ID: 1138398564

View in Genome Browser
Species Human (GRCh38)
Location 16:56727435-56727457
Sequence AACAGAATCCTGTTTTTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 1, 2: 1, 3: 33, 4: 394}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138398564_1138398569 13 Left 1138398564 16:56727435-56727457 CCTTTGAAAAACAGGATTCTGTT 0: 1
1: 1
2: 1
3: 33
4: 394
Right 1138398569 16:56727471-56727493 GACCCAGTAGGACTAAATGAGGG 0: 1
1: 0
2: 0
3: 9
4: 76
1138398564_1138398567 1 Left 1138398564 16:56727435-56727457 CCTTTGAAAAACAGGATTCTGTT 0: 1
1: 1
2: 1
3: 33
4: 394
Right 1138398567 16:56727459-56727481 AATAATGTTTGGGACCCAGTAGG 0: 1
1: 0
2: 2
3: 19
4: 257
1138398564_1138398568 12 Left 1138398564 16:56727435-56727457 CCTTTGAAAAACAGGATTCTGTT 0: 1
1: 1
2: 1
3: 33
4: 394
Right 1138398568 16:56727470-56727492 GGACCCAGTAGGACTAAATGAGG 0: 1
1: 0
2: 1
3: 5
4: 79
1138398564_1138398565 -10 Left 1138398564 16:56727435-56727457 CCTTTGAAAAACAGGATTCTGTT 0: 1
1: 1
2: 1
3: 33
4: 394
Right 1138398565 16:56727448-56727470 GGATTCTGTTAAATAATGTTTGG 0: 1
1: 0
2: 0
3: 16
4: 247
1138398564_1138398566 -9 Left 1138398564 16:56727435-56727457 CCTTTGAAAAACAGGATTCTGTT 0: 1
1: 1
2: 1
3: 33
4: 394
Right 1138398566 16:56727449-56727471 GATTCTGTTAAATAATGTTTGGG 0: 1
1: 0
2: 2
3: 32
4: 352
1138398564_1138398572 17 Left 1138398564 16:56727435-56727457 CCTTTGAAAAACAGGATTCTGTT 0: 1
1: 1
2: 1
3: 33
4: 394
Right 1138398572 16:56727475-56727497 CAGTAGGACTAAATGAGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 219
1138398564_1138398573 22 Left 1138398564 16:56727435-56727457 CCTTTGAAAAACAGGATTCTGTT 0: 1
1: 1
2: 1
3: 33
4: 394
Right 1138398573 16:56727480-56727502 GGACTAAATGAGGGAAGGTAAGG 0: 1
1: 0
2: 5
3: 52
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138398564 Original CRISPR AACAGAATCCTGTTTTTCAA AGG (reversed) Intronic
902997369 1:20237076-20237098 AAAACAAGACTGTTTTTCAAAGG - Intergenic
906675446 1:47690194-47690216 ACCAGCCCCCTGTTTTTCAAGGG + Intergenic
906935801 1:50213077-50213099 AACAGAATCCTGATTTTTTTAGG + Intergenic
907767883 1:57428331-57428353 AATAGAATCATGTTTGTCCAGGG - Intronic
907811860 1:57878987-57879009 AACAAAATCCTGTCATTCACAGG - Intronic
908425261 1:64001222-64001244 AAAAGAAGCCAGTTTTTAAAAGG + Intronic
911532027 1:99054401-99054423 TAGAAAATCCTGTTTTCCAATGG - Intergenic
912077182 1:105889451-105889473 CAAAGAATCCAGTTTTTAAAAGG - Intergenic
912127306 1:106555067-106555089 GACTGAGTCCTTTTTTTCAAGGG - Intergenic
912145419 1:106788065-106788087 AAAAGAATCCTGTTTTCTTAAGG + Intergenic
912175124 1:107145283-107145305 AACAAATTCCTGATTTTCAGAGG + Intronic
912878044 1:113382563-113382585 CACAGTATCCTGTCTTTGAATGG + Intergenic
912964353 1:114224531-114224553 AACAGCATGCTGTTCTGCAAAGG + Intergenic
913560928 1:120018709-120018731 AAAAGAATCTTGTGTTTAAAAGG + Intronic
913637200 1:120774893-120774915 AAAAGAATCTTGTGTTTAAAAGG - Intergenic
914340972 1:146760251-146760273 AACAGAATGATGGTTTCCAAGGG + Intergenic
914542558 1:148629057-148629079 AAAAGAATCTTGTGTTTAAAAGG + Intronic
914624075 1:149442187-149442209 AAAAGAATCTTGTGTTTAAAAGG - Intergenic
915263740 1:154699091-154699113 AACAGAAAAATGTTTTCCAAAGG + Exonic
916693620 1:167215178-167215200 TAGAGTATCCTGTTTTTCCAAGG - Intergenic
917511924 1:175675893-175675915 GACAGAATCCAGTGTTTCCAGGG - Intronic
918088993 1:181271532-181271554 AATAAGGTCCTGTTTTTCAAGGG - Intergenic
919190161 1:194206034-194206056 AAGAATATCCTGTTTTTAAAGGG - Intergenic
919704265 1:200661253-200661275 CACAGCTTCCTGTTATTCAAAGG - Intronic
920106473 1:203556756-203556778 AACCAGATCCTGTTGTTCAAGGG + Intergenic
921542593 1:216434307-216434329 AACAGAATGCTGACTTTTAAAGG - Intergenic
923330765 1:232922356-232922378 AAAATAATACTGTTTTTCAAAGG + Intergenic
923488174 1:234456889-234456911 AACAAAATTCTATTTTTTAAAGG + Intronic
1063003184 10:1944105-1944127 AACAGAATCATGTTGTTCTGTGG - Intergenic
1063553427 10:7055035-7055057 GCCAGAATCCTTTCTTTCAAAGG + Intergenic
1064573654 10:16722226-16722248 AACAGAGTACTGTTTTTCTAGGG + Intronic
1065278882 10:24114709-24114731 AACTGATTTGTGTTTTTCAAAGG - Intronic
1065569968 10:27060391-27060413 AACAGAATCTTTCATTTCAATGG + Exonic
1066335112 10:34468520-34468542 AGCAGAATCCAGTTTATCAGTGG - Intronic
1067520509 10:46998456-46998478 AACAGATTACTATTTTCCAAGGG + Intronic
1068311227 10:55278758-55278780 AACATAATCCTCTGATTCAATGG - Intronic
1069253172 10:66297769-66297791 ACAAGAATCCTGTATTTCTATGG + Intronic
1069752954 10:70756383-70756405 AACAGATTGCTGGTCTTCAAAGG + Intronic
1070372621 10:75798143-75798165 AACAGAATTCAATTTTTAAAAGG - Intronic
1070473321 10:76806717-76806739 TAGAGAATACAGTTTTTCAAAGG - Intergenic
1070598847 10:77851752-77851774 AACAGAAGCAAGTTTTTCAATGG + Intronic
1071046166 10:81381026-81381048 AACTGAATCCTGTATGTTAACGG - Intergenic
1073734697 10:106332444-106332466 AACAAAGCCCTGTTTTCCAAGGG + Intergenic
1074080432 10:110164194-110164216 AAAACAATCCTGTTTTTCCCAGG - Intergenic
1074171126 10:110938083-110938105 AATGGCATCTTGTTTTTCAAGGG + Intronic
1074501822 10:114032389-114032411 ACAAAAATCCTGTTTTTCAATGG + Intergenic
1074751832 10:116594414-116594436 AAAAGAGTCCTGTTTTGAAAAGG - Intronic
1074791244 10:116889686-116889708 GACAGCATGCTGTTTCTCAAAGG + Intronic
1074992352 10:118720769-118720791 AACAAAATCCTTTCTTTCAAAGG + Intronic
1075293037 10:121246813-121246835 AACAAAAATCTTTTTTTCAAAGG + Intergenic
1075326314 10:121534773-121534795 AAAAGAATCCTGGTTTGGAAGGG + Intronic
1077796966 11:5502370-5502392 AAGAGAATCCTGATTTTGACTGG - Intronic
1078118101 11:8476130-8476152 AACAGAATCCTGATCTTCTTTGG + Intronic
1078384729 11:10879458-10879480 ACCAGAATCTTGTTTTCCATTGG - Intergenic
1079421700 11:20297315-20297337 AACTGATTACTGTTTTTCCATGG + Intergenic
1080086507 11:28289057-28289079 AACAGAATCTTGCTATTGAAAGG - Intronic
1085310683 11:75514860-75514882 GACAGCATCCTGTATTTCAGAGG - Intronic
1086437843 11:86799921-86799943 AACAGAAACCTGTATTCCCATGG - Intronic
1086808403 11:91272603-91272625 ATTAGAATCTTATTTTTCAAGGG + Intergenic
1086909053 11:92450934-92450956 AACAGAATCCTGATCTTTACTGG + Intronic
1088029268 11:105226499-105226521 GACAGAAGCCTATTTTCCAAGGG - Intergenic
1088360372 11:108982996-108983018 TTCAGATTCCTGTCTTTCAAGGG + Intergenic
1089414745 11:118278352-118278374 AAGAGAATCCTGTCTTTTAAAGG - Intergenic
1089612131 11:119675251-119675273 AACAGAACCCTCTTCTTCAAGGG - Exonic
1089696856 11:120221202-120221224 CACAGATTCCTGTTTTCCAGGGG - Intronic
1089972705 11:122707163-122707185 CATAGACCCCTGTTTTTCAAAGG + Intronic
1091095783 11:132820967-132820989 AAAAGACTGCTCTTTTTCAATGG + Intronic
1092425101 12:8368763-8368785 ATCATAGTCCTGTTTTTAAATGG - Intergenic
1093334233 12:17881104-17881126 TACAGAATGGTGTTTTTCAGGGG + Intergenic
1093987259 12:25549631-25549653 CCCAGAATTCTGCTTTTCAAAGG + Intronic
1096855197 12:54476238-54476260 AAATCAAACCTGTTTTTCAATGG + Intergenic
1097360553 12:58654529-58654551 AAAAGCATTCTGTTTTTAAAGGG - Intronic
1097552156 12:61087663-61087685 AACTGAATCTTATTTTTTAATGG + Intergenic
1097861973 12:64526958-64526980 GGCAGAATCCTTTTTTTAAAAGG + Intergenic
1098872406 12:75831900-75831922 AACAGAAAGCTGTTTCACAAAGG + Intergenic
1099062057 12:77924057-77924079 AACAAACTCCTGAATTTCAATGG + Intronic
1099745418 12:86696496-86696518 AACAGAATCATATTTCTCAAAGG - Intronic
1099976852 12:89555087-89555109 AAAACAATCCAGTTTTTAAATGG + Intergenic
1100161644 12:91867491-91867513 AAGTGATTCCTGTTTTACAAAGG - Intergenic
1100706936 12:97211039-97211061 AAAAGAATCCTTGGTTTCAATGG - Intergenic
1104279816 12:127366150-127366172 AAAAGAATCCTGATTTGTAATGG - Intergenic
1105621382 13:22070662-22070684 AACTTAATTCTTTTTTTCAAAGG - Intergenic
1105788002 13:23768876-23768898 GACACAATCCTGTATTTCCAGGG - Intronic
1106647552 13:31653042-31653064 AACATAGTCCTCTTTTTCACTGG - Intergenic
1107576127 13:41724697-41724719 AACTGAATCCTGGTTAGCAATGG + Intronic
1108908717 13:55514682-55514704 AACAAACTCATGTTGTTCAAGGG + Intergenic
1109588397 13:64442011-64442033 AGCAGATTCCTCTTTTGCAATGG - Intergenic
1109632554 13:65069974-65069996 AACAAAATGATGTTTTTCAGGGG - Intergenic
1109933879 13:69254449-69254471 AACAGAGTCATGATTTTCAGTGG + Intergenic
1112464415 13:99630986-99631008 AAAAGAATCCTCCTTTCCAAAGG - Intronic
1112682879 13:101787508-101787530 GACACAATCCTTTTTTTCCAGGG - Intronic
1112917403 13:104568612-104568634 AACATATTCCTGTTTTACAAGGG - Intergenic
1114162867 14:20188648-20188670 AACAGAATACTGTTTTGGAGGGG - Intergenic
1115135067 14:30098114-30098136 TTCAAAATCCTGTTTTTCAAGGG - Intronic
1115270058 14:31541508-31541530 AACAGAATCCCGTTTTTATCCGG + Intronic
1115435332 14:33365645-33365667 AACAGAGGCATTTTTTTCAATGG - Intronic
1115517721 14:34202708-34202730 AACAGAATTCTGTCTCTGAAAGG + Intronic
1115744843 14:36426072-36426094 AACAGAACCCTCTTTTCCCAGGG + Intergenic
1115902351 14:38166379-38166401 TACAGAATTCTTTTTTTCAGGGG + Intergenic
1116644364 14:47508024-47508046 AAAAGAATTCTATTTTTGAATGG + Intronic
1117688553 14:58280845-58280867 AACGGAATATTGTTTTGCAATGG - Intronic
1117752887 14:58941739-58941761 CACAGAATCGTGTATTTTAAGGG + Intergenic
1118203801 14:63702787-63702809 TTCAGAATTCTGTTATTCAATGG - Intronic
1118242935 14:64079075-64079097 AAAATAATTCTGTTTTTCCATGG + Intronic
1119297014 14:73541150-73541172 AACAGAATGCACTTATTCAATGG - Intronic
1120490207 14:85168494-85168516 AACAAATTGCTCTTTTTCAATGG + Intergenic
1120828739 14:88979045-88979067 AACAGGAGCCTGTTTTGCAGAGG - Intergenic
1124173592 15:27401328-27401350 AATAGAACCCTGGTTTTTAAAGG - Intronic
1125445183 15:39746636-39746658 AACAGCATCCTGGTAATCAATGG + Intronic
1125750742 15:42026253-42026275 GACAGACCCCTGCTTTTCAAGGG + Intronic
1126331890 15:47541648-47541670 TACAGGATTCTGTTTTTGAATGG - Intronic
1126466682 15:48967045-48967067 AGCAGAACTCTGTTTTCCAAGGG - Intergenic
1126924458 15:53567455-53567477 CAAAAAACCCTGTTTTTCAAAGG + Intronic
1127567622 15:60208047-60208069 AACAGAATCTTGTTTACAAAGGG + Intergenic
1127903829 15:63361298-63361320 CAAAGAACACTGTTTTTCAAAGG + Intronic
1129421714 15:75433130-75433152 AACAGAATCCAGTTCTTAAAAGG - Intronic
1129748811 15:78045254-78045276 AACAGATCCATGTTTCTCAAAGG + Intronic
1131877875 15:96830038-96830060 AGCAGTATCCTATTTTTCACTGG + Intergenic
1132926468 16:2432163-2432185 AACACTATCCTATTTTTTAAGGG - Intronic
1136063059 16:27740080-27740102 AACAGAAACCTCATCTTCAATGG + Exonic
1136671926 16:31866111-31866133 AAGAGAATTCTGTTCTTCTAAGG + Intergenic
1137495705 16:48967577-48967599 AACAGTATTATTTTTTTCAAAGG - Intergenic
1138293684 16:55869098-55869120 AACAGTGTCCTGTTCTTCCAGGG + Intronic
1138398564 16:56727435-56727457 AACAGAATCCTGTTTTTCAAAGG - Intronic
1138863267 16:60785789-60785811 AAGAGAATCATGTATTTCAATGG + Intergenic
1139993313 16:70957155-70957177 AACAGAATGATGGTTTCCAAGGG - Intronic
1140759453 16:78098122-78098144 AACAAAATCCTGTATTTACAAGG - Intergenic
1140795214 16:78431050-78431072 AACAGTCTCATGTTTGTCAAAGG - Intronic
1141333075 16:83129741-83129763 TACAGAATCCTTTTTGTCTAAGG - Intronic
1146286473 17:31577514-31577536 AACAGAATCCTGCTCTCCAGGGG + Intergenic
1146451329 17:32976460-32976482 AACAGCTTCATGTTTCTCAAAGG + Intronic
1146631506 17:34473532-34473554 ACCAGAATTCTTTCTTTCAAGGG - Intergenic
1148367826 17:47069883-47069905 AACAGCATTCATTTTTTCAACGG - Intergenic
1148408340 17:47441233-47441255 ATCAGAATCCATTTTTTCTAGGG - Exonic
1149807148 17:59629333-59629355 ACCAGAATGCTGTTTGGCAAAGG + Intronic
1149862137 17:60127927-60127949 AACACAATCCTGATTTTATAGGG + Intergenic
1150185718 17:63179065-63179087 TACAGAATCCTCTTTTTGAGGGG + Intronic
1150588348 17:66538780-66538802 AGCAGAATTCTGTTTTGCTACGG - Intronic
1150758782 17:67941109-67941131 CAAATAATCCTGTTCTTCAAAGG - Intronic
1152113313 17:78369528-78369550 ACCAGTGTCCTGTTTTTCCAAGG - Intergenic
1152463197 17:80451887-80451909 CACAGGGCCCTGTTTTTCAATGG - Intergenic
1152996803 18:415018-415040 AAGAGGATCCTAATTTTCAAAGG + Intronic
1153419526 18:4888665-4888687 ACCAGATGCTTGTTTTTCAAAGG + Intergenic
1155194887 18:23464678-23464700 TTTAGAATCCTGTTTTTGAAAGG - Intronic
1156208240 18:34908991-34909013 AAAAGAATGCTGTCTTTGAAGGG + Intergenic
1158592801 18:58791700-58791722 AACAGAATTTTGTTTCTCACAGG - Intergenic
1159000925 18:62974471-62974493 AACAGCCTCCCGTTTTACAAGGG - Intronic
1159516540 18:69466144-69466166 AATAGAATAATGTTTGTCAAAGG - Intronic
1160351283 18:78181928-78181950 TGCAGAATGCTGTTTATCAATGG - Intergenic
1162232079 19:9275607-9275629 AGAAGAATCATGATTTTCAATGG - Intergenic
1165686109 19:37821445-37821467 AACAGGATCCAGTTTCTCACAGG + Intergenic
1166209485 19:41296969-41296991 CACAGAATCCTGGCTTACAAAGG - Intronic
1166665359 19:44676573-44676595 AACAGAATTCTGCATTGCAAGGG + Intronic
1167706771 19:51085804-51085826 AAGAGAATCCTTTCTTTAAAGGG + Intergenic
1168441719 19:56373874-56373896 AACAGGATCCTGAATTTAAAAGG - Intergenic
1168587864 19:57608650-57608672 CACTGAATTCTGTGTTTCAAGGG - Intronic
1202646609 1_KI270706v1_random:147719-147741 AACAGACTCCTCATCTTCAATGG + Intergenic
925428085 2:3767797-3767819 AACAGAATCCTGTGTTTTAGGGG - Exonic
925531347 2:4866132-4866154 CAGAAAATCCTGTTTTTCAAGGG - Intergenic
926005834 2:9372968-9372990 AACAAAATGCTGTTATTCGAGGG + Intronic
926406760 2:12561394-12561416 AACAGGAATTTGTTTTTCAATGG + Intergenic
926838716 2:17053625-17053647 AAGAGAATCCTGTTGCTTAATGG + Intergenic
927005977 2:18849381-18849403 AACAGAAACCTTGTTATCAAAGG - Intergenic
928105024 2:28464660-28464682 TACAGAATCCTGTGCTCCAATGG + Intronic
930276635 2:49318974-49318996 AAATGAATCCAATTTTTCAAGGG - Intergenic
930361039 2:50379900-50379922 AACATAATCTTATTTCTCAAAGG - Intronic
930382620 2:50650964-50650986 AATATAAACCTGTTTTTCAGTGG + Intronic
930443475 2:51439669-51439691 CACAAATTGCTGTTTTTCAAGGG - Intergenic
930522598 2:52486299-52486321 AACAGAATCCTTCTGTTTAATGG - Intergenic
930920147 2:56743438-56743460 AACAGTATCCTCTCTTCCAAGGG - Intergenic
931093268 2:58910522-58910544 AACAGATTAATGTTTTACAAGGG + Intergenic
931681783 2:64755978-64756000 AACAGAATGATATTTTTTAAAGG + Intergenic
932742031 2:74298733-74298755 AAAAAAATCCTATTTTTAAATGG + Intronic
932904464 2:75734207-75734229 AACAGCATTCAGTTTTACAAGGG - Intergenic
934471024 2:94536297-94536319 CTCAGAATCCTGTTTTTGATGGG - Intergenic
934509762 2:94928138-94928160 AACAGACTCCTCATCTTCAATGG + Intergenic
935892293 2:107691817-107691839 CAAATAATCCTGTTTTCCAAGGG - Intergenic
937289933 2:120776061-120776083 AACTGGATGCTGTTTTTCCAGGG + Intronic
937600954 2:123731217-123731239 ACCAGACTCTTATTTTTCAAGGG + Intergenic
938235579 2:129703691-129703713 ACCAGTATACTGTTTTTCATAGG + Intergenic
939965388 2:148605436-148605458 AAGACAAACCTGTTTTTAAATGG + Intergenic
940058201 2:149535693-149535715 AGCAGAACTCTGTTTTCCAAAGG - Intergenic
940660643 2:156540777-156540799 AAAAGAATCTTATTTTTCAGTGG + Intronic
940999952 2:160191314-160191336 AACAGAATGCTGATTTTGGAGGG + Intronic
941014704 2:160341973-160341995 GACAGTAACTTGTTTTTCAAAGG + Intronic
941202767 2:162533210-162533232 AACAAAAACCAGTTTTTAAAAGG + Intronic
941525946 2:166607454-166607476 AACAGAATCCTTTTTTTCTTTGG - Intergenic
942003532 2:171675152-171675174 AACAGTATCTTGGTCTTCAAAGG + Intergenic
942511954 2:176711921-176711943 GACAGAATTCTGTCTTTCACAGG - Intergenic
943138906 2:183952948-183952970 AACATAATCTTATTTTTCAATGG + Intergenic
943730745 2:191300968-191300990 AACAGAAAGCTATTTTTGAAAGG - Intronic
944693401 2:202179099-202179121 AACACAAAACTGTTTTTGAAAGG - Intronic
944740858 2:202611249-202611271 AAAGCAATCCTGTTTTTCCATGG - Intergenic
944985780 2:205174885-205174907 AACAGAAACATATTTTTCAAAGG + Intronic
945774430 2:214086912-214086934 AACAAAATCATGTTGTTCATTGG - Intronic
947503901 2:230692279-230692301 TACAGAGTCCAGTTTTTCAGAGG - Intergenic
1168738802 20:169820-169842 AACAGATTCCTGTTTACCCAGGG + Intergenic
1169759000 20:9070515-9070537 TCCAGAATGCTGTTTTTCATAGG + Intronic
1169936835 20:10892729-10892751 ATCAGAATTGTGTTTTTCAAAGG + Intergenic
1172134128 20:32675785-32675807 ATCAGAATTGTGTTGTTCAAAGG - Intergenic
1172989235 20:39020638-39020660 AAAAGAATCCTGTTTCTAAATGG - Intronic
1173634614 20:44544272-44544294 AACACAATTCTGTTTCTGAATGG - Intronic
1173646242 20:44634828-44634850 GCCAGAATCCTGTTATTCAGAGG - Intronic
1174683064 20:52426746-52426768 AACAGAATGGTGATTTTCATGGG + Intergenic
1174770471 20:53294836-53294858 ATGGGAATCCTGCTTTTCAAAGG - Intronic
1175025005 20:55892788-55892810 AACAGCATTCGATTTTTCAATGG + Intergenic
1175296308 20:57911135-57911157 ATCAGAGTCCAGGTTTTCAATGG - Intergenic
1176605262 21:8825045-8825067 AACAGACTCCTCATCTTCAATGG - Intergenic
1176983188 21:15406511-15406533 ACCAGAATTGTATTTTTCAAAGG - Intergenic
1177928991 21:27256421-27256443 AAAAGATTGCTGTTTTTCACTGG - Intergenic
1178143251 21:29707832-29707854 AACATAATCCACCTTTTCAATGG + Intronic
1178503898 21:33147811-33147833 AAGAGAATTCTCTTTTTTAAAGG - Intergenic
1180111469 21:45656693-45656715 AAGACAATCCAGTTTTTAAATGG - Intronic
1180347556 22:11716650-11716672 AACAGACTCCTCATCTTCAATGG - Intergenic
1180355094 22:11832830-11832852 AACAGACTCCTCATCTTCAATGG - Intergenic
1180355323 22:11834760-11834782 AACAGACTCCTCATCTTCAATGG - Intergenic
1180382929 22:12157567-12157589 AACAGACTCCTCATCTTCAATGG + Intergenic
1180383157 22:12159501-12159523 AACAGACTCCTCATCTTCAATGG + Intergenic
1182691116 22:32164052-32164074 AACAGAAACGTGTTTTACACTGG + Intergenic
1183309060 22:37099433-37099455 ATCAGACTTCTGTTTTGCAAAGG + Intronic
1185358354 22:50388964-50388986 CACAGAATGTTGTTTTTTAAAGG + Intronic
950944204 3:16927957-16927979 GACAGCAGCCCGTTTTTCAAAGG + Intronic
951837251 3:26996965-26996987 AACAGCATGTTGTTTTTCAGTGG - Intergenic
952436646 3:33277972-33277994 ATCAGAATGCTGATTTTGAAAGG - Intronic
952548250 3:34446417-34446439 AATACATTCCGGTTTTTCAAGGG + Intergenic
953812150 3:46122110-46122132 AACAGAATAGTGGTTTTCAGGGG - Intergenic
954532189 3:51330583-51330605 AACAGGAACCTGTCTCTCAAAGG - Intronic
954904115 3:54045019-54045041 AACTGACTCCTGCTTTTAAAAGG - Intergenic
957118380 3:76056940-76056962 AACATAATCATTTTTTTAAAAGG - Intronic
957751618 3:84426122-84426144 TACACAATCCTGCTTTTGAAAGG - Intergenic
958118960 3:89259988-89260010 AGCAGCATCTTCTTTTTCAAAGG + Intronic
958667095 3:97155273-97155295 AACAGAATCCATTTTTTGAGGGG - Intronic
959394774 3:105823695-105823717 AAAAGCCTCCTCTTTTTCAAAGG - Intronic
959552563 3:107679607-107679629 AACAGAATCCTGTTGTTTCTGGG - Intronic
959768038 3:110057183-110057205 AACAAAATTCTTTTTTTCAGAGG + Intergenic
960364827 3:116758330-116758352 TCCAAAATCCTGTTTTTGAAGGG - Intronic
960641625 3:119830017-119830039 AACAGAGTTCTCTTTTTCAGAGG + Intronic
960924845 3:122784234-122784256 AATAGTATTCTGTTTTTCATGGG + Intronic
961031884 3:123613299-123613321 ATAAGAATCCTGGTTTACAAAGG + Exonic
961070038 3:123915364-123915386 ATCAGAATCCTGTTTTGAAAGGG + Exonic
962476896 3:135762835-135762857 TTAAGAAACCTGTTTTTCAAAGG - Intergenic
963309876 3:143698345-143698367 ACCAGCACTCTGTTTTTCAAAGG - Intronic
963313288 3:143731630-143731652 AAGAGAATCATGTTTGTCACGGG - Intronic
963890817 3:150634282-150634304 AACAAAATTGTGTTTTGCAATGG - Intergenic
964194017 3:154040712-154040734 AGCAGAATGATGTTTGTCAAGGG + Intergenic
964912184 3:161796846-161796868 AGTAGAAACCTGTTTTGCAATGG - Intergenic
967044561 3:185724826-185724848 TACAGAATTCCGTCTTTCAATGG - Intronic
969740407 4:9021376-9021398 ATCATAGTCCTGTTTTTAAATGG + Intergenic
969898440 4:10326461-10326483 AATAGAAACCTGTTCTTCCAAGG - Intergenic
971445590 4:26743718-26743740 AATAGAATTTTGTTTTTTAATGG - Intronic
972906702 4:43758982-43759004 AACAGAATCCAGTTTCTGATTGG + Intergenic
973234492 4:47884647-47884669 GACAGAATCCAGTTTATAAATGG + Intronic
973372842 4:49265862-49265884 AACAGACTCCTCATCTTCAATGG + Intergenic
973388155 4:49529201-49529223 AACAGACTCCTCATCTTCAATGG - Intergenic
973778956 4:54270611-54270633 AACAAAATCCTTTTTTTAAAAGG + Exonic
974079229 4:57195407-57195429 AAGAGATTTGTGTTTTTCAAAGG - Intergenic
977235578 4:94504010-94504032 AACAGAATTCTGATTATCCAGGG - Intronic
977421339 4:96803563-96803585 AGCATAATACTGTTTTTCATAGG - Intergenic
977954322 4:103009877-103009899 AACAGAATACTCTTTATAAAAGG + Intronic
978203521 4:106051180-106051202 AACAGAATCATGTCTCTCACTGG + Intronic
978522015 4:109626486-109626508 AAAAAAATCCTGATTCTCAATGG - Intronic
978633312 4:110773136-110773158 AAGAGAATGCTGTTTTACAGAGG + Intergenic
979269041 4:118737964-118737986 AACAGAATCCTGTTTATATTAGG + Intronic
980295621 4:130912316-130912338 AACAGAATCATGTATTCGAAGGG + Intergenic
980534832 4:134104447-134104469 AGCAGAATCCTCATTTTGAAAGG + Intergenic
980966892 4:139530662-139530684 AACAGAAGTCTGTCTTTCCAGGG + Intronic
981057456 4:140379054-140379076 ACTATAAGCCTGTTTTTCAAAGG - Intronic
982239992 4:153290223-153290245 AGAAGTTTCCTGTTTTTCAAAGG - Intronic
982341997 4:154309890-154309912 TGCAGAAGACTGTTTTTCAAAGG + Intronic
982344811 4:154345565-154345587 AACAAGAGCCTGTTTTGCAAGGG - Intronic
982529833 4:156525668-156525690 AACACAAGGCTGTTTTTCACAGG + Intergenic
983481774 4:168283548-168283570 AAAAGTATCATGTTTTCCAACGG - Exonic
984326957 4:178267551-178267573 ACCAGAAGTCAGTTTTTCAATGG - Intergenic
984469803 4:180154276-180154298 AAAAAAATCCTGTTTTTTTATGG + Intergenic
984684151 4:182646963-182646985 TACAGAATCAGGATTTTCAAGGG - Intronic
985752677 5:1690380-1690402 AAAAAAATCCTGGTTTTCTAGGG + Intergenic
986196482 5:5541120-5541142 ATCAGATACCTGTTTTTCCATGG + Intergenic
987920982 5:24280910-24280932 AATAGAATCTTGTTTTGAAAGGG + Intergenic
988139254 5:27214476-27214498 TACAGAACCTTGTTTTACAAGGG - Intergenic
988212659 5:28226013-28226035 AACAGAATATTATTTGTCAAGGG - Intergenic
988616727 5:32782096-32782118 AACAGAATAATGATTTTCCAGGG + Intronic
988668371 5:33354827-33354849 GGCAGAATTCTGTTTTTGAAGGG - Intergenic
988974414 5:36500708-36500730 AAATGAATCCTATTTTTCAGTGG - Intergenic
989156383 5:38348451-38348473 AGCAGAGTCATGATTTTCAACGG + Intronic
989764205 5:45060573-45060595 AACTGAATCTTGCCTTTCAAAGG - Intergenic
990766946 5:59194664-59194686 TCCAGAATCATGTTTTTCAAGGG + Intronic
991448226 5:66723184-66723206 AACAGATTCCTGATTTAAAATGG - Intronic
992092854 5:73334341-73334363 AACAGAATCCTTTTTCAGAAAGG + Intergenic
992498617 5:77319102-77319124 AAGAGATACCTGCTTTTCAAAGG - Intronic
994056226 5:95419375-95419397 AACAGATTTGTGTTTTTCAAAGG + Intronic
995147283 5:108800710-108800732 AGCACAATCCTCTTTTTAAAAGG - Intronic
995846450 5:116499124-116499146 CACAGAATTCTGTGTTTAAAAGG - Intronic
995984481 5:118152665-118152687 AAAAGCAGCCTATTTTTCAAAGG + Intergenic
997404729 5:133636208-133636230 AACAGAAGCCTGATATTCACTGG + Intergenic
998536565 5:142937692-142937714 AATAGAATACTGTTTGGCAATGG + Intronic
1000627651 5:163557667-163557689 AATAGAATCCTTCTTTTCATGGG + Intergenic
1001337330 5:170809920-170809942 AAAAGAATGGTCTTTTTCAAGGG - Intronic
1001525605 5:172426552-172426574 AACAGAATCCTGACTTCCCACGG + Intronic
1001889153 5:175324558-175324580 GACAGAATCCTGGCTTTCCAAGG - Intergenic
1002929982 6:1626852-1626874 AAAAGAAAAATGTTTTTCAAAGG + Intronic
1003016948 6:2475617-2475639 AACACAAACCTATTTTTCAAAGG - Intergenic
1003160997 6:3634042-3634064 AACAGAATCCTGATTTTGTTTGG - Intergenic
1003994475 6:11525081-11525103 AACAAAATTCTGATTTTAAATGG + Intergenic
1004646125 6:17562490-17562512 AAATGAGGCCTGTTTTTCAAGGG + Intergenic
1005065704 6:21815591-21815613 AACAGAATCTTCTTTTTCAAAGG - Intergenic
1005085640 6:22004149-22004171 AACATAAACCTATTTTCCAAAGG - Intergenic
1007587565 6:43000917-43000939 AACAGGGTCCTGGCTTTCAAAGG + Intronic
1007802220 6:44405284-44405306 AAGAAAATCCTATTTTACAATGG - Intronic
1008562443 6:52735986-52736008 AACAGAATCCTGTTTTTCTATGG + Intergenic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1008767002 6:54929997-54930019 AACATAATCATGTTATTTAAGGG - Intronic
1008850948 6:56020878-56020900 GCCAGAATTCAGTTTTTCAAGGG - Intergenic
1008881174 6:56382050-56382072 AAAAGCATCCTGTTTGACAAGGG + Intronic
1008982193 6:57497424-57497446 AAAAGAAGCTTGTTATTCAAAGG - Intronic
1009170257 6:60390260-60390282 AAAAGAAGCTTGTTATTCAAAGG - Intergenic
1009584270 6:65577226-65577248 AACAAAAACCTGTTGTCCAATGG + Intronic
1010250649 6:73703794-73703816 AACAGAATTTAGTTTTTAAAAGG - Intronic
1010258476 6:73788153-73788175 AACTGAAACGTGTTTTTCACAGG - Intronic
1012937261 6:105380896-105380918 AACACAATTCTGCTTTTCCAAGG - Intronic
1013427009 6:110021404-110021426 CACAGAATCAAGTTTTTCCAAGG + Intergenic
1013585912 6:111578857-111578879 AACAGAATCTAGTTTTACAGTGG + Intronic
1014052619 6:116973298-116973320 AACAGAAGTCTATTTATCAAGGG + Intergenic
1014259596 6:119201108-119201130 GACAGAAGCCTGTTTATTAAAGG + Intronic
1015028127 6:128561794-128561816 AACAGAATATTGTTTTGAAATGG - Intergenic
1015413923 6:132927038-132927060 AATAGGATCCTGTGTTTCAGAGG - Intergenic
1016087021 6:139926848-139926870 AACCGAGACCTGTTTGTCAATGG + Intergenic
1017229500 6:152057428-152057450 AAAATCACCCTGTTTTTCAATGG - Intronic
1017837541 6:158192672-158192694 AACAGAATATTGTTTTTAAGAGG + Exonic
1020983590 7:15103629-15103651 AATAGAATCCTGGTTATCAGAGG + Intergenic
1021088408 7:16451487-16451509 AACATTCTCCTGTTTTTCATAGG + Intergenic
1021338661 7:19436008-19436030 AACAGAATCTGGTTTTTGAAAGG - Intergenic
1022298984 7:29084740-29084762 AAAAGAATTCTATTTTTTAAGGG - Intronic
1023063084 7:36347937-36347959 AACAAGATACTGTTTTTTAAAGG + Intronic
1024188320 7:46977622-46977644 AACAGCATCCTTTTCTTCATGGG - Intergenic
1024413079 7:49069827-49069849 ATCATAATCCTGACTTTCAAGGG + Intergenic
1026391660 7:69908850-69908872 TACAGAATAATGTTTCTCAAAGG + Intronic
1027499943 7:78937258-78937280 AACAGATTTCTTTTTTTCAATGG - Intronic
1027712769 7:81627818-81627840 TACAGAACCATGTTTTTCATAGG - Intergenic
1027906089 7:84184504-84184526 AACAGGATTTTGTTTTTGAAAGG + Intronic
1028042121 7:86065854-86065876 AACAGAATCATGTCTGTAAATGG - Intergenic
1028735110 7:94200831-94200853 AACAGAATACACATTTTCAAAGG - Intergenic
1030179734 7:106693449-106693471 AACAAAAAACTGTTTTTCACAGG + Intergenic
1030579163 7:111331244-111331266 GACAGAATCCTTCTTTTTAAGGG - Intronic
1031606349 7:123772506-123772528 AACAGAAACATTGTTTTCAATGG - Intergenic
1033018526 7:137697345-137697367 AAGAGAATGATGTTTTTCATGGG - Intronic
1033399475 7:141008189-141008211 AAAATAATCTTGTTTTTCTATGG + Intronic
1033889249 7:145988563-145988585 AAAAGATTCCTGGTTTCCAAGGG - Intergenic
1034841979 7:154406775-154406797 AACAGAATGGTGTTTTGCAAAGG - Intronic
1034844633 7:154432931-154432953 ATCAGAATCTTGTTTCTAAATGG + Intronic
1035843929 8:2842854-2842876 AACAGAAGCCTGCTTTTTAAAGG + Intergenic
1036421429 8:8599591-8599613 AAAAAAATACGGTTTTTCAAAGG + Intergenic
1037240565 8:16772511-16772533 AATAGACTCCTTTTTGTCAATGG - Intergenic
1038988699 8:32842195-32842217 AAAAGAATCCTGAATTTTAAAGG + Intergenic
1040847336 8:51857563-51857585 ATTTGCATCCTGTTTTTCAAAGG + Intronic
1041292790 8:56322397-56322419 TATAAAATCATGTTTTTCAAGGG + Intergenic
1041431503 8:57786041-57786063 AACAGAATCCTGTATGCCCAGGG + Intergenic
1042280706 8:67053082-67053104 AAAAGCATTCTGTTTTTAAAAGG - Intronic
1042393079 8:68258167-68258189 TACATAATTCTGTTTCTCAATGG + Intergenic
1043191912 8:77235411-77235433 AATAGTATTCTGTTTTTAAAGGG + Intergenic
1043635116 8:82375365-82375387 AATATAATCCTGTTTTTCCCTGG - Intergenic
1043638309 8:82414587-82414609 AAAAGACTCCTCTTTTTCAAAGG + Intergenic
1044071693 8:87768439-87768461 AACCAAATCATGTTTTTCATTGG - Intergenic
1044433186 8:92132806-92132828 AACAGAATTCTGATTTTCTTTGG - Intergenic
1044444619 8:92260237-92260259 AACACCATCTTGTTTTTCTATGG + Intergenic
1044461734 8:92453223-92453245 AATATAATCTTATTTTTCAATGG - Intergenic
1045034084 8:98164039-98164061 AACAGAATCCTAGTTTGAAAAGG + Intergenic
1045184462 8:99823003-99823025 ATCAGAACACTGGTTTTCAAAGG - Intronic
1046227470 8:111302971-111302993 AGCATAATGCTGTTTTTAAAAGG - Intergenic
1046653762 8:116870980-116871002 AACAGAAGCCTGTTTGGCATAGG + Intronic
1047450200 8:124958608-124958630 AACAGATTAATGTTTCTCAAGGG + Intergenic
1048710025 8:137199464-137199486 AACAGTAACCTGTCTTTCAGAGG + Intergenic
1049289930 8:141796463-141796485 TGCAGAATCCTGAATTTCAAAGG + Intergenic
1050302161 9:4270524-4270546 GACAGAATGCAGTTTCTCAAAGG + Intronic
1051490359 9:17657211-17657233 AACAGACACCTGCTTTTCAAGGG + Intronic
1052034060 9:23660400-23660422 TACAGACTCCTGTTTTTATATGG - Intergenic
1052210241 9:25894525-25894547 AAGAAAATCCTGTTTTTCTGAGG - Intergenic
1052708382 9:32021306-32021328 AACAGTATACTATTTTTCTATGG - Intergenic
1052721455 9:32175786-32175808 AACAGATTTATGATTTTCAAAGG - Intergenic
1054352037 9:64026145-64026167 AACAGACTCCTCATCTTCAATGG - Intergenic
1054729652 9:68688114-68688136 AAGAGAATCCAATTTTTAAATGG + Intergenic
1055262292 9:74451259-74451281 AGCTGACTCCTTTTTTTCAAAGG - Intergenic
1056169306 9:83967489-83967511 AACAGAATAATGTCTTTTAAGGG - Intergenic
1056267087 9:84908133-84908155 AACAGACTCCTTTGTTTGAAGGG - Intronic
1057330635 9:94111517-94111539 AACAAAATCCTGTTTCTCAGTGG + Intergenic
1057372600 9:94487709-94487731 AACAGACTCCTCATCTTCAAAGG - Intergenic
1057742573 9:97724832-97724854 CATAGATTCCTATTTTTCAATGG + Intergenic
1058015609 9:100029331-100029353 AACAAAATCCTATTTTAAAAAGG + Intronic
1058947945 9:109876424-109876446 CAGAGAATCCTGTTTCACAAAGG - Intronic
1059492285 9:114678482-114678504 AACAGAATCCTGAATTACACAGG - Intergenic
1059741183 9:117151474-117151496 AACAGTGTCCTGTTTTAAAAAGG - Intronic
1059912608 9:119062578-119062600 AACAGGATCATGTCTTTCATGGG - Intergenic
1060196554 9:121627761-121627783 AACAGAATCATATTATTCTATGG - Intronic
1203696558 Un_GL000214v1:103884-103906 AACAGACTCCTCATCTTCAATGG + Intergenic
1203552663 Un_KI270743v1:177140-177162 AACAGACTCCTCATCTTCAATGG - Intergenic
1203639715 Un_KI270751v1:179-201 AACAGACTCCTCATCTTCAATGG - Intergenic
1186728117 X:12378570-12378592 GACAGAATCCAGTAATTCAAAGG + Intronic
1187305317 X:18090113-18090135 AACACAATGCTGTTTTTGAGAGG - Intergenic
1187666096 X:21611359-21611381 AACAGAATTCTCTATTTCAGAGG - Intronic
1187800978 X:23062410-23062432 AGGAGAATCATGTTTTCCAATGG - Intergenic
1187884199 X:23873769-23873791 AACAAAATCTTGTTTTTACAAGG - Intronic
1187923979 X:24233727-24233749 AACAGAATCCTGGTATTTTATGG + Intergenic
1189927591 X:45972851-45972873 AAAAGAAGTCTGTTTATCAAAGG - Intergenic
1191024158 X:55895687-55895709 AACAGAATACAGGATTTCAAGGG - Intergenic
1193548772 X:82862845-82862867 AACAGAACAGAGTTTTTCAATGG + Intergenic
1193699840 X:84747286-84747308 AAAAGAAGACTTTTTTTCAAAGG - Intergenic
1193784055 X:85737005-85737027 AACAGACTCCTGTTTGTGAAAGG + Intergenic
1194037433 X:88894314-88894336 AAGTGAATCCTATTTTTAAAAGG + Intergenic
1194171655 X:90592564-90592586 ATCAGAATTCTATTTTTCCAAGG + Intergenic
1194368736 X:93043460-93043482 GATACAATACTGTTTTTCAAGGG + Intergenic
1194912092 X:99658090-99658112 AATAAGATACTGTTTTTCAATGG + Intergenic
1195524002 X:105864959-105864981 AATAGAACCCTGCTTTTCACTGG - Intronic
1196073839 X:111552842-111552864 AACAAAATCCTTTCTTTTAATGG - Intergenic
1196999641 X:121424636-121424658 ATCAGATTCCTCCTTTTCAAAGG - Intergenic
1197168434 X:123405089-123405111 AAAATAATCCTGTTGTCCAAAGG - Intronic
1197260155 X:124308782-124308804 AACAGAAGCCTCTTTCTCACAGG - Intronic
1197366825 X:125573405-125573427 AAGAAAATCCTATTTTTCAAGGG - Intergenic
1197532809 X:127651208-127651230 GACACAATCCTTTTCTTCAATGG + Intergenic
1198101208 X:133423410-133423432 AACAAAATCCTGTCTCTCATGGG + Intergenic
1198233204 X:134713282-134713304 AACAGAATATTATTTTTCATCGG - Intronic
1198452518 X:136781393-136781415 AACAGAAGCCAGATTTTCACTGG - Exonic
1198474925 X:136985864-136985886 AAAATAATCCAGTTTTTAAATGG - Intergenic
1198748766 X:139918298-139918320 AACATAATCCAGTCTTTAAAAGG + Intronic
1198969149 X:142261260-142261282 AACAGAATCCTATTTATCTTTGG - Intergenic
1199182562 X:144875934-144875956 AACAGAATCCTCCTCTGCAAGGG - Intergenic
1199683920 X:150248151-150248173 AATAGAATGGTGGTTTTCAAGGG + Intergenic
1200517886 Y:4170314-4170336 ATCAGAATTCTATTTTTCCAAGG + Intergenic
1200676940 Y:6159788-6159810 GATACAATACTGTTTTTCAAGGG + Intergenic
1201153704 Y:11110783-11110805 AACAGACTCCTCATCTTCAATGG - Intergenic
1201153926 Y:11112715-11112737 AACAGACTCCTCATCTTCAATGG - Intergenic
1201905857 Y:19085016-19085038 AGCAGAAGCCTGTTATTCCAAGG - Intergenic