ID: 1138393870

View in Genome Browser
Species Human (GRCh38)
Location 16:56689803-56689825
Sequence TGGTAGGGCCAGCATCTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138393870_1138393880 3 Left 1138393870 16:56689803-56689825 CCAAACAGATGCTGGCCCTACCA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1138393880 16:56689829-56689851 CCTCCCTCTCTCTGGGTGGCGGG 0: 1
1: 0
2: 2
3: 47
4: 389
1138393870_1138393885 13 Left 1138393870 16:56689803-56689825 CCAAACAGATGCTGGCCCTACCA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1138393885 16:56689839-56689861 TCTGGGTGGCGGGAGGAGGATGG 0: 1
1: 0
2: 9
3: 83
4: 981
1138393870_1138393873 -5 Left 1138393870 16:56689803-56689825 CCAAACAGATGCTGGCCCTACCA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1138393873 16:56689821-56689843 TACCACTCCCTCCCTCTCTCTGG 0: 1
1: 1
2: 4
3: 43
4: 424
1138393870_1138393886 20 Left 1138393870 16:56689803-56689825 CCAAACAGATGCTGGCCCTACCA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1138393886 16:56689846-56689868 GGCGGGAGGAGGATGGAGAGTGG 0: 1
1: 2
2: 23
3: 297
4: 2273
1138393870_1138393882 6 Left 1138393870 16:56689803-56689825 CCAAACAGATGCTGGCCCTACCA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1138393882 16:56689832-56689854 CCCTCTCTCTGGGTGGCGGGAGG 0: 1
1: 0
2: 3
3: 24
4: 281
1138393870_1138393884 9 Left 1138393870 16:56689803-56689825 CCAAACAGATGCTGGCCCTACCA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1138393884 16:56689835-56689857 TCTCTCTGGGTGGCGGGAGGAGG 0: 1
1: 0
2: 1
3: 49
4: 514
1138393870_1138393876 -1 Left 1138393870 16:56689803-56689825 CCAAACAGATGCTGGCCCTACCA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1138393876 16:56689825-56689847 ACTCCCTCCCTCTCTCTGGGTGG 0: 1
1: 0
2: 3
3: 44
4: 444
1138393870_1138393874 -4 Left 1138393870 16:56689803-56689825 CCAAACAGATGCTGGCCCTACCA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1138393874 16:56689822-56689844 ACCACTCCCTCCCTCTCTCTGGG 0: 1
1: 1
2: 6
3: 69
4: 544
1138393870_1138393878 2 Left 1138393870 16:56689803-56689825 CCAAACAGATGCTGGCCCTACCA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1138393878 16:56689828-56689850 CCCTCCCTCTCTCTGGGTGGCGG 0: 1
1: 1
2: 5
3: 58
4: 437
1138393870_1138393887 21 Left 1138393870 16:56689803-56689825 CCAAACAGATGCTGGCCCTACCA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1138393887 16:56689847-56689869 GCGGGAGGAGGATGGAGAGTGGG 0: 1
1: 0
2: 10
3: 119
4: 1265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138393870 Original CRISPR TGGTAGGGCCAGCATCTGTT TGG (reversed) Intronic
900556231 1:3282278-3282300 TGGCAGGGCCAGCCTGTGTCTGG - Intronic
901400845 1:9014334-9014356 TGGTAGGCCCAGCCTGTGTCAGG - Intronic
904202598 1:28830998-28831020 TGGTGGGGACAGCATCTGGTGGG - Intronic
904854912 1:33490370-33490392 TGTTAGGGCCGGGAGCTGTTGGG + Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906532974 1:46533893-46533915 TTGGAGGGGCAGCGTCTGTTTGG - Intergenic
908955363 1:69619085-69619107 TGGAAGGGTCAGCATGTGTGAGG + Intronic
910209221 1:84776441-84776463 TGGTTGGACCAGCATCTGGGGGG + Intergenic
911943377 1:104074669-104074691 TGGAAGGGCAGGCATGTGTTGGG - Intergenic
912717512 1:111992256-111992278 TGGGAGGGACAGCATCTCCTGGG - Intergenic
912748739 1:112268084-112268106 TGACAGGCCCAGCATCTGCTGGG - Intergenic
917486241 1:175457269-175457291 TGGTTGGGGCAGCATCTGCCAGG - Intronic
920241866 1:204558457-204558479 TGGTATGCCTAGCATCTGCTAGG + Intergenic
1067815591 10:49473573-49473595 AAGTATGTCCAGCATCTGTTTGG + Exonic
1070392958 10:75987401-75987423 TGGTGGGGGCAGCTTCTGCTGGG - Intronic
1076344051 10:129768567-129768589 GGGGAGGGCCATCATCTGTGGGG - Intergenic
1076721512 10:132395415-132395437 TGGTGGGGCCAGCATGGGGTGGG - Intergenic
1081403864 11:42673684-42673706 TGGAAGGCCCAGCATATGGTGGG - Intergenic
1084630150 11:70342594-70342616 TGGTAGTGCCAGCCTCAGGTAGG + Intronic
1085459082 11:76682367-76682389 AGGTGGGGCCAGCATGTGTAGGG + Intergenic
1086952477 11:92905185-92905207 TGGTAGGGCCAACACCTTCTCGG + Intergenic
1093947232 12:25123404-25123426 TGGTAGAGCAAGTATCAGTTTGG - Intronic
1095405376 12:41861670-41861692 TGGAAGGCCCAGCAGCTGTTGGG - Intergenic
1096887026 12:54728286-54728308 TGTTAGGGCCAGGACCTGGTGGG - Intergenic
1098607375 12:72408023-72408045 TGGAGGAGCCAGCATCTGTGAGG + Intronic
1100601545 12:96115688-96115710 TGGTAGGGGCTGTAACTGTTAGG + Intergenic
1101283357 12:103283023-103283045 TGTTTGGGCCAGGATCTGTTAGG - Intronic
1102058462 12:109914379-109914401 TTGTAGAACCAGGATCTGTTAGG + Intronic
1110220927 13:73072391-73072413 TGGCAGTGCCAGCCTCTGTGGGG - Intronic
1110284482 13:73733628-73733650 TGTTATGACCAGTATCTGTTTGG + Intronic
1112564756 13:100543902-100543924 TGGTGGGCCCAGGATCTGCTGGG - Intronic
1118598408 14:67453714-67453736 ATGTAGGGCCACCATCTGCTGGG + Intronic
1121586588 14:95067163-95067185 TGGTAGAGCCAGCTCCTGTGTGG - Intergenic
1123578400 15:21695219-21695241 TGGGAGGGCCATCCTCTGCTCGG + Intergenic
1123615025 15:22137701-22137723 TGGGAGGGCCATCCTCTGCTCGG + Intergenic
1125153405 15:36559898-36559920 TGGTAGAGCCAGGATCTGAATGG + Intergenic
1127997178 15:64160031-64160053 TGGGAGGGCCAGGTTCTGCTGGG - Intronic
1128784380 15:70384037-70384059 TGGCAGGGCCAGCTTCTGGGAGG - Intergenic
1202987270 15_KI270727v1_random:429464-429486 TGGGAGGGCCATCCTCTGCTCGG + Intergenic
1134313116 16:13094005-13094027 TGAAAGGGCCAGCTTCTGTTGGG - Intronic
1138393870 16:56689803-56689825 TGGTAGGGCCAGCATCTGTTTGG - Intronic
1139730909 16:68944488-68944510 TGGTTGGGAGATCATCTGTTGGG - Intronic
1142368954 16:89667184-89667206 TGGTAACGCCAGCGTCTGGTAGG - Intronic
1142412055 16:89921870-89921892 TGGCAGGGCCCGCCTCTGCTGGG + Intronic
1143444731 17:7000835-7000857 TGGTAGTGTCAGCATCACTTTGG - Intronic
1148069989 17:44903119-44903141 TGGTATAGCCAGCATTTGGTTGG - Exonic
1153940436 18:9972325-9972347 TGGTATTGCAAACATCTGTTTGG + Intergenic
1156583307 18:38404547-38404569 TGGTCAGGCCTGCAACTGTTGGG + Intergenic
1159926837 18:74277307-74277329 TGGAGGGGCCAGCATCTGCATGG + Intronic
1160175170 18:76587653-76587675 TGGTAGGGCCTTCAACTGATGGG + Intergenic
1164896258 19:31880027-31880049 CAGTAGGGCCAGCCTGTGTTGGG + Intergenic
1165752253 19:38267498-38267520 TGGTAGGGCCAGCAGATTGTTGG + Intronic
1166991739 19:46696979-46697001 TGGTGGGGCCAGAATCGGATGGG + Intronic
1167006164 19:46777713-46777735 TGGTATGGGCAGGATCTGGTGGG - Intronic
941380814 2:164790109-164790131 GGGTGGGGCCACCATCTGTGTGG + Intronic
945449455 2:209976905-209976927 TGGTTGGGCCAGCAGCTGAAAGG - Exonic
945450950 2:209994381-209994403 TGGCAGGAGCAGTATCTGTTTGG - Intronic
947464004 2:230325575-230325597 TGGTAAGCTGAGCATCTGTTGGG - Intergenic
948901778 2:240959956-240959978 TGGGAGGGCCAGCATGTGAAAGG + Intronic
1174031462 20:47631724-47631746 TTGTAGGGACAGAATCTCTTCGG + Intronic
1175498820 20:59434674-59434696 TGGTAGTGCCAGCATCACCTGGG + Intergenic
1180945379 22:19689530-19689552 TGGCAGGGCCAGCCCCTGTGAGG + Intergenic
1183102249 22:35591186-35591208 TGGCCTGGCCAGCACCTGTTGGG + Intergenic
1183705466 22:39472732-39472754 GGGCAGGGCCAGCATCTGGCGGG + Intronic
1184635947 22:45831668-45831690 GGCTAGGGCCACCAGCTGTTCGG + Intronic
1184865509 22:47199801-47199823 GGGCAGGGCCAGCAGTTGTTGGG - Intergenic
950311483 3:11962199-11962221 TGTCAGGGCCAGCATCTTTGCGG - Intergenic
954406739 3:50349365-50349387 TGGTATGGCCAGCCTCTGCAAGG - Exonic
954578958 3:51692753-51692775 TGGTAGAGCCATCATCTGGAAGG + Intronic
954699384 3:52443441-52443463 TGGGATAGCCAGCATCTGTGGGG - Intronic
960680070 3:120238684-120238706 TGTTTGGGCCAGCGTCAGTTTGG - Intronic
960696328 3:120400212-120400234 TTGTAGGGCCAGCTTCTGGCTGG - Intronic
962284361 3:134074143-134074165 GGGGAGTGCCAGAATCTGTTAGG - Intronic
969300856 4:6296128-6296150 TGGTTGGGCCACCAACTGTCAGG + Intronic
971491477 4:27216683-27216705 TGTTTGCACCAGCATCTGTTTGG + Intergenic
972810344 4:42578373-42578395 TACTAGCGCCACCATCTGTTGGG + Exonic
978347620 4:107788422-107788444 TGGTAGTCCCAACATCTGTGTGG + Intergenic
979375992 4:119947477-119947499 TGGAAGGCCCAGCATCTTCTTGG - Intergenic
983484169 4:168314200-168314222 TGTTAGGGCGTGCATGTGTTGGG - Intronic
984180977 4:176481828-176481850 TGGTAGGGGTAACACCTGTTAGG + Intergenic
988453213 5:31363973-31363995 ATGAAGGGCCAGCCTCTGTTAGG + Intergenic
989118662 5:37981574-37981596 TGGTAGGGATCACATCTGTTTGG + Intergenic
998248858 5:140535455-140535477 TGCAAGGGCCAGCTCCTGTTGGG + Exonic
1001255816 5:170182946-170182968 TGGAAGGCCCAGCATCTGACAGG + Intergenic
1008056624 6:46952230-46952252 TGGATGTGCCAGCATTTGTTAGG + Intronic
1008256718 6:49311000-49311022 TGCTAGAGCCAGCAGCTGGTAGG + Intergenic
1011880563 6:92018923-92018945 TGGTAGGGGCAGCATCCTTAGGG + Intergenic
1014867278 6:126548024-126548046 TGGCAGGGTCAGCAGCTTTTTGG + Intergenic
1020867939 7:13590538-13590560 TGTTTGGGCCAGCATCAGGTTGG - Intergenic
1021039654 7:15846267-15846289 TTGTAGGGCCACCAGCTGTTTGG - Intergenic
1021176101 7:17451146-17451168 TGGTAGGATCTGCATCTATTAGG - Intergenic
1026434592 7:70384484-70384506 CTGTAGGCCCAGCTTCTGTTAGG - Intronic
1027810331 7:82888710-82888732 AGCTAGGGCCAGAATATGTTGGG - Intronic
1039560151 8:38506002-38506024 AGGTAGGGCCAGCAGCTGGCAGG - Intergenic
1043438529 8:80256852-80256874 TGGTAGGGCCAGCAGCACCTGGG - Intergenic
1049399256 8:142417557-142417579 TGGTAGGGGCAGCTCCTGTGAGG - Intergenic
1050562005 9:6843651-6843673 TGGTGGAGCCAGCATTTGGTTGG + Intronic
1054782411 9:69177180-69177202 TGGTTGGTCCAACAACTGTTGGG - Intronic
1060552866 9:124493841-124493863 GGGCAGGGCCAGCCCCTGTTTGG + Intronic
1061007309 9:127935458-127935480 TGGGAGGACCAGCATCTTTTAGG + Exonic
1062491028 9:136804994-136805016 TGCTGGGGCCAGCATCTCTGAGG - Intronic
1187532042 X:20105938-20105960 TGGTGGTGTCAGCATCTGCTTGG + Intronic
1187761131 X:22586535-22586557 TTGTAGGGCAAGCACCTGTTTGG + Intergenic
1191863312 X:65683560-65683582 GGGTAGGGCCAGCATTTGAGAGG + Intronic
1195454689 X:105054287-105054309 TGCTAGGGCCACTATCTGTGTGG - Intronic
1199343310 X:146708148-146708170 TGGTAGGGGCACCAGCTGTGGGG + Intergenic
1199643476 X:149883973-149883995 TGGTAGGGCCAGGAACTGTGGGG - Intronic
1199736219 X:150689078-150689100 TGGTAGGGCCTGTGTGTGTTTGG + Intergenic