ID: 1138394809

View in Genome Browser
Species Human (GRCh38)
Location 16:56695694-56695716
Sequence AGGGCACACCGATTGGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138394809_1138394811 -9 Left 1138394809 16:56695694-56695716 CCATGGGCCAATCGGTGTGCCCT 0: 1
1: 0
2: 5
3: 28
4: 120
Right 1138394811 16:56695708-56695730 GTGTGCCCTTCCTCCCTTCAAGG 0: 1
1: 0
2: 1
3: 28
4: 269
1138394809_1138394822 29 Left 1138394809 16:56695694-56695716 CCATGGGCCAATCGGTGTGCCCT 0: 1
1: 0
2: 5
3: 28
4: 120
Right 1138394822 16:56695746-56695768 GACCGAGCTGAGCAGACTACAGG 0: 1
1: 0
2: 0
3: 11
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138394809 Original CRISPR AGGGCACACCGATTGGCCCA TGG (reversed) Intronic
900234006 1:1577947-1577969 AGTGTATACTGATTGGCCCATGG - Intergenic
902875230 1:19337025-19337047 AGGGCACACAGGTGGGCCTAGGG - Intergenic
903337502 1:22634982-22635004 AGTGCATACTGATTGGTCCATGG + Intergenic
905588449 1:39141039-39141061 AGGGCATAGTGATTTGCCCAGGG + Intronic
905923549 1:41734359-41734381 ATGGCCCAGCGTTTGGCCCAGGG + Intronic
907338056 1:53713481-53713503 GGGGCTCACCGTTTTGCCCAGGG - Intronic
909599646 1:77448281-77448303 AGGGCATGCTGATTGGCCCATGG - Intronic
915185091 1:154098678-154098700 AGTCCACACTGATTGGTCCATGG + Intronic
1065156575 10:22875666-22875688 AGGCCACACCGATAGGCTCAAGG - Intergenic
1066105405 10:32152004-32152026 AGGCCATAGCGATTGGCCCAGGG + Intergenic
1071447607 10:85763248-85763270 AAGGCACACCCATCTGCCCAAGG + Intronic
1072335589 10:94395477-94395499 AGTGCTCACCAATTGGTCCATGG + Intergenic
1072753325 10:97999747-97999769 AGTGCACGCCAATTGGTCCATGG - Intronic
1074623763 10:115154887-115154909 ACGGCCCAAAGATTGGCCCAGGG + Intronic
1080731549 11:34960479-34960501 AGGGCACAGCCACTGGCCCTCGG + Exonic
1081082238 11:38756554-38756576 AGTACACACCAATTGGTCCATGG + Intergenic
1082687695 11:56260363-56260385 AGTGCATGCTGATTGGCCCATGG + Intergenic
1082779439 11:57275295-57275317 AGGCCACAGTGATTGGCCCAGGG - Intergenic
1084469472 11:69348668-69348690 AGTGCACACCGATTGGTCCATGG + Intronic
1084686532 11:70699094-70699116 AGGGCAGCCCGCTTGGCTCATGG + Intronic
1085212174 11:74791263-74791285 AGTGCATACTGATTGGTCCATGG + Intronic
1085328938 11:75631071-75631093 CGGGCACACCACTTGGCTCAAGG + Intronic
1085334215 11:75678827-75678849 AGTGCATACTGATTGGTCCATGG + Intergenic
1085404389 11:76253232-76253254 AGCACACAGTGATTGGCCCATGG + Intergenic
1090359531 11:126162876-126162898 AGGGCACCCCGATCGTCCCAAGG - Intergenic
1090514645 11:127412291-127412313 AGTGCACTCCAATTGGTCCATGG + Intergenic
1090717789 11:129445404-129445426 AAGGCACACGCATTGGCCCACGG - Intronic
1092002562 12:5044267-5044289 TGGGCTCAGCGATGGGCCCAAGG + Exonic
1093783571 12:23166359-23166381 AATGCATACCCATTGGCCCAGGG - Intergenic
1096555888 12:52403536-52403558 AGGGCACCCCACTTGGCACACGG - Intronic
1100931299 12:99612975-99612997 AGGGCATTCCCATTGGCTCAGGG - Intronic
1101580876 12:106040091-106040113 AGTGCATGCTGATTGGCCCATGG + Intergenic
1104668044 12:130661301-130661323 TGGGCACAGTGATTGGCTCAGGG + Intronic
1104939912 12:132390175-132390197 AGGGCACAGCCATGGGCCGATGG + Intergenic
1107835909 13:44412490-44412512 TGGACACACCGCTTGGCCCAGGG - Intergenic
1108464079 13:50696743-50696765 AGTGCATGCTGATTGGCCCATGG + Intronic
1110439114 13:75507860-75507882 AGTGCATACTGATTGGCTCATGG + Intergenic
1110939454 13:81330866-81330888 AGGGCATGCTGATTGGTCCATGG - Intergenic
1110967972 13:81725499-81725521 AGTGCATACTGATTGGTCCATGG - Intergenic
1111091500 13:83452982-83453004 AGGGCATGCTGATTGGTCCATGG - Intergenic
1111268843 13:85853848-85853870 AGTGCATGCTGATTGGCCCATGG - Intergenic
1113428715 13:110230895-110230917 AGGGCACACCCGTTTACCCAGGG + Intronic
1122491262 14:102117374-102117396 AGTGCACACTGATTGGTCCATGG - Intronic
1123030803 14:105450205-105450227 AGGGCAGCCCGAGGGGCCCAGGG - Intronic
1127525916 15:59792029-59792051 AGTGCATACTGATTGGTCCATGG + Intergenic
1131999286 15:98163224-98163246 AGTGCATGCCGATTGGCCCATGG + Intergenic
1138329632 16:56203307-56203329 TGGCCACAGTGATTGGCCCAGGG + Intronic
1138394809 16:56695694-56695716 AGGGCACACCGATTGGCCCATGG - Intronic
1142954530 17:3512396-3512418 CTGGCACACAGAGTGGCCCAGGG + Intronic
1144836763 17:18160596-18160618 TGGCCACAGTGATTGGCCCAGGG - Intronic
1146093511 17:29905790-29905812 AGTGCATGCAGATTGGCCCATGG - Intronic
1147743894 17:42683584-42683606 AGGCTACACCTATAGGCCCAAGG - Intronic
1147849075 17:43427304-43427326 AGGGAAGACCGCTTGGGCCAGGG - Intergenic
1148847490 17:50537934-50537956 CTGGCACACTGCTTGGCCCACGG + Intronic
1149085469 17:52710325-52710347 AGGGCATGCAGATTGGTCCATGG - Intergenic
1150529155 17:65958877-65958899 AGTGCACACTGATTGGTCCATGG - Intronic
1150714057 17:67556545-67556567 AGGGCACACTGATGGGCCAAGGG + Intronic
1151890430 17:76948024-76948046 AGGGCTCACAGATTAGCCCGTGG - Exonic
1154127456 18:11704408-11704430 AAGGCACAACTAATGGCCCAGGG + Intronic
1159519070 18:69495555-69495577 AGTGCACACTGATTGGTCCATGG + Intronic
1159623871 18:70669665-70669687 AGTGCACACCGATTGGTCCATGG - Intergenic
1161219010 19:3109405-3109427 TGGGCACACTGATGGTCCCAGGG - Intronic
1162039061 19:7958334-7958356 TGGGCCCACCGAGTGGCCCCTGG - Intergenic
1162263660 19:9552586-9552608 AGTGCATGCCAATTGGCCCATGG + Intergenic
1164522824 19:28991823-28991845 AGGCCACAGGGATTGGCTCATGG + Intergenic
1164752661 19:30668333-30668355 AGGGGCCCCTGATTGGCCCAGGG - Intronic
1165022643 19:32936568-32936590 AGTGCGCACCGATTGGTCCATGG - Intronic
1166548402 19:43648676-43648698 AGAGCTCTCCCATTGGCCCACGG + Exonic
1166898151 19:46036795-46036817 AGTGCATACCAATTGGTCCATGG - Intergenic
1168630188 19:57950315-57950337 AGTGCATGCTGATTGGCCCATGG + Intergenic
925628079 2:5862157-5862179 AGGGCATGCTGATTGGTCCATGG - Intergenic
926803524 2:16683658-16683680 TGGGCACACTCATTGGCACAGGG + Intergenic
927226198 2:20767749-20767771 AGTGCCCACTGATTGGTCCATGG - Intronic
927458198 2:23275480-23275502 AGCCCACACGGATTAGCCCAGGG + Intergenic
927533844 2:23836861-23836883 AGTGCACACCAATTGGTCCATGG + Intronic
937866377 2:126754362-126754384 AGGGCCCACCACTTGTCCCATGG - Intergenic
943023465 2:182601881-182601903 AAGTCACACCAATTGGTCCATGG + Intergenic
943182346 2:184560499-184560521 AGTGCACGCCAATTGGTCCATGG + Intergenic
943858430 2:192828484-192828506 AGGGCATGCTGATTGGGCCATGG - Intergenic
944146760 2:196514591-196514613 AGTGCATGCCGATTGGTCCATGG - Intronic
949003289 2:241630124-241630146 AGTGCACACAGATTGGGCGAGGG - Intronic
1170573977 20:17648845-17648867 AAGGCACACAGGCTGGCCCAAGG + Intronic
1171322017 20:24254646-24254668 AGGTTTCACCGATTGGCTCATGG - Intergenic
1172340975 20:34157371-34157393 AGGGCCCGCAGATTGGTCCAGGG - Intergenic
1172347050 20:34209934-34209956 AGTGCACACTGATTGGTCCATGG - Intronic
1172676704 20:36677426-36677448 AGTGCATGCTGATTGGCCCATGG - Intronic
1173626380 20:44476000-44476022 AGGGCACACGGATGGGCTCGCGG - Intronic
1176993108 21:15522115-15522137 AGTGCATGCTGATTGGCCCATGG + Intergenic
1178015821 21:28344978-28345000 AGGGCACACATATTGTTCCAAGG - Intergenic
1178819721 21:35964003-35964025 AGGGCCCACAGATTGGTTCAAGG + Intronic
1179798551 21:43799657-43799679 AGGGCACAGCCATGAGCCCAGGG - Intronic
1181859151 22:25804965-25804987 AGGGCTCAGCGAAGGGCCCATGG + Intronic
1183726670 22:39593797-39593819 AAGGGAAACAGATTGGCCCAAGG - Intronic
1184828795 22:46970981-46971003 AAGGCACACAGAGTGGCACAGGG - Intronic
1185319972 22:50196146-50196168 AGGGCACAGCGAGTGTCCCCCGG - Intronic
954099368 3:48357729-48357751 AGTGCACACCAGTTGGTCCATGG + Intergenic
955530585 3:59868929-59868951 TGGCCACAGCGATTGGCCCAAGG - Intronic
956728499 3:72176465-72176487 CTGGCACACTGCTTGGCCCATGG + Intergenic
965261329 3:166489584-166489606 AGGGCACACTGAATGGCAGAAGG + Intergenic
965984650 3:174736639-174736661 AGTGCATACTGATTGGCTCATGG + Intronic
966205290 3:177399902-177399924 AGGGCACACCTCTTCCCCCAAGG + Intergenic
967649865 3:191973394-191973416 AGTGCACACCGATTAGTTCATGG + Intergenic
967820850 3:193837398-193837420 AGGGCACACTGAGTGCCGCATGG - Intergenic
967999723 3:195196462-195196484 GGGGCATACCTATTGCCCCAGGG - Intronic
974894445 4:67922128-67922150 AGGTCACATTGAGTGGCCCAAGG + Intronic
975254342 4:72216189-72216211 AGTATACACCGATTGGTCCATGG + Intergenic
975597774 4:76066645-76066667 AGTGCACACTGGTTGGCCCATGG + Intronic
976700805 4:87966735-87966757 AGTGCACACCAATTGGTCCATGG - Intergenic
979649492 4:123114196-123114218 AGTGCATGCCGATTGGTCCATGG + Intronic
984102101 4:175499272-175499294 AGGGCATGCTGATTGGTCCATGG + Intergenic
987623994 5:20374075-20374097 TGTGCACACCATTTGGCCCAGGG - Intronic
988073746 5:26326023-26326045 AGTGCATGCCGATTGGTCCATGG + Intergenic
988093197 5:26569088-26569110 AGTGCACACAGATTGGTCCATGG + Intergenic
996923845 5:128800037-128800059 AGTGCACACCGATTGGTCCATGG + Intronic
997232502 5:132254861-132254883 AGGCCACACCCAGTGGCTCAGGG - Intronic
999375902 5:151086334-151086356 AGGGCACAGGGAGTGGGCCAAGG - Intronic
1002647678 5:180669071-180669093 TGGCCACAGCGATAGGCCCAAGG + Intergenic
1002693379 5:181066539-181066561 AGTGCATGCCGATTGGTCCATGG + Intergenic
1004318691 6:14615127-14615149 AAAGCACACGGATTAGCCCATGG + Intergenic
1006404309 6:33835282-33835304 AGGCCACAGGGATTGGTCCAGGG - Intergenic
1006582394 6:35084447-35084469 AGGGAACAGGGACTGGCCCAGGG + Intronic
1007850661 6:44799647-44799669 AGGCCACACAGATTGAACCATGG - Intergenic
1009610153 6:65930981-65931003 AGTGCACACCAATTGGTCCATGG + Intergenic
1010887591 6:81263415-81263437 AGGGCAAGCTGATTGGTCCATGG + Intergenic
1013829099 6:114251620-114251642 AGGCCACACCAATTGGTTCAGGG + Intronic
1017420499 6:154267946-154267968 AATGCACACAGATTGGTCCATGG + Intronic
1017841791 6:158228307-158228329 AAGGCACAGAGTTTGGCCCACGG + Intergenic
1019281313 7:201629-201651 AGGCCACACCGATTGGGGCCTGG + Intronic
1020145665 7:5640443-5640465 AGGTGACAGCGATTGGCCCAGGG - Intronic
1021604059 7:22393115-22393137 AGGGCACACCATTTGGACCAGGG + Intergenic
1022487825 7:30794026-30794048 AGGGCACACAGACTGGCAAATGG + Intronic
1023981641 7:45073955-45073977 AGGGCACAGGCATTGGCCCCGGG + Intronic
1028527395 7:91801283-91801305 AGTGCACACTGATTGGTCCATGG + Intronic
1029899318 7:104022541-104022563 AGTGCACACTGATTGGTCCATGG - Intergenic
1034489619 7:151386348-151386370 TGGGCACAGTGATTGGCCCAAGG - Intronic
1036418281 8:8571283-8571305 AGGCCACACAGATTGGCACTGGG + Intergenic
1041357264 8:57014116-57014138 AGTGCACACTGATTGGCCCATGG + Intergenic
1046777735 8:118181487-118181509 TGGACACACTGATTGGGCCAAGG + Intergenic
1047390766 8:124449172-124449194 AGTGCACACCAAGTGGCCAATGG + Intergenic
1050908929 9:11041346-11041368 AGAGCAGACCCATTGGCCAAAGG - Intergenic
1052996846 9:34555736-34555758 AGGGCTCACAGATGGGCCCAAGG - Intronic
1053003251 9:34589441-34589463 AGGGGACACCCGTGGGCCCACGG - Intronic
1053222653 9:36325080-36325102 AAGGCACACCCATGGGCACAGGG + Intergenic
1055572637 9:77632430-77632452 AGTGTGCACCGATTGGTCCATGG - Intronic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1058871229 9:109203230-109203252 AGGGCACATCAATGGGCCAAGGG + Intronic
1059104804 9:111501872-111501894 AGCGCATACTGATTGGTCCATGG - Intergenic
1061620403 9:131807885-131807907 AGGGGTCCCCTATTGGCCCAGGG - Intergenic
1187871212 X:23766803-23766825 AGTGCATGCTGATTGGCCCATGG + Intergenic
1188859859 X:35244044-35244066 AGTGCACACTGATTGGTCCATGG + Intergenic
1192265322 X:69533729-69533751 AGTGTGCACCGATTGGCCCATGG + Intergenic
1195655039 X:107324995-107325017 AGTGCACACCGATTGGTCCATGG - Intergenic
1197795975 X:130299316-130299338 AGTTCATACCGATTGGTCCATGG + Intergenic
1199548590 X:149033738-149033760 AGGGCACACTTCTTGGGCCAAGG - Intergenic