronic
967970240 3:194994148-194994170 GGGGCAGCTGGGAGGCAGCGAGG - Intergenic
967984819 3:195086950-195086972 GGTACAGGTGGGAGGTATCGGGG - Intronic
968091623 3:195901581-195901603 TGGGCATGTGGGGTGCATGGTGG - Intronic
968112825 3:196063462-196063484 GAGGGAAGTGGGAGGGATGGAGG - Intronic
968183666 3:196616023-196616045 GGGGAGGGTGGGAGGGATGAGGG - Intergenic
968356022 3:198108054-198108076 GGGGAAGGAGGGAGGGAGGGCGG + Intergenic
968641439 4:1716931-1716953 GGGGCAGGAGGGAGGCAAAGAGG + Exonic
968716710 4:2165411-2165433 GGGGCTGGTGGGAGGGAGGGAGG + Intronic
968763083 4:2452340-2452362 GGAGCAGGTGGGTGCCATGCAGG + Exonic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968894053 4:3388563-3388585 GGGGTGGGTGGGAGCCAGGGTGG - Intronic
968946371 4:3666746-3666768 GGGGCCGGTGGGAGGCTTCCTGG + Intergenic
969161366 4:5262059-5262081 GGGGAAGGAGGGAGGCACGACGG - Intronic
969235908 4:5864954-5864976 TGGGCTGGGGGGAGGCAGGGAGG + Intronic
969263197 4:6046569-6046591 GGGGCAGGCGGGCGGCAGTGGGG + Intronic
969265618 4:6062332-6062354 GGAGCAGGTGGGAGGCACGCTGG - Exonic
969312848 4:6364136-6364158 GGGGCTCGAGGGAGTCATGGAGG + Intronic
969617495 4:8262190-8262212 GGGGCAGGGGTGAAGCAGGGGGG + Intergenic
969684897 4:8665928-8665950 GGAGCAGGTGGGAGGAGGGGTGG - Intergenic
969710532 4:8840650-8840672 GGGCCAGGTGGAAGACAAGGGGG - Intergenic
969721610 4:8895404-8895426 GGGGCAGGGGAGGGGCAGGGAGG + Intergenic
969758752 4:9167559-9167581 GGGGTGGGTGGGAGGCAAGCTGG - Intergenic
969818718 4:9705022-9705044 GGGGTGGGTGGGAGCCCTGGTGG - Intergenic
969858396 4:10018004-10018026 AGGGCAGGTTGGAGGCTTGAGGG - Intronic
969885217 4:10209324-10209346 GGGGCAAGAGGGTGGGATGGGGG + Intergenic
969978241 4:11126923-11126945 GGTGCAGGGGCCAGGCATGGTGG + Intergenic
970137872 4:12945818-12945840 AGGGAAGGAGGGAGGGATGGAGG + Intergenic
970192338 4:13528535-13528557 GGGTGAGGAGGGAGGAATGGGGG + Intergenic
970360493 4:15304148-15304170 GAGGCAGCAGGTAGGCATGGTGG + Intergenic
970870402 4:20810443-20810465 AGGGCAGGGGGGAGGAAGGGGGG + Intronic
971045533 4:22801583-22801605 GGGAAAGGTTGGAGGCAGGGAGG - Intergenic
972420152 4:38879233-38879255 GGTGCAGGAGGGAGGAATTGGGG + Intronic
972505752 4:39718599-39718621 GGGGCAGGACTCAGGCATGGCGG + Intronic
972543233 4:40057037-40057059 GCGGCGGGTGGGAGGCAGGGAGG + Intronic
972731364 4:41798478-41798500 GGGCCAGGTGGGAGGCAGACTGG + Intergenic
972924222 4:43983829-43983851 AGGGAAGGAGGGAGGCAGGGAGG + Intergenic
972940946 4:44194756-44194778 GGGGAGGGTGGGAGGGAGGGAGG - Intronic
973626602 4:52778790-52778812 GCTGGAGGTGGGAGGCCTGGTGG - Intergenic
973895652 4:55410075-55410097 AAGGCTGGTGGGAGGCAAGGAGG - Intronic
975137309 4:70887490-70887512 GGGGCGGGGGGTAGGCATTGGGG - Intergenic
975549478 4:75596513-75596535 GGGGCTGCTGGGAGGCATGAGGG - Intronic
976177965 4:82373585-82373607 CGAGCAGGAGGGAGCCATGGTGG - Exonic
976183004 4:82416846-82416868 GGGACAGGGGGCAGCCATGGTGG - Intergenic
976623789 4:87156397-87156419 GAGGCAGGTGGGGGTCGTGGGGG + Intergenic
976907858 4:90262761-90262783 GGGGCAGGAGTGAGGCTGGGAGG - Intronic
977472194 4:97455352-97455374 GGCACAGGTTGGAGGCATGGTGG - Intronic
977566596 4:98587000-98587022 CCGGCAGTTGGGAGGCAGGGTGG + Intronic
978141077 4:105318058-105318080 GGGCCTGGTGGGAGGCATTTGGG + Intergenic
978369785 4:108018605-108018627 GGGGCGGGTGGGAGGAGAGGAGG - Intronic
978705087 4:111698437-111698459 GGGGGAAGTGGGAGGGAGGGGGG + Intergenic
979295703 4:119030714-119030736 GGGGCAGGCTGGGGCCATGGAGG - Exonic
980035767 4:127881190-127881212 GGGGCGGGTGGGAGTAATTGTGG + Intronic
980562976 4:134501944-134501966 GGGGCAGGCGGGGGGCTGGGCGG - Intergenic
980562986 4:134501964-134501986 GGGGCAGGCGGGGGGGAAGGGGG - Intergenic
980562997 4:134501983-134502005 GGGGCAGATGGGGGGAAAGGGGG - Intergenic
980721075 4:136696582-136696604 GGGGCAGGTGGGGTGGGTGGGGG - Intergenic
981003670 4:139853398-139853420 AGGGCAGGTGGGGGGCCTGCAGG + Intronic
982063156 4:151624795-151624817 GGAGCAGAAGGGAGGCATAGGGG + Intronic
982094910 4:151912705-151912727 GAGGCAGGTGAGGGGAATGGAGG + Intergenic
982203099 4:152976964-152976986 GGGGAGGGTGGGGTGCATGGGGG - Exonic
982451004 4:155552341-155552363 GGGGGAGGGGGGTGGCACGGTGG + Intergenic
982816487 4:159891933-159891955 GGGGAAGGAGGGAGGGAGGGAGG - Intergenic
984157200 4:176207314-176207336 GCTGCAGGTGGCAGGGATGGAGG + Intergenic
984271844 4:177557463-177557485 GGTGCAGGATGGAGGCGTGGTGG - Intergenic
984278510 4:177638848-177638870 GGTGTGGGTGGGAGGCATGAAGG + Intergenic
984944331 4:184959514-184959536 GCTGCAGGTGGGAGGCAGTGGGG - Intergenic
984952488 4:185017858-185017880 GGGGCGGGTGGGAGGATTGGGGG - Intergenic
985009269 4:185565969-185565991 GGTGCAGGGGGAAGGCCTGGGGG + Intergenic
985522048 5:378536-378558 GGGGAAGGCCGGAGGCTTGGAGG - Intronic
985541314 5:488897-488919 GGGGCAGGTGGGAGGGCCGTTGG + Intronic
985631541 5:1016685-1016707 AGGGCAGGTGGGAGCCCTGGAGG - Intronic
985752341 5:1687757-1687779 GGGGCATGAGTGAGGCGTGGTGG - Intergenic
985777312 5:1851560-1851582 GGGGGAGGTGGGAGGAGAGGAGG - Intergenic
985995656 5:3595740-3595762 AGGGCGGGCGGGAGGCAGGGAGG + Intergenic
986127236 5:4894413-4894435 GAAGCGGGTGGGAGTCATGGGGG + Intergenic
986195766 5:5535390-5535412 TGGGGTGGTGGGAGGCAGGGAGG + Intergenic
986256730 5:6107164-6107186 GTGGTGGGTGGGAAGCATGGTGG - Intergenic
986369126 5:7062747-7062769 GGGGGAAGAGGGAGGAATGGAGG + Intergenic
986690218 5:10307806-10307828 GGTGGAGGAGGGAGGCCTGGGGG + Exonic
987089289 5:14497118-14497140 GGGGCTGGTGGGTGGGAGGGAGG - Intronic
987099214 5:14577513-14577535 GGGGCAGGGTTGGGGCATGGTGG - Intergenic
987300938 5:16597707-16597729 GGGGCATGTGGGAGACATGTTGG - Intronic
987355472 5:17059870-17059892 GGACCAGGTTGGTGGCATGGAGG + Intergenic
988421872 5:31015572-31015594 GGGGCGGGGGCGAGGCATGGAGG + Intergenic
988623634 5:32848433-32848455 GGGGAAGGAGGGAGGGAGGGAGG - Intergenic
989289546 5:39747355-39747377 GGCCCTGGTGGGAGGTATGGAGG - Intergenic
989382361 5:40822011-40822033 GGGCCAGGTGGGAGGTATTTGGG - Intergenic
989855983 5:46292004-46292026 GGGATACGTGGGAGCCATGGAGG - Intergenic
990446180 5:55896570-55896592 GGGGAAGGTGGGGGGAAGGGAGG - Intronic
990559888 5:56973348-56973370 GGGGGGTGGGGGAGGCATGGAGG + Intergenic
990755430 5:59064128-59064150 AGGGAAGGAGGGAGACATGGAGG + Intronic
990992970 5:61703057-61703079 TGGGCAGGAGACAGGCATGGAGG - Intronic
991491961 5:67192694-67192716 GGGCCTGGTGGGAGGCGTGTGGG - Intronic
991608802 5:68429369-68429391 GGGGCAGGATGGAGACATGGGGG - Intergenic
991659119 5:68932491-68932513 GGTGCAGGTGGGGCGCCTGGAGG - Intergenic
992249941 5:74866491-74866513 GGGGCTGGAGGGAGGCAGGGCGG - Intronic
992551765 5:77866272-77866294 GGGGCGGGTGGGAGGGAGGCAGG + Intronic
992886140 5:81162191-81162213 GGGGGTGGTGGGGGACATGGGGG + Intronic
993660193 5:90623698-90623720 GGGGCAGGGGGAAGGCATGGTGG - Intronic
993672394 5:90777181-90777203 GGAGCAGGTGGAAGGGGTGGAGG + Intronic
994146494 5:96401383-96401405 GGGGCAGGGGAGAGGCAGTGAGG + Intronic
994297004 5:98102547-98102569 GGGACAGGTTGGAGGAATGTTGG - Intergenic
994691632 5:103026839-103026861 GGGGAAGGTGGCAGGAATTGTGG + Intronic
994957201 5:106546997-106547019 GTATCAGGTGGGAGGGATGGAGG + Intergenic
995064414 5:107843876-107843898 GGGGCACGTGGGTTGCATAGTGG + Intergenic
997303830 5:132824622-132824644 GGGGCCCCTGGGAGGCATGGGGG + Exonic
997361720 5:133299470-133299492 CTGGCAGGTGGGAGGCAGGGAGG + Intronic
997476009 5:134142955-134142977 GGGGCAGGTGGGGTGCATCAGGG - Intronic
997739140 5:136238467-136238489 GGGGCAGGTCTGAGGCAAGCTGG - Intronic
997864302 5:137447633-137447655 GGGAGAGGTGGTAGGTATGGTGG - Intronic
997882791 5:137605160-137605182 GCAGCAGGTGGGGGGCGTGGAGG + Intergenic
998018417 5:138751259-138751281 GGGGCTGGTGGGAGGCATTTGGG - Intronic
998230232 5:140357125-140357147 TGGGGAGGGTGGAGGCATGGTGG + Intergenic
998256944 5:140595056-140595078 GGGGAAGCTGAGAGGCATAGAGG - Intergenic
998329030 5:141307040-141307062 GGGGAGGGTGGGAGGGATTGAGG + Intergenic
999201309 5:149818380-149818402 TGGGCAGGTGGTGGGCAGGGTGG + Intronic
999722827 5:154411547-154411569 GAGGAAGGGGAGAGGCATGGTGG + Intronic
1000171619 5:158708004-158708026 GGTGCAGGTGGGAGGTGGGGAGG + Exonic
1000419564 5:161022943-161022965 AGGGAAGGTGAGAGGGATGGAGG + Intergenic
1001035242 5:168292309-168292331 GGGGCAGGTGGGGGCCCAGGCGG - Intronic
1001085845 5:168699514-168699536 GGGGAAGGTGGGAAGCAGGAAGG + Intronic
1001097044 5:168783424-168783446 GGGGAAGATGGGAGGCAGGCAGG + Intronic
1001740713 5:174050869-174050891 GGGGCAGTGTGGAGGCTTGGCGG - Intronic
1001825739 5:174743451-174743473 GAGGGAGGTGGGAGGGAGGGAGG - Intergenic
1001860211 5:175047767-175047789 GGGGCAGGAGGGTGGCAGGACGG + Intergenic
1001862526 5:175070055-175070077 GGAGCAGGAGGGAGACAAGGGGG + Intergenic
1001929481 5:175662589-175662611 GGGGCAGAGGGGAAGCAGGGAGG - Intronic
1001945071 5:175771965-175771987 GTGCCAGGAGGGTGGCATGGTGG - Intergenic
1001965812 5:175909129-175909151 ATGGCAGGTGGGGGACATGGAGG - Intergenic
1001991314 5:176117888-176117910 GGCGCTGCTGGGAGGCATGTGGG + Intronic
1002066280 5:176653476-176653498 GGTGCAGGTGGGAGGCAGATAGG - Intronic
1002101659 5:176860901-176860923 TGGGCAGGAGGCAGGCAGGGAGG + Intronic
1002225561 5:177720248-177720270 GGCGCTGCTGGGAGGCATGTGGG - Intronic
1002251134 5:177930071-177930093 ATGGCAGGTGGGGGACATGGAGG + Intergenic
1002268288 5:178050957-178050979 GGCGCTGCTGGGAGGCATGTGGG + Intronic
1002316890 5:178349502-178349524 GGGCCAGGTGTGGGGCATGGGGG - Intronic
1002401186 5:178992315-178992337 TGTGCAGGTGGGAGGTATGCAGG + Intronic
1002455986 5:179345531-179345553 GAGGCAGGCGGGAGGGAGGGAGG + Intergenic
1002670937 5:180866563-180866585 GGGACAGCTGGGAAGCATTGGGG + Intergenic
1002794721 6:463265-463287 TGGCCAGGTGGGAGGCGTGAGGG + Intergenic
1002805860 6:573387-573409 GAGGCAGGTGGGAGGCAGCAGGG - Intronic
1003051283 6:2783124-2783146 GAGGCAGGAGGGAGGAAAGGTGG - Intronic
1003130977 6:3394992-3395014 CGGGCAGGTATGAGGCAGGGAGG + Intronic
1003483741 6:6556633-6556655 GGGGCAGATGGGATGGAGGGGGG - Intergenic
1003869651 6:10391366-10391388 GGGGCAGGTGGGACCCAGTGAGG + Intergenic
1003961164 6:11210744-11210766 AGGGAAGGAGGGAGGGATGGGGG + Intronic
1004194115 6:13488355-13488377 GGGGGAGGTGGGAGGCAGATGGG - Intergenic
1005870618 6:29972090-29972112 GGGGCAGGGGTGAGGAATAGGGG - Intergenic
1006093585 6:31642348-31642370 GGGGCAGGTGGTGGGGGTGGAGG + Exonic
1006099413 6:31676834-31676856 GTGGCTGGAGGGAGGCAAGGAGG + Exonic
1006174870 6:32115759-32115781 GGGGCTGGTGGGAGGCCTGGTGG + Exonic
1006426136 6:33964011-33964033 GGGACAGGTGGGAGGAAGTGAGG + Intergenic
1006440324 6:34049820-34049842 GGGGCGGGTGGTGGTCATGGAGG - Intronic
1006481412 6:34297506-34297528 GGGGCAGATGAGAGCCTTGGGGG + Intronic
1006599695 6:35217233-35217255 GGGGCGGGGGGGAGGCGCGGCGG + Intronic
1006632003 6:35436567-35436589 CCTGCTGGTGGGAGGCATGGAGG - Intergenic
1006723223 6:36174163-36174185 GGGGAAGGAGGGAGGGAGGGAGG + Intergenic
1006750388 6:36373253-36373275 TGGGGAGGTGGGAGGCATGGAGG + Intronic
1007383488 6:41505056-41505078 GGGGCAGGGTGGAGAGATGGAGG - Intergenic
1007412941 6:41675301-41675323 TGGACAGGTGAGAAGCATGGAGG - Intergenic
1007504859 6:42327840-42327862 AGGGCAGGCAGAAGGCATGGTGG + Intronic
1007588664 6:43008254-43008276 TGGGCAGGTGAGAGGCCGGGTGG + Exonic
1007625515 6:43244052-43244074 AAGGCAGGTGGGAGGCATGGAGG - Intronic
1007629529 6:43265118-43265140 GGGGCTGGGGAGAGTCATGGAGG + Intronic
1007722218 6:43891743-43891765 GGGGAGGGTGGCAGGCATGGCGG + Intergenic
1007777814 6:44233559-44233581 GGGGCAGGAGGCAGACAGGGAGG - Exonic
1007907147 6:45473261-45473283 TTGGCAGGTGGGAGGAATGGGGG - Intronic
1008305366 6:49892679-49892701 GGTGGAGGTGGCAGGCAGGGGGG - Intergenic
1008754072 6:54772948-54772970 GGGGCATGTGGAAGGCAGGCAGG - Intergenic
1008810555 6:55492805-55492827 GGGGCAGAAGGGAGGGAAGGGGG - Intronic
1008937182 6:57004527-57004549 GGGGCATGTGGTAGTCATGGCGG - Intronic
1009430273 6:63558275-63558297 GGGGAAGGAGGGAGGGATGGAGG + Intronic
1010289173 6:74115576-74115598 AGGGCTGGTGGGAGGGGTGGAGG + Intergenic
1010312891 6:74408347-74408369 GGGGTAGGTGTGAGGCAGGAGGG + Intergenic
1010650194 6:78445390-78445412 GGGGGAGGGGGGAGGGATGAGGG - Intergenic
1011534437 6:88360802-88360824 GAGGCAGGTGGGAGACAGGGAGG - Intergenic
1011664818 6:89623572-89623594 GGGGTGGCTGGGAGGCAGGGTGG + Intronic
1012270543 6:97204640-97204662 GGGGTAGGGGGTGGGCATGGTGG + Intronic
1012794570 6:103743069-103743091 GGGGCAGATGGGAGGGAGGCTGG + Intergenic
1012897568 6:104967829-104967851 GTGGCATGTGCCAGGCATGGTGG - Intronic
1013189389 6:107789390-107789412 GGGGCAGTGGGGAGGCAGGATGG - Intronic
1013196182 6:107847212-107847234 GGGGTAGGGGGCAGGCATGGTGG + Intergenic
1013414542 6:109913141-109913163 GGGGCAGATGTGAGTCATGATGG + Intergenic
1013463941 6:110400548-110400570 GGGGCAGGGAGGGGGCATGAAGG - Intronic
1013633878 6:112010292-112010314 GTGGCAGGTGGAAGGGTTGGAGG + Intergenic
1013637693 6:112044710-112044732 GGGGGAGGTAGGAAGCTTGGAGG + Intergenic
1013766281 6:113577987-113578009 AGGGAAGGAGGGAGGCAGGGAGG - Intergenic
1015390715 6:132678446-132678468 GGGTCTGGTGGGAGGCATCTGGG - Intergenic
1015444098 6:133283813-133283835 TGGGCAGGTGGGAGGGAGTGAGG - Intronic
1015447750 6:133326923-133326945 GGGGCAGGAGGGATGGAAGGTGG - Intronic
1015528054 6:134192587-134192609 GGGGGAGGGGGGATGGATGGAGG - Intronic
1015796045 6:137012373-137012395 GGGGCAGATGGGTGGAATGGTGG + Intronic
1016438456 6:144060998-144061020 GGGGCAGGGGAGAGAAATGGTGG - Intronic
1017416768 6:154229070-154229092 GGGGCTGGAGGCAGACATGGGGG - Intronic
1017672115 6:156778211-156778233 GGTGGAGGTGGTGGGCATGGTGG - Exonic
1017781363 6:157717936-157717958 TGGGCAGGTGGGAGGGGTGAGGG - Intronic
1018472894 6:164112228-164112250 GGGGCAGGTGCCTGGGATGGTGG + Intergenic
1018897053 6:168027079-168027101 GGGGCAGGAGGCAGAGATGGGGG + Intronic
1019082107 6:169441435-169441457 GCGGCAGGTGGGAAGCACCGAGG + Intergenic
1019105517 6:169664125-169664147 GGGCCAAGTGGGAGGCCTGAGGG + Intronic
1019262176 7:87833-87855 GGGGCAGGTGGGTCACCTGGTGG - Intergenic
1019319656 7:409797-409819 GGGGCTGGCAGGAGGCCTGGGGG + Intergenic
1019467411 7:1196915-1196937 GGGGCGGGTGGGGGGAATGCAGG + Intergenic
1019471754 7:1224795-1224817 GGGGCAGGGGAGAGGGAGGGAGG + Intergenic
1019471787 7:1224933-1224955 GGGGCAGGGGAGAGGGAGGGAGG + Intergenic
1019471877 7:1225363-1225385 GGGGCAGGGGAGAGGGAGGGAGG + Intergenic
1019478686 7:1256157-1256179 GGGGAAGGCGGGAGGCTGGGAGG - Intergenic
1019491552 7:1316145-1316167 GGGGCAGGTTGGGGGTCTGGGGG + Intergenic
1019739907 7:2667526-2667548 GAGGGAGGTGGGAGCCATGAAGG + Intergenic
1019812782 7:3176661-3176683 GAGGCAGGTGGGGGGTCTGGTGG + Intergenic
1019862712 7:3675126-3675148 GGAGCAGGTTTGGGGCATGGAGG - Intronic
1019873614 7:3789932-3789954 GGGGCAAGTGGCAGGAGTGGTGG + Intronic
1020983507 7:15102436-15102458 GGGGCAGGTGGGATGCTTTCTGG - Intergenic
1021119206 7:16778835-16778857 GGGGAGGGTGGGAGTCTTGGGGG + Intronic
1021824784 7:24538677-24538699 GGGGTAGGGGGTAGGGATGGGGG + Intergenic
1021862823 7:24923735-24923757 GGGGCAGGCGGGCGGCCGGGTGG + Intronic
1022060317 7:26786541-26786563 GGGGAAGGTGGGAGGGAGTGAGG + Intronic
1023183488 7:37510216-37510238 AGGGCAGGAGGGAGTCAAGGTGG - Intergenic
1023365360 7:39458197-39458219 GGAGCAGGTTGGAGGCTGGGTGG + Intronic
1023638430 7:42236522-42236544 GAAGGAGGCGGGAGGCATGGTGG - Intronic
1023823891 7:43995694-43995716 GGGGGAGGTTGGGGGGATGGAGG + Intergenic
1023868946 7:44252460-44252482 GGGGCAGGGGAGAGGGCTGGAGG + Intronic
1023874950 7:44281871-44281893 GAGGCAGGTGGGGGTCCTGGAGG - Intronic
1023908696 7:44539344-44539366 GGGGCACGTGGGTGGCTTCGTGG - Exonic
1023957079 7:44895091-44895113 GGGGCAGCTGGGAGTCTAGGAGG - Intergenic
1023995627 7:45157630-45157652 GCGCCGGGTGGGAGGGATGGGGG - Intergenic
1024260934 7:47573363-47573385 CGGGCTGGTGGGAGGCAGCGTGG - Intronic
1024548291 7:50540101-50540123 CTGGCAGCTGGGAGCCATGGGGG - Intronic
1024638330 7:51309156-51309178 AGGGCAGCTTGGAGGCAGGGGGG - Intronic
1024874031 7:54000397-54000419 GGGGCAGGTTGGTGAGATGGGGG - Intergenic
1024948260 7:54833462-54833484 GCGGCAGGTGGGATGGAGGGGGG + Intergenic
1025019182 7:55467315-55467337 GGGGCAGGAGGGAGTCAGGCAGG + Intronic
1025124838 7:56336138-56336160 GGGGGGGGTGGGAGGGAGGGAGG + Intergenic
1025142574 7:56478441-56478463 TGGGCAGGTGGGGTGCTTGGGGG + Intergenic
1025991914 7:66503468-66503490 GGGGCAGGGGAGACGCATGCTGG - Intergenic
1026112414 7:67469099-67469121 GGGGGAGGGGGGAGGGAGGGAGG - Intergenic
1026195526 7:68170199-68170221 CGGGCTGGTGGGAGACTTGGGGG + Intergenic
1026456104 7:70574002-70574024 TGTGCAGTTGGGAGGCCTGGGGG + Intronic
1026680097 7:72460192-72460214 GGGCCTGGTGGGAGGTATGTGGG - Intergenic
1026817200 7:73522145-73522167 GGGGCTGCTGGGAGGCGCGGCGG - Exonic
1026899260 7:74028051-74028073 GGGAGAGGGGGGAGGCCTGGGGG - Intronic
1026976644 7:74502751-74502773 GGGGCAGGTGGCAGGCAGGCAGG + Intronic
1026977543 7:74507715-74507737 TGGGCAGTAGGGAGCCATGGAGG + Intronic
1027043210 7:74974460-74974482 GGGGCAGGGGGGAGTCTGGGAGG + Intronic
1027175384 7:75899833-75899855 GGAGCAGGTAGGATGCAAGGTGG - Intronic
1027236975 7:76303886-76303908 GGGGTGGGTGGGTGGCGTGGGGG + Intronic
1027328207 7:77064744-77064766 GGGGGAGGTTGGGGGGATGGAGG - Intergenic
1027374381 7:77536649-77536671 GGGGCGGGCGGGAGGCAGGCTGG - Intergenic
1028753448 7:94408791-94408813 GGGGCACCTGGGAAGCCTGGAGG - Exonic
1029179065 7:98686158-98686180 AGGGCAAGTTGGAGGCCTGGAGG - Intergenic
1029344982 7:99971839-99971861 GAGACAGGTGGAAGGAATGGAGG - Exonic
1029752162 7:102549107-102549129 GGGGGAGGTTGGGGGGATGGAGG + Intronic
1029770114 7:102648201-102648223 GGGGGAGGTTGGGGGGATGGAGG + Intronic
1030061063 7:105621740-105621762 GGAGCTGCTGGGAGGCCTGGAGG - Intronic
1030147066 7:106367644-106367666 GGGGTAGGTGGGAGGCATGGTGG + Intergenic
1030659152 7:112201653-112201675 TGGGGAGGGGGGAGGAATGGGGG + Intronic
1030980669 7:116182074-116182096 GGGGGTGGGGGGAGGCAGGGAGG + Intergenic
1032023179 7:128421440-128421462 GGGGATGGAGGGAGGCTTGGGGG - Intergenic
1032066935 7:128778902-128778924 GCCGCAGGTGGGAGTCCTGGTGG + Intergenic
1032123276 7:129172052-129172074 GGTGGGGGTGGGAGGCAGGGAGG + Intergenic
1032172584 7:129597721-129597743 GGGGAAGGTAGGAGGGAGGGAGG + Intergenic
1032238076 7:130141501-130141523 CTGGCAGGAGGGACGCATGGAGG + Intergenic
1032268980 7:130386884-130386906 GGGGCAGGTGGGTTGAAGGGTGG + Intronic
1032282806 7:130518478-130518500 GGAGCAGGTGGGTGGCATTGAGG + Intronic
1032637321 7:133723862-133723884 GAGGCAGGTGGGAGGACTGTTGG - Intronic
1033284960 7:140033510-140033532 GGGGAAGGTGGCCTGCATGGTGG - Intronic
1033304641 7:140215429-140215451 GGGGCAGGTTTGTGGCATGGGGG + Intergenic
1033415999 7:141161639-141161661 GGAACAGGTGGGAGGCAGTGCGG + Intronic
1034065876 7:148136078-148136100 GGGGGAGGTGGAAGGAATGGAGG + Intronic
1034103242 7:148469155-148469177 GGGGGAAGTGCCAGGCATGGTGG - Intergenic
1034278447 7:149834942-149834964 GTGGCAGGTGGGAGTCAGGGAGG - Intergenic
1034406700 7:150908787-150908809 TGGGAAGGCTGGAGGCATGGTGG - Intergenic
1034595222 7:152183472-152183494 GGGGCTGGGGCCAGGCATGGTGG + Intronic
1034970774 7:155417945-155417967 ACGGCAGGTGGGAGGAGTGGGGG - Intergenic
1034975487 7:155446876-155446898 GGGGAAGGAGGGAGGGAGGGAGG + Intergenic
1035006291 7:155663569-155663591 GGGCCTGGTGGGAGGCGTTGGGG - Intronic
1035011840 7:155725416-155725438 GGCGCAGGAGGGAGGACTGGAGG + Intronic
1035064390 7:156094686-156094708 ATGGCAGGAGGGAGGCCTGGTGG - Intergenic
1035205187 7:157290242-157290264 GGGGCAGGGGAGAGGACTGGGGG + Intergenic
1035259906 7:157654342-157654364 GGTGCTGGTGGGAGTCAGGGTGG - Intronic
1035302012 7:157903516-157903538 GGGGCATGTGGGAGGGTTGTCGG - Intronic
1035316647 7:158001022-158001044 GCCGCAGGTGGGGTGCATGGTGG + Intronic
1035374074 7:158395834-158395856 GGGGCTGGTGGGATCCAAGGCGG - Intronic
1035771739 8:2153087-2153109 GGGGCAGGTGGGCTGGATGTTGG + Intronic
1036202026 8:6778051-6778073 GGGCCTGGTGGGAGGTGTGGGGG - Intergenic
1036503037 8:9330826-9330848 GAGGCAGGTGGGAAGTAGGGCGG - Intergenic
1036683095 8:10890281-10890303 AGGGCAGGTGGGAGCCCAGGAGG - Intergenic
1036773186 8:11592700-11592722 GAGGCAGGTGGCAGGCAGGATGG - Intergenic
1036909714 8:12746272-12746294 TGGGCAGGAGCCAGGCATGGAGG - Intronic
1037098036 8:15008750-15008772 GGGGGAGGAGGGAGGGACGGAGG + Intronic
1037169432 8:15873949-15873971 GGAGAAGGAGGGAGGCAGGGAGG - Intergenic
1037180766 8:16003272-16003294 GGCCCAAGTGGGAGGCATTGGGG - Intergenic
1037611950 8:20483294-20483316 AGGGCAGGTGGCAGGCAGGGAGG + Intergenic
1037866062 8:22443233-22443255 GGGGCTAGGGGCAGGCATGGTGG + Intronic
1037879591 8:22566237-22566259 GGAGGAGGTGGCAGGGATGGGGG + Intronic
1037959281 8:23084190-23084212 GGGGAAGGTGGATAGCATGGGGG - Intergenic
1038542476 8:28401817-28401839 GGGGCGGGAGGGAGGGAGGGAGG - Intronic
1038646498 8:29366227-29366249 GGGGTAGGTTGGTGGCCTGGAGG - Intergenic
1038752107 8:30305270-30305292 AGGGCAGGATGGAGGGATGGGGG - Intergenic
1039578662 8:38646070-38646092 GTGGCAGCTGGGAGGGAAGGTGG + Intergenic
1039745321 8:40420390-40420412 GAGGCAGGTGGGGAGCATGGTGG + Intergenic
1039900897 8:41751929-41751951 AGGGAAGGTGGTAGGCAGGGGGG - Intronic
1039903298 8:41767796-41767818 CGGGGAGGCGGGAGGCAGGGAGG - Intronic
1040569223 8:48592926-48592948 GGGGATGTTGGTAGGCATGGTGG + Intergenic
1040825313 8:51613480-51613502 GGGGCGGGGGGGGGGCAGGGCGG + Intronic
1040863268 8:52022773-52022795 GGGGCCTGTGAGAGGAATGGAGG - Intergenic
1041045020 8:53880518-53880540 GGGGTGGGCGGCAGGCATGGAGG - Intronic
1042110248 8:65374020-65374042 TGGGCAGGAGGGAGGGAGGGGGG + Intergenic
1042537089 8:69870019-69870041 TGGGCAAATGGGAGTCATGGAGG - Intergenic
1042654978 8:71085872-71085894 GGGGCAGGTGGGGGGCATACAGG + Intergenic
1042852095 8:73226569-73226591 TGGGAAGGTGGGAGGGATCGAGG - Intergenic
1043515277 8:80990028-80990050 AGGGAGGGTGGGAGGGATGGAGG - Intronic
1043516085 8:80996293-80996315 TGGGGAGGTGGGAGGAGTGGTGG + Intronic
1045324773 8:101109917-101109939 GGGGCAGGGTGGAGGGAGGGAGG + Intergenic
1045344093 8:101279233-101279255 GGGGGAGGAGGGAGGAAGGGAGG + Intergenic
1045412022 8:101929380-101929402 GAGGAGGGAGGGAGGCATGGAGG + Intronic
1045649151 8:104326656-104326678 GTGGCAGGTTGCAGACATGGAGG - Intergenic
1046003160 8:108445468-108445490 GGGGCAAGAGTGAGGCAAGGAGG - Intronic
1046020032 8:108653848-108653870 GGGATAGGTGGGAAGCATGGAGG + Intronic
1046181021 8:110647780-110647802 GAGGCAGGAGGGAGGCATGGAGG + Intergenic
1046229559 8:111335372-111335394 GGGCCAGGATGGGGGCATGGCGG + Intergenic
1046568390 8:115930695-115930717 GGGGGGGGTGGGGGGCGTGGCGG + Intergenic
1046731775 8:117733785-117733807 GGGGCGGGGGGTAGGCATTGAGG + Intergenic
1046958197 8:120083248-120083270 GGGCCAGGAGGAAGACATGGTGG - Intronic
1047218140 8:122895847-122895869 TTGGCAGGTGGGAGGGCTGGGGG - Intronic
1047402398 8:124557773-124557795 GGAGCAGGCGGGAGGCAGGCAGG + Exonic
1047901906 8:129431948-129431970 GGTGCTGTTGGGGGGCATGGTGG - Intergenic
1048257602 8:132917018-132917040 AGGGAGGGAGGGAGGCATGGAGG - Intronic
1048328079 8:133453752-133453774 GGAGCAGGACAGAGGCATGGGGG + Intergenic
1048332445 8:133479949-133479971 GGGGCAGCCTGCAGGCATGGGGG + Intronic
1048445123 8:134487599-134487621 GGGGAAGGAGTGAGGCAGGGAGG - Intronic
1048453579 8:134556001-134556023 AGGGAAGGTGGGAGGGAAGGAGG + Intronic
1048615155 8:136066155-136066177 GAGGCAGGTAGGAGGGATGTGGG + Intergenic
1048709669 8:137195219-137195241 CGGGAAGGAGGGAGGCAGGGAGG + Intergenic
1048890210 8:138940471-138940493 GGGGAAGGTGGGGGGATTGGGGG - Intergenic
1049013944 8:139906554-139906576 GGGGCAGGAGGGAGAGAAGGGGG + Intronic
1049262428 8:141646766-141646788 TGGGGAGGTGGGTGGCATGGAGG - Intergenic
1049323986 8:142012260-142012282 GGGGAGGGAGGGAGTCATGGAGG + Intergenic
1049378612 8:142301215-142301237 AGGGCAGGTGGGGGGCACTGTGG - Intronic
1049378680 8:142301406-142301428 AGGGCAGGTGGGGGGCACTGTGG - Intronic
1049378727 8:142301535-142301557 AGGGCAGGTGGGGGGCACTGTGG - Intronic
1049423779 8:142528326-142528348 GCTGCAAGTGGCAGGCATGGGGG - Intronic
1049567603 8:143349300-143349322 GGGGCAGGGGGGTGGGAGGGGGG - Intronic
1049579428 8:143404629-143404651 GGGGCAGGCGGGAGGCTCTGGGG + Intergenic
1049612597 8:143562372-143562394 GTGGCGGGTGGGAGGGAGGGAGG + Intronic
1049645895 8:143735436-143735458 AGGGCAGTGGAGAGGCATGGAGG + Intergenic
1049660486 8:143817635-143817657 GCGGCAGGTGGGAGGCCTCCAGG + Exonic
1049664191 8:143835733-143835755 GCGGAAGGAGGGAGGCATGGGGG + Intronic
1049687388 8:143944369-143944391 GGGACAGCTGGCAGGCATGGAGG + Intronic
1049740795 8:144239970-144239992 GGAGCAGGTGGGGGGCAGCGGGG + Intronic
1049767061 8:144359741-144359763 GGTGCAGGTGCTGGGCATGGTGG + Exonic
1049771501 8:144384239-144384261 AGGGCAGGAAGGAGGCAGGGAGG + Intronic
1049806294 8:144542160-144542182 GGAGCAGGTGGGAGAGCTGGAGG + Intronic
1051228199 9:14925007-14925029 GGGACTGGTGGGAGGCAGAGAGG + Intergenic
1051305060 9:15700139-15700161 GGGGTGGGAGGCAGGCATGGCGG + Intronic
1051366715 9:16326576-16326598 AGGGCAGGTGGGAGAGGTGGGGG - Intergenic
1051367314 9:16330105-16330127 GGGGCAGGAGGCAGGGATAGTGG + Intergenic
1051408647 9:16766305-16766327 GGGGAAGGTGGGAGGGATGAGGG + Intronic
1052049722 9:23831279-23831301 GAGGGAGGTGGGGGGCAGGGCGG - Intergenic
1052283812 9:26761992-26762014 GGGGAGGGAGGGAGGGATGGAGG + Intergenic
1052703041 9:31960588-31960610 GGGGGATGTGGGAGGGATGTTGG - Intergenic
1052731464 9:32291234-32291256 GGGGCTGCTGTGGGGCATGGGGG + Intergenic
1052778453 9:32756067-32756089 GGCCCAGGGTGGAGGCATGGCGG + Intergenic
1052900658 9:33791952-33791974 GGGGCAGGAGGCAGGCAGGGAGG + Intronic
1052970440 9:34373962-34373984 GGGGCAGGAGCCTGGCATGGGGG + Intronic
1052998708 9:34565554-34565576 AGGGCAGGTTGGGGGCTTGGGGG + Intronic
1053098689 9:35351321-35351343 GGGGCATGTGCGAGGTTTGGAGG + Intronic
1053142582 9:35690668-35690690 GGGGCACGTGGGGGGCGGGGCGG - Exonic
1053360966 9:37486372-37486394 GGGGGAGGCGGGAGACCTGGTGG - Intronic
1054337207 9:63817697-63817719 GGGGCAGGGTGGGGGCAGGGCGG - Intergenic
1054337213 9:63817708-63817730 GGGGCAGGGTGGGGGCAGGGTGG - Intergenic
1054923225 9:70562614-70562636 TGGGCAGGGGGGAGGTATGGGGG + Intronic
1055544062 9:77348453-77348475 GGGGCCTGTTGGGGGCATGGTGG + Intronic
1055824202 9:80304335-80304357 TTGGCAGGTGGCAGACATGGAGG + Intergenic
1055898471 9:81207610-81207632 TGTGGAGGTGGGAGGCATGTGGG + Intergenic
1056507942 9:87275250-87275272 GGGGCTGGGAGGAGGAATGGAGG - Intergenic
1056604534 9:88076126-88076148 GCGGGAGGTGGGAGGGAAGGCGG - Intergenic
1056679148 9:88701920-88701942 GAGGCAGGAGGGTGGCCTGGGGG + Intergenic
1056968380 9:91182995-91183017 GGAGCAGGAGGGAGGCAGAGTGG - Intergenic
1057188980 9:93075752-93075774 CAGGCAGGTATGAGGCATGGCGG - Intronic
1058053375 9:100427467-100427489 GGGGCCGGGGGCCGGCATGGAGG + Intronic
1058432079 9:104928365-104928387 GGGGGAGGTGGGTGGGGTGGGGG + Intergenic
1059034423 9:110738681-110738703 GGGGTGGGTGGGAGGTAGGGAGG + Intronic
1059153911 9:111973179-111973201 GGGGCAGGTGGGGGCCGTTGAGG + Intergenic
1059570643 9:115430824-115430846 GTGGCAGGTGGGAGACATTGGGG - Intergenic
1060109190 9:120894514-120894536 GAGGCGGGTGGGAGGCGTCGTGG - Intronic
1060109641 9:120897316-120897338 GAGGCAGATGGGAGTCAGGGAGG + Intergenic
1060269052 9:122128387-122128409 GGGGCAGGAGAGGGGCATGGCGG - Intergenic
1060403519 9:123361609-123361631 GGGGGTGGGGGGAGGAATGGAGG + Intronic
1060475169 9:123981260-123981282 GGGCAAGGGGGGAGGGATGGAGG + Intergenic
1060478562 9:124002781-124002803 GGGGCAGGGAGGAAGTATGGGGG - Intronic
1060479756 9:124011389-124011411 GGGGTGGGGGGGAGGCAGGGAGG - Intronic
1060548450 9:124474318-124474340 GGGGTAGTTGGGAGCCATGCAGG + Intronic
1060872062 9:127050620-127050642 GGGGCAGGAGGTGGGGATGGGGG - Intronic
1060907911 9:127324439-127324461 GGGTCAGGATGGAGGCACGGAGG - Intronic
1060934141 9:127506049-127506071 CGGGCAGGAGGGAGGCAGGCTGG + Exonic
1060948886 9:127588070-127588092 GGGGAGGGAGGGAGGCAAGGAGG - Intergenic
1060952516 9:127612850-127612872 GGGGAAGGAGGGTGGGATGGGGG - Intronic
1060985425 9:127816665-127816687 GAGGCAGGGGTGAGGGATGGGGG - Intronic
1060993203 9:127860745-127860767 GGGGCAAGTTGGAAGCAAGGTGG - Intergenic
1061127531 9:128686307-128686329 GGGGCAGGGAGGTGGCAGGGAGG + Intronic
1061169145 9:128941890-128941912 GGGGCAGTAGGGAGGCAGAGAGG - Exonic
1061293936 9:129666960-129666982 GGGGCGGGTGGGAGGGCTGCTGG - Intronic
1061298458 9:129690141-129690163 GGGTAAGGTGGGAGGGATGAAGG - Intronic
1061339223 9:129965798-129965820 GGGGAAGGAGGGAGGGAGGGAGG + Intronic
1061411519 9:130424684-130424706 GGGGCAGTGGGGAGCCATGACGG + Intronic
1061496398 9:130977235-130977257 GGGGCAGGTGTGAGGGGAGGCGG + Intergenic
1061505991 9:131032180-131032202 GAGGGAGGAGGGAGGCAGGGTGG + Intronic
1061607613 9:131722904-131722926 GGGGCGGGGGGCAGGCATGGTGG + Intronic
1061799035 9:133104217-133104239 GGGGCAGGGGGCTGGCCTGGGGG - Intronic
1061852506 9:133424314-133424336 GGGGAAGGAGGGCGGCCTGGAGG - Exonic
1061853463 9:133429174-133429196 GGGGCAGGTGGGTGGGACGGGGG - Intronic
1061872122 9:133526766-133526788 AGGGGAGGTGGGAGGCTGGGAGG - Intronic
1061873602 9:133533322-133533344 GGGGCAACTGGGATGCAAGGTGG - Intronic
1061895955 9:133647820-133647842 GGAGAAGGTGGGATGGATGGAGG - Intronic
1061898664 9:133661974-133661996 GGTGCACTTGGGAGCCATGGCGG + Intergenic
1061905420 9:133694270-133694292 GGGCCAGCGGGGAGGCCTGGTGG + Exonic
1061942636 9:133891636-133891658 GGGGGATGGGGGAGGGATGGAGG + Intronic
1061949877 9:133930270-133930292 GAGGCAGGGTGGAGGCAGGGAGG - Intronic
1062005442 9:134236425-134236447 GGGGCAGGTTGGGGGCAGGGTGG + Intergenic
1062028737 9:134352479-134352501 TGGGCAGGGGCGAGGCAGGGAGG - Intronic
1062046131 9:134425424-134425446 GGGGCAGGTGGGAAGGAGGTTGG - Intronic
1062050467 9:134444316-134444338 GGGGAAGGAGGGAGGGAGGGGGG - Intergenic
1062050546 9:134444516-134444538 GGGGAAGGAGGGAGGGACGGGGG - Intergenic
1062062042 9:134502036-134502058 AGGGCAGGTGAGAGGAAGGGCGG + Intergenic
1062132851 9:134909348-134909370 GGGGGATGGGGGAGGCTTGGGGG + Intronic
1062266719 9:135689864-135689886 TGGGCAGGTGGGCTGCCTGGAGG - Intergenic
1062291208 9:135795566-135795588 GGGACAGGTGGGAGGAAGCGGGG + Intergenic
1062332548 9:136051028-136051050 GGGGAAGGAGGGAGGGAGGGGGG + Intronic
1062399399 9:136365841-136365863 GGGGCAGGTGTGAAGGTTGGAGG - Intronic
1062413101 9:136434543-136434565 GGTGCAGGTGGGAGCTCTGGGGG + Intronic
1062481387 9:136754093-136754115 TGGGCAGTGGGGAGCCATGGAGG + Intergenic
1062591706 9:137277437-137277459 GGGGGAGGTGGGGGCCCTGGAGG + Intergenic
1062622382 9:137428757-137428779 GGGCCAGGTGGGGGGACTGGGGG + Intronic
1185455969 X:311116-311138 CGGGGACGTGGGAGGCTTGGGGG + Intronic
1185712352 X:2314301-2314323 AGGGAAGGAGGGAGGCAGGGAGG + Intronic
1185721774 X:2388143-2388165 GGAGCCATTGGGAGGCATGGAGG + Intronic
1185827015 X:3261203-3261225 GGGGCCTGTGGGAGGTATGTAGG + Intergenic
1185834074 X:3328991-3329013 AGGGAAGGTGGGAAGCAGGGAGG + Intronic
1185944677 X:4361969-4361991 GAGGGTGGTGGGAGGGATGGGGG - Intergenic
1185975324 X:4713782-4713804 GGGGCCGGGGGCAGGCATGGTGG - Intergenic
1186291867 X:8109088-8109110 GAGGAAGGAGGGAGGCAGGGAGG - Intergenic
1186490024 X:9964233-9964255 AGGGCAGGAGGGAGGGAGGGAGG - Intergenic
1186872530 X:13786568-13786590 GGGGCAGGTGGAAGCCGGGGAGG - Intronic
1187352517 X:18533914-18533936 GGGGCCAGTGGGAGGGTTGGAGG - Intronic
1187496424 X:19799537-19799559 AGGCCAGGAGGGAGGCATGATGG - Intronic
1187700590 X:21961316-21961338 GGCTCTGGTGGGAGGCTTGGGGG + Intronic
1187832676 X:23398826-23398848 GGGGCGGGTGAGAGGCAAGCTGG - Exonic
1188003541 X:25002718-25002740 GGGGCAGGCGGGAGGGGTGCGGG - Intergenic
1188306749 X:28568579-28568601 GGGAAAGGTGGAAGGCAAGGAGG - Intergenic
1188892314 X:35625945-35625967 GCGGCTGGTGGGGAGCATGGCGG + Intergenic
1189288594 X:39869430-39869452 TGGGCAGGTGGCAGGAATGGGGG + Intergenic
1189377331 X:40475916-40475938 GAGGCAGGTGCGGGGCAGGGTGG - Intergenic
1189711102 X:43812877-43812899 GGGGAAGATGGGAGTCATAGTGG + Intronic
1190123491 X:47683271-47683293 GGGGCAGGTGAGACGCAGAGAGG + Intergenic
1190225156 X:48539643-48539665 GGGCCAGGTGGGAGGGACGGTGG + Exonic
1190429944 X:50369541-50369563 AGGGAAGGAGGGAGGCAGGGAGG - Intronic
1190597178 X:52061679-52061701 GGGACAGGTGGGATGCTGGGAGG - Intergenic
1190611646 X:52192394-52192416 GGGACAGGTGGGATGCTGGGAGG + Intergenic
1190708264 X:53048467-53048489 GGAGGAGGAGGGAGGCAGGGAGG - Intergenic
1190874926 X:54453049-54453071 GTGGCAGCAGGAAGGCATGGAGG - Intronic
1191881200 X:65845171-65845193 GGGCCATGTGTGAGGCATTGGGG + Intergenic
1192201486 X:69069194-69069216 TGGGCAGGTGGCAGCTATGGAGG - Intergenic
1192270746 X:69577090-69577112 GGGTCAAGTGGGAGGTATGAGGG - Intergenic
1192436810 X:71148233-71148255 AGGGCAGGCGGGAGGCAGGGAGG - Intronic
1193659172 X:84236417-84236439 GTGGCAGGTGTGATGCATGGGGG + Intergenic
1194298246 X:92154569-92154591 GGCCCAGGATGGAGGCATGGTGG - Intronic
1194644315 X:96440002-96440024 TGAGCAGGTGGGAGGCATAAAGG + Intergenic
1194802731 X:98292074-98292096 GGTACAGGATGGAGGCATGGTGG + Intergenic
1195298728 X:103506278-103506300 GGGGGAGGTGGGAGTAAGGGAGG - Intronic
1197639293 X:128950414-128950436 GGGGCAGTGGGGAGCCATTGAGG - Intergenic
1198036400 X:132805424-132805446 GGGGGATGGGGGAGGCAGGGAGG - Intronic
1198548565 X:137719983-137720005 GGTGCAGGTGGTAGTAATGGTGG + Intergenic
1199471596 X:148201742-148201764 GGAGAAGGTGGGAGGGAGGGAGG - Intergenic
1199541043 X:148958409-148958431 GGGGCTGGTGAGATGCAAGGAGG - Exonic
1199692117 X:150316654-150316676 GGAGCAGGTGGGATGCATAAGGG - Intergenic
1199800545 X:151247006-151247028 GGGGTAGATGGAAGGGATGGAGG + Intergenic
1199951070 X:152706556-152706578 GGGGCAGTGGGGCTGCATGGAGG + Intergenic
1199953375 X:152723180-152723202 GGGGCAGTGGGGCTGCATGGAGG + Intergenic
1199956307 X:152745270-152745292 GGGGCAGTGGGGCTGCATGGAGG - Intergenic
1199958614 X:152761905-152761927 GGGGCAGTGGGGCTGCATGGAGG - Intergenic
1200007988 X:153100485-153100507 GGGGGAAGAGGGAGGAATGGAGG + Intergenic
1200051277 X:153433126-153433148 GGGGCAGTGGGGAGGGATGAGGG + Intergenic
1200071313 X:153530808-153530830 GGGGCCGGTGGGGGGCAGAGGGG + Intronic
1200256663 X:154586036-154586058 GGGGTAGGGGGGAGGGGTGGGGG + Intronic
1200261106 X:154618367-154618389 GGGGTAGGGGGGAGGGGTGGGGG - Intronic
1200615855 Y:5379529-5379551 GGCCCAGGATGGAGGCATGGTGG - Intronic
1200659095 Y:5939835-5939857 GAGGCAGGTTGGGGGAATGGGGG + Intergenic
1200807029 Y:7443565-7443587 GAGGGAGGTGGGAGGGAGGGAGG - Intergenic
1200992245 Y:9356392-9356414 GAGCCAGGTGGGAGGCACGTGGG - Intergenic
1200994894 Y:9376670-9376692 GAGCCAGGTGGGAGGCACGTGGG - Intronic
1200997559 Y:9397016-9397038 GAGCCAGGTGGGAGGCACGTGGG - Intergenic
1201000071 Y:9465552-9465574 GAGCCAGGTGGGAGGCACGTGGG - Intergenic
1201002732 Y:9485862-9485884 GAGCCAGGTGGGAGGCACGTGGG - Intronic
1201005387 Y:9506146-9506168 GAGCCAGGTGGGAGGCACGTGGG - Intergenic
1201008050 Y:9526475-9526497 GAGCCAGGTGGGAGGCACGTGGG - Intergenic
1201010664 Y:9546665-9546687 GAGCCAGGTGGGAGGCACGTGGG - Intergenic
1201269334 Y:12239263-12239285 AGGGAAGGAGGGAGGGATGGAGG + Intergenic
1201550424 Y:15211928-15211950 AGGGAAGGAGGGAGGGATGGAGG + Intergenic
1201731239 Y:17206034-17206056 GAGGGTGGTGGGAGGGATGGGGG - Intergenic
1201741268 Y:17326362-17326384 AGGGAAGGAGGGAGGGATGGAGG + Intergenic
1202370994 Y:24195303-24195325 GTGGGGGGTGGGAGGGATGGCGG + Intergenic
1202499790 Y:25474814-25474836 GTGGGGGGTGGGAGGGATGGCGG - Intergenic