ID: 1138402074

View in Genome Browser
Species Human (GRCh38)
Location 16:56754587-56754609
Sequence CCCCATGCTTTGGCTCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 260}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138402063_1138402074 22 Left 1138402063 16:56754542-56754564 CCCATTCCAAAAGGGAGAAATTG 0: 118
1: 742
2: 1203
3: 1106
4: 1103
Right 1138402074 16:56754587-56754609 CCCCATGCTTTGGCTCTGCAGGG 0: 1
1: 0
2: 4
3: 25
4: 260
1138402070_1138402074 -2 Left 1138402070 16:56754566-56754588 CCAAAACAAAGGGGCTACAGACC 0: 42
1: 843
2: 1473
3: 1670
4: 1463
Right 1138402074 16:56754587-56754609 CCCCATGCTTTGGCTCTGCAGGG 0: 1
1: 0
2: 4
3: 25
4: 260
1138402064_1138402074 21 Left 1138402064 16:56754543-56754565 CCATTCCAAAAGGGAGAAATTGG 0: 146
1: 1403
2: 1909
3: 1467
4: 1243
Right 1138402074 16:56754587-56754609 CCCCATGCTTTGGCTCTGCAGGG 0: 1
1: 0
2: 4
3: 25
4: 260
1138402066_1138402074 16 Left 1138402066 16:56754548-56754570 CCAAAAGGGAGAAATTGGCCAAA 0: 161
1: 1732
2: 2060
3: 1613
4: 1172
Right 1138402074 16:56754587-56754609 CCCCATGCTTTGGCTCTGCAGGG 0: 1
1: 0
2: 4
3: 25
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138402074 Original CRISPR CCCCATGCTTTGGCTCTGCA GGG Intronic
900029290 1:359262-359284 CCCCAGGCTTTGGCTATGATGGG - Intergenic
900049892 1:588034-588056 CCCCAGGCTTTGGCTATGACGGG - Intergenic
900395593 1:2452042-2452064 CCCCGAGCTTTGGCAGTGCACGG + Intronic
901885829 1:12222395-12222417 CTCCATCCTGTGGCTTTGCAGGG + Intergenic
902261007 1:15224876-15224898 CCCCTTGCTTTGTCTGTGCCGGG - Intergenic
902974348 1:20078187-20078209 CCCCAAGCTTGGGCTATGCCAGG + Intronic
904743375 1:32695606-32695628 CTCCATGCTGGGGCTCTGCTCGG + Exonic
905029312 1:34870812-34870834 CCCCGTGCTCTTCCTCTGCAGGG - Intronic
905477999 1:38242386-38242408 CCCCAAGCTTTGGCACTTGACGG + Intergenic
906796895 1:48703895-48703917 CCCCATCCTTTAGCAATGCATGG - Intronic
908163162 1:61431717-61431739 GCCCATAATTTGGCTATGCAGGG - Intronic
911407905 1:97464998-97465020 CTCCATCCTGTGGCTTTGCAGGG - Intronic
911826272 1:102488813-102488835 TCCCAAGATTTGGCTCTCCATGG - Intergenic
916560764 1:165932613-165932635 CCACAGGCTTGGGCTTTGCAGGG + Intergenic
920305225 1:205014301-205014323 CCCTCTGCTTTGGCTCTGGAAGG + Intronic
920860814 1:209704969-209704991 CCCCATTCTGGGGCTCTTCATGG + Exonic
920952750 1:210587706-210587728 ACCCAAGCCTTAGCTCTGCAGGG - Intronic
921012241 1:211153369-211153391 CCCCCTGCTTTGGCTGGGCGTGG - Intergenic
921939257 1:220823212-220823234 CCCCAAGCATTGCCTCTGCTTGG - Intergenic
923891423 1:238219319-238219341 TCTCTTGCTTTGTCTCTGCATGG - Intergenic
923914971 1:238491893-238491915 CCACATCCATGGGCTCTGCAAGG + Intergenic
924495472 1:244584733-244584755 CCTCATGCTTGGGTTCTGAATGG - Intronic
924789278 1:247229463-247229485 CTTCTTGCTTTGGCTATGCAGGG - Intergenic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063001159 10:1924162-1924184 ACCCTTGTTTAGGCTCTGCAGGG + Intergenic
1066390611 10:34974908-34974930 CCTCATGCTTCGGCCGTGCATGG - Intergenic
1066616672 10:37301843-37301865 GTCCAGGGTTTGGCTCTGCAGGG + Intronic
1069717923 10:70532693-70532715 CCCCATGCTGTGGCCATCCATGG + Exonic
1070177318 10:73982278-73982300 CCTCCTGCTTTGGCTTTGCAAGG + Intergenic
1070762226 10:79031196-79031218 CCCCATCCTCTGGCTCTGAGAGG + Intergenic
1071172136 10:82878864-82878886 CTCCATGATTTGGCTCTGCCTGG + Intronic
1072883271 10:99249262-99249284 TCCACTGCTTTAGCTCTGCAGGG - Intergenic
1074394084 10:113082934-113082956 CCCCATGCTCTGTCTGTGCGAGG + Intronic
1075136597 10:119791984-119792006 CCCAGTGCTCTGCCTCTGCACGG - Exonic
1075389613 10:122083205-122083227 CCCCCTGCCTGGACTCTGCAGGG - Exonic
1075862117 10:125685733-125685755 GCCCATGCTTTGGCTCTGGTTGG + Intergenic
1075948832 10:126460191-126460213 CACCATGCTCTGGCTCAACAGGG - Intronic
1076551129 10:131278793-131278815 TCCCATGCTGGGGCTTTGCAAGG + Intronic
1079306577 11:19328928-19328950 CACCAGGCTCTGGCTCTGCGGGG - Intergenic
1081077355 11:38693508-38693530 ACACATGCATTGGCTGTGCAAGG - Intergenic
1087305486 11:96484671-96484693 CCCCATGCTAGGTCCCTGCATGG + Intronic
1087361741 11:97169289-97169311 CCCCATGCTGTGGCTAGTCATGG - Intergenic
1087895013 11:103577254-103577276 CCTCATGCTTTGGCTGTGCATGG - Intergenic
1087940736 11:104093811-104093833 TCCCACTCTTTGGCTTTGCAAGG + Intronic
1087956499 11:104294737-104294759 CACCTTGCTTGGGCTCTCCAAGG + Intergenic
1090497159 11:127224551-127224573 CCCCATGCTAAAGCTCTGCAGGG + Intergenic
1090686872 11:129131519-129131541 CCACATTCTCTGGCTCTCCAAGG - Intronic
1091814312 12:3424899-3424921 CCTCATGCTTTGGCCATGCGTGG + Intronic
1092415094 12:8284866-8284888 CCTCATGCTTTGGCTGTGCGTGG + Intergenic
1092971907 12:13704259-13704281 GCCCTGGCATTGGCTCTGCATGG - Intronic
1093593905 12:20939547-20939569 TCTCATGCTTTGGCCGTGCATGG + Intergenic
1096789404 12:54035590-54035612 TCCCATGCTGTGGCTGTCCAAGG + Intronic
1096982799 12:55738014-55738036 ACTCATTCTTTGGCACTGCAGGG - Intergenic
1098639342 12:72820812-72820834 CCTCATGCTTTGGCCATGCGTGG + Intergenic
1098771540 12:74559398-74559420 CTCCATACTGTGACTCTGCAGGG + Intergenic
1099675537 12:85755934-85755956 CTCCACCCTGTGGCTCTGCAGGG - Intergenic
1100189928 12:92179647-92179669 CCCCATGACCTGGCTCTGTATGG + Intergenic
1101541224 12:105667230-105667252 CTCCATGATGTGGCTTTGCAAGG + Intergenic
1102219967 12:111187709-111187731 CCCCAGGCTGGAGCTCTGCATGG - Intronic
1103358052 12:120336353-120336375 CTCCATCCTGTGGCTTTGCAGGG + Intergenic
1104293127 12:127487013-127487035 CCTCATGCTTTGGCCATGCGTGG - Intergenic
1107304802 13:39006630-39006652 CCCCTTTCTTTGACTCTGAAAGG + Intergenic
1110992987 13:82068151-82068173 CTCCATGTTTTTGCTTTGCACGG - Intergenic
1111219133 13:85181072-85181094 CCCAAGGCCTTGGTTCTGCAGGG - Intergenic
1111857839 13:93662124-93662146 CCCCAGGCTTGTGCTCTCCAAGG + Intronic
1113912359 13:113849000-113849022 CTTCATGCGCTGGCTCTGCATGG + Intronic
1117388485 14:55240598-55240620 CCCCATGGATGGGCTTTGCAAGG - Intergenic
1117955007 14:61116088-61116110 CCTCATGCTTCGGCCATGCATGG + Intergenic
1119635685 14:76271336-76271358 GCCCATGCTTTGGCTTAGTATGG + Intergenic
1120156355 14:81097616-81097638 CCCTATGCAGTGGCTCTGGATGG + Intronic
1121326340 14:93022030-93022052 CCCAGAACTTTGGCTCTGCAAGG - Intronic
1122080222 14:99262051-99262073 CCCCATGCCTCGGCTTTGCTGGG + Intronic
1124025327 15:25960206-25960228 TCTCATGCTTTGGCTATGGAAGG + Intergenic
1124815555 15:32988267-32988289 CCCAACGCTTTATCTCTGCAAGG - Intronic
1125209925 15:37202601-37202623 CTCCATGATATGGCTATGCAGGG + Intergenic
1127152679 15:56094417-56094439 CCTCATGCTTTTGCTGTGCCTGG - Exonic
1127421591 15:58811632-58811654 CCCCAAGCTATGGCCCAGCAGGG + Intronic
1128148105 15:65343989-65344011 CCCCTGACTTTGGCTCTGCTAGG + Intronic
1128495083 15:68193227-68193249 CCCCCTTCTTGAGCTCTGCAAGG + Exonic
1129058174 15:72837092-72837114 CCCAATGCTGTGGCCCAGCAAGG + Intergenic
1133130375 16:3672981-3673003 CCCCACACTGTGGCTCTGCAGGG + Intronic
1136364223 16:29801613-29801635 CCCCAAGCTCTGGGTCTGCTGGG - Intronic
1138402074 16:56754587-56754609 CCCCATGCTTTGGCTCTGCAGGG + Intronic
1140862597 16:79031242-79031264 CCCCACACGTGGGCTCTGCAGGG - Intronic
1142946457 17:3433382-3433404 CCCCATGCTCTGTCTCTCCGTGG - Exonic
1144219439 17:13086666-13086688 CCGCAGGCTTTGGCTATGCCAGG + Intergenic
1145718404 17:27045404-27045426 CCCCTTTCTTTGACTCTGAAAGG + Intergenic
1146050068 17:29542854-29542876 CCCCTTGCATTGGCCCTGAAGGG - Exonic
1147132536 17:38417942-38417964 TCCCATGCTGTGGCCCTGCAGGG - Intergenic
1147861765 17:43528067-43528089 CCCCACGCTGTGGCCCTGGAGGG - Exonic
1148466684 17:47869160-47869182 CCCCATCCTTTGGGCCTGAAGGG + Intergenic
1150251114 17:63704997-63705019 GCCCAGGCTGTGGCACTGCAGGG - Intronic
1151130262 17:71889570-71889592 CCACCCCCTTTGGCTCTGCAAGG + Intergenic
1151131614 17:71903119-71903141 CTCAGTGCTTTGGCTCTGCTGGG - Intergenic
1151372089 17:73654356-73654378 GCCCATGCTGTTGGTCTGCATGG - Intergenic
1152280718 17:79383602-79383624 TCCCATGCTCTGACTCTGTAAGG - Intronic
1152892366 17:82889943-82889965 CCACATAATGTGGCTCTGCAGGG + Intronic
1152950468 17:83227294-83227316 CCCCAGGCTTTGGCTATGATGGG + Intergenic
1153784151 18:8519255-8519277 CCACATGCCTTGGCTTTCCAAGG + Intergenic
1153910603 18:9703198-9703220 CCCCATGCTTTAACCCTGCAAGG + Intergenic
1153961194 18:10141545-10141567 TCCGAGGCTCTGGCTCTGCAGGG + Intergenic
1154013939 18:10599921-10599943 TCTCATGCTTCGGCTGTGCATGG + Intergenic
1154294213 18:13135443-13135465 CCTCAGGCTTAGGCTCTGGAAGG - Intergenic
1156540384 18:37903813-37903835 CCTCCAGCCTTGGCTCTGCAAGG - Intergenic
1160015113 18:75134208-75134230 CCCCAGGCAGGGGCTCTGCACGG + Intergenic
1160109672 18:76014260-76014282 CCCCATGCTTTGGTACTGGTGGG - Intergenic
1160504246 18:79418117-79418139 CCCCTTCCTGTGGGTCTGCAGGG + Intronic
1161464838 19:4423282-4423304 CTCTTTGCTTTGGCTCTGGAAGG - Intronic
1161999418 19:7733745-7733767 CCCCCTGCCTTGGCTCCCCAAGG - Intronic
1162196633 19:8989898-8989920 CCCCATTCTCTGCCTCTCCAGGG - Intergenic
1162427206 19:10603618-10603640 CCCCTTGGCTGGGCTCTGCAGGG - Intronic
1162928387 19:13942411-13942433 CCCCAGGGATTGGCTCTGGATGG - Intronic
1163855417 19:19697794-19697816 CCCCATCCTGAGGCTATGCACGG + Intergenic
1164324277 19:24178517-24178539 CCCAATGCTTTGCGGCTGCAGGG + Intergenic
1164764999 19:30757691-30757713 CACCATGCTATGGCTATGAATGG - Intergenic
1164784463 19:30919130-30919152 TGCCATGCTTTAGCTTTGCATGG + Intergenic
1165313744 19:35042541-35042563 GCCCCAGCTTTGGCTCTGCCTGG + Intronic
1166078203 19:40426066-40426088 CCCCAGGGATTGGCCCTGCATGG + Intergenic
1166921696 19:46232845-46232867 CCCCATGCTAGGATTCTGCAGGG + Intergenic
925031257 2:651421-651443 CCTCATGCATGGGCTCTGCATGG + Intergenic
925301956 2:2823248-2823270 CCCCACCCCATGGCTCTGCAGGG + Intergenic
926198451 2:10777291-10777313 CCCCTTGCTTGGGCTCAGCCAGG - Intronic
926225238 2:10962258-10962280 CCCCGTGCCTTGACTCTGCTTGG - Intergenic
926491245 2:13528503-13528525 CCTCATGCTTTGGCCTTGCGTGG + Intergenic
926692929 2:15749693-15749715 CCCCAGGCTAAGGCCCTGCAGGG + Intergenic
926733990 2:16058558-16058580 CCCCATGCTCCTGCTCTCCAAGG - Intergenic
927102655 2:19799905-19799927 CTCCAGGCTTTTGCACTGCAGGG - Intergenic
927751550 2:25674094-25674116 CACCGTGGCTTGGCTCTGCACGG - Intergenic
929063140 2:37943876-37943898 CCCCATATCTTTGCTCTGCACGG + Intronic
930518757 2:52436954-52436976 CCTCATGCTTCAGCTGTGCACGG - Intergenic
931698218 2:64888174-64888196 CCTCATGCTTTGGCCATGCGTGG + Intergenic
933935854 2:87203350-87203372 CCTCATGCTTCGGCTATGCATGG + Intergenic
934656732 2:96120306-96120328 CACCATGCTGTGACTCTGCCTGG + Intergenic
935721289 2:105981629-105981651 CCTCATGCTTTGGCCGTGCGTGG + Intergenic
936153483 2:110033970-110033992 CCCCAGGCAGTGGCTCTGCCCGG - Intergenic
936191198 2:110337445-110337467 CCCCAGGCAGTGGCTCTGCCCGG + Intergenic
936357295 2:111762480-111762502 CCTCATGCTTCAGCTGTGCATGG - Intergenic
937238946 2:120447861-120447883 CCCACTTCTTTGGCTCTGTAGGG + Intergenic
937841188 2:126526346-126526368 CCCCATGGTTTTGCTAAGCATGG + Intergenic
938125621 2:128669214-128669236 CGCCATGTTGTGGCACTGCACGG + Intergenic
939479212 2:142728027-142728049 CGCCCTGCTTCGGCTCCGCATGG - Intergenic
940380837 2:153013551-153013573 CCCCTTTCTTTGGCTCGGAAAGG + Intergenic
940605233 2:155915354-155915376 CCCCATGATTTAGCTCTCAAAGG + Intergenic
941016638 2:160364829-160364851 ACAAATGATTTGGCTCTGCAGGG - Intronic
941606598 2:167605107-167605129 CCCAATGCTTTGGCACTGGATGG + Intergenic
942401783 2:175610493-175610515 TGCCAGGCTGTGGCTCTGCAGGG - Intergenic
943408302 2:187515583-187515605 CCTCATGCTTCGGCTGTGCGTGG - Intronic
944990372 2:205229285-205229307 TTCCACGCTTTGGCTCTTCAAGG + Intronic
945892356 2:215443216-215443238 CCCCAGGCTTTGGTCCTCCAAGG + Intergenic
946634742 2:221712257-221712279 TCCAATGCTTTAGCACTGCATGG + Intergenic
947362220 2:229357477-229357499 CCCCCTCCTTTGCCTCTGCAAGG - Intergenic
947595121 2:231406254-231406276 CCTCATGCTTTGGCCGTGCGTGG - Intergenic
947821683 2:233075843-233075865 CCCTGTGCATTGGCTATGCAGGG + Intronic
948051836 2:234984450-234984472 CCCCCTGCTTTGGCTGTCCAAGG + Intronic
948292366 2:236835289-236835311 CCCTATTCTGTGGCTCTGCAGGG + Intergenic
1169227240 20:3864403-3864425 CCCCTGGCTTGGCCTCTGCAGGG + Exonic
1169332116 20:4724382-4724404 CCCCATGTTTGGGTTGTGCAGGG - Intronic
1171408724 20:24931597-24931619 CCTCATGCTTCGGCTGTGCGTGG - Intergenic
1172998615 20:39089746-39089768 CCCCATGCTCTGGTTTAGCAAGG - Intergenic
1174133278 20:48360550-48360572 CCCCACGCTGTGGCCCCGCAGGG + Intergenic
1174441737 20:50561085-50561107 CCCCATGCCTTTGCTGTGCAGGG + Intronic
1177358407 21:20037931-20037953 CTCCACCCTGTGGCTCTGCAGGG - Intergenic
1179548640 21:42128732-42128754 CGCCAGGCTTCGTCTCTGCAGGG + Intronic
1181021996 22:20108366-20108388 CCCCAAGCTGTGGCTGTGCCTGG - Intronic
1181235900 22:21447480-21447502 CCCCCGGCTCTGGCGCTGCAGGG + Exonic
1181641896 22:24205779-24205801 CCCCCTGCTCTGTCTCTGTAAGG - Intergenic
1182135302 22:27896713-27896735 ATCCATGCTTTGACTCTACAAGG + Intronic
1182499921 22:30739286-30739308 TCCCATTCTCTGGCTCTACATGG - Intronic
1183034942 22:35134386-35134408 CCCCTTGCTTTGGCTGGGCTCGG + Intergenic
1183250335 22:36725799-36725821 CCCCAGGCTTTGCCTCTGGGCGG + Intergenic
1183405329 22:37627738-37627760 CCCCATGCTTTGCCTCTGAGAGG - Intronic
1183589983 22:38774396-38774418 TCTCCTGCTTTGGCTCTGCAGGG + Intronic
1184017298 22:41795727-41795749 TCCCATGCTCTGGAGCTGCAGGG - Exonic
1185174872 22:49320848-49320870 CTCCGTGGTTTGGCTCCGCAGGG + Intergenic
949482047 3:4503296-4503318 CCCCATCCTGTGGCTCACCAGGG - Intronic
949682287 3:6528006-6528028 GCCTATGCTTTGTCTCTGTAAGG - Intergenic
954587767 3:51751576-51751598 CCCCATGCAGTGGCCCTGCAGGG - Intergenic
955850764 3:63217488-63217510 CCCCTTTCTTTGACTCTGAAAGG + Intergenic
956084456 3:65595557-65595579 GCCCATGCTTTTGCTCAGCAAGG + Intronic
956727057 3:72164783-72164805 CCCCATGCTGTCTCACTGCAGGG - Intergenic
956978763 3:74613470-74613492 CCCCTTTCTTTGCCTCTGAAAGG + Intergenic
957999706 3:87736109-87736131 CCTCATGCTTCGGCCATGCATGG + Intergenic
958165880 3:89877370-89877392 CCCTGTGCCTTGACTCTGCAGGG + Intergenic
958843764 3:99240816-99240838 CCCCAGAGTTTGGCTCTGCTTGG + Intergenic
962123065 3:132584706-132584728 ACTCATGATTTGGCTCTGAAAGG - Intronic
963301138 3:143598377-143598399 CCCCATCCTTTGGCTCTACCTGG - Intronic
963997930 3:151732767-151732789 CCCTTTCCATTGGCTCTGCAAGG - Intergenic
968300145 3:197606661-197606683 GCCCATTCGCTGGCTCTGCAGGG + Intergenic
969107801 4:4820990-4821012 CCCCATGCTTGAGCTCTGCATGG - Intergenic
969326879 4:6449140-6449162 CCCCATCCTCTGACTCTCCAAGG + Intronic
969350547 4:6595854-6595876 CCCCAGCCTCTGGGTCTGCATGG + Intronic
970100421 4:12515075-12515097 CCCCTCACTGTGGCTCTGCAGGG - Intergenic
972075254 4:35079245-35079267 CCCCAGGCTTAGGCTCTCCCTGG - Intergenic
973220699 4:47723048-47723070 CCCCGTCCTTTGGTTTTGCAGGG - Intronic
974443235 4:61945715-61945737 CCCCTTTCTTTGACTCTGAAAGG + Intronic
974573759 4:63689424-63689446 CTCCACCCTGTGGCTCTGCAGGG - Intergenic
975243458 4:72090285-72090307 CATCTTGCTTTGGCTATGCAGGG + Intronic
976008206 4:80456152-80456174 CCCCATGCTTGGACACAGCAAGG + Intronic
976142026 4:82002697-82002719 TCCACTGCTGTGGCTCTGCAGGG - Intronic
976277217 4:83289956-83289978 CCCCAGCCTGTGGCTTTGCAGGG - Intergenic
980091477 4:128447556-128447578 CCCCAGCCTATGCCTCTGCATGG - Intergenic
980762904 4:137260320-137260342 CCCCATGCTATGGATTTTCATGG + Intergenic
983147992 4:164241839-164241861 CCCCTTTCTTTGGCTCAGAAAGG - Intronic
983898172 4:173103697-173103719 TCTCATGCTTTGGCCATGCATGG - Intergenic
985065430 4:186116173-186116195 CCCCTTTCTTTGACTCCGCAAGG + Intronic
985541577 5:489903-489925 CCACGTGCTTTGCCTGTGCAAGG + Intronic
985561191 5:586909-586931 CTGAACGCTTTGGCTCTGCAGGG + Intergenic
985913702 5:2902113-2902135 CCCCACTCTTTGGCACTGAAGGG + Intergenic
986788584 5:11138887-11138909 TCCAATGCTTTAGTTCTGCATGG - Intronic
987440278 5:17947231-17947253 AGTCATGCTTTGGCTATGCAGGG + Intergenic
987580671 5:19787209-19787231 CCACCTGCCTTGGCTCTGCCAGG - Intronic
988511316 5:31867035-31867057 CTCCATGCCTTGACTCTGCCTGG + Intronic
990741625 5:58918475-58918497 CCCCTGTCTCTGGCTCTGCAAGG - Intergenic
993461560 5:88189314-88189336 CCTCATGCTTCGGCTATGCGTGG + Intergenic
994348643 5:98718659-98718681 CCCCATTCTTTGTTTCTGTAAGG - Intergenic
994592229 5:101788123-101788145 GCCCATTCTTTGGGTTTGCATGG - Intergenic
994790112 5:104213962-104213984 TCCCCTCCTTTGGCTCAGCAAGG - Intergenic
996591148 5:125149117-125149139 CTCCATCCTGTGGCTCTGCTTGG + Intergenic
997334885 5:133100357-133100379 CCAGATGCTTTGGCTAGGCATGG - Intronic
997531016 5:134581351-134581373 CCCCATGCTTTGGGTCACCTCGG + Exonic
999003293 5:147946892-147946914 CCCCTTTCTTTGACTCTGAAAGG + Intergenic
1001231453 5:169992236-169992258 CTCCATGCTAGGGCTTTGCATGG - Intronic
1002744700 5:181461109-181461131 CCCCAGGCTTTGGCTATGATGGG + Intergenic
1003252947 6:4448023-4448045 CCCCATGCCTTGTCCCTGTATGG - Intergenic
1004928965 6:20443221-20443243 CTCCATTCTTTGTCTCTTCATGG + Intronic
1006428332 6:33980024-33980046 CCCCAAACTTTGGCTCATCAGGG + Intergenic
1010317957 6:74472059-74472081 CCTCATGCTTCGGCTGTGCATGG - Intergenic
1012611481 6:101225710-101225732 CCTCATGCTTTGGCTGTGTGTGG + Intergenic
1012791337 6:103701236-103701258 CCACATGTTTAGTCTCTGCATGG + Intergenic
1013451712 6:110288126-110288148 CCCAGTGCTTGTGCTCTGCAGGG + Intronic
1013886708 6:114976157-114976179 CCCCTTTCTTTGACTCAGCAAGG + Intergenic
1014546693 6:122744044-122744066 CCTCATGCTTCGGCTGTGCGTGG + Intergenic
1014851528 6:126345007-126345029 CCCCATCCTTTGCTTCTGCCAGG - Intronic
1015172123 6:130265396-130265418 CCTCATGCTTCGGCCGTGCATGG - Intronic
1018456727 6:163960258-163960280 CCAGATTCTTTGTCTCTGCAAGG + Intergenic
1019249611 6:170734650-170734672 CCCCAGGCTTTGGCTATGACGGG + Intergenic
1019357494 7:588232-588254 CTCCATGCTGAGGCTCTGGAAGG - Intronic
1019398524 7:836808-836830 GCCCATCCTTTCCCTCTGCAGGG - Intronic
1019600395 7:1880403-1880425 CCTCAAGTTTGGGCTCTGCAGGG - Intronic
1021849164 7:24790981-24791003 CCTCATGCTTTGGCCATGCATGG + Intergenic
1024438516 7:49387923-49387945 CTCCATCCTGTGGCTTTGCAGGG + Intergenic
1027831426 7:83182588-83182610 TCCCCTGCTATGGCTCTGAAGGG + Intergenic
1029714759 7:102319874-102319896 CTCCGGGTTTTGGCTCTGCAGGG + Intronic
1032055602 7:128681897-128681919 CCCCTGGCCATGGCTCTGCAGGG + Intronic
1033639072 7:143243252-143243274 CACCATGCTCTGTTTCTGCAGGG - Intergenic
1034925180 7:155115469-155115491 ACCCACGCCTGGGCTCTGCAAGG - Intergenic
1035498485 8:73006-73028 CCCCAGGCTTTGGCTATGATGGG - Intronic
1037216585 8:16461223-16461245 TCCCACTCTTTTGCTCTGCAGGG + Intronic
1038780564 8:30565830-30565852 TCCCATGCCTTTCCTCTGCAGGG + Intronic
1039278596 8:35957710-35957732 CCTCATGCTTTGGCTGTGCAGGG - Intergenic
1041515665 8:58696304-58696326 TCTCATGCTTTGGCTGTGCGTGG - Intergenic
1042009460 8:64224710-64224732 CCTCATATTTTGGATCTGCAAGG - Intergenic
1043266232 8:78270692-78270714 TCCCCTGCTGTGGCTTTGCAGGG + Intergenic
1044453943 8:92369961-92369983 CCCCATTCTTTGACTCGGAAAGG + Intergenic
1045727754 8:105195613-105195635 CCCCAGGCTTTGTATGTGCAGGG + Intronic
1045884364 8:107078548-107078570 CTCCATCCTCTGGCTTTGCAGGG + Intergenic
1046272670 8:111916760-111916782 CCCCATCCTTAGGCTTTGCTGGG + Intergenic
1046798066 8:118393900-118393922 CCCCATGCATTTGATCTGAAAGG + Intronic
1047872392 8:129098370-129098392 CCCCAAGCTTTGGCTTTGGCAGG + Intergenic
1049242960 8:141548084-141548106 AGCCCTGCTTTGCCTCTGCATGG + Intergenic
1049634086 8:143676889-143676911 CCTCATGCTTCGGCCGTGCATGG - Intergenic
1050966215 9:11806424-11806446 CCCCATGCATTGGCTCCTAATGG - Intergenic
1052614573 9:30821556-30821578 TCCAATCCTGTGGCTCTGCAGGG - Intergenic
1054912227 9:70465225-70465247 CCCCATCCTGAGGCTCTCCAGGG + Intergenic
1055108459 9:72536731-72536753 CCCCACTCTTTGGCTTTGCTGGG + Intronic
1056413886 9:86358027-86358049 CCCCATGCTGAGGCTATGTAGGG - Intergenic
1056591539 9:87969240-87969262 CCCCAGGCATTGGATCTGCTGGG - Exonic
1056699281 9:88888862-88888884 CCCAGTGCTTTCCCTCTGCATGG + Intergenic
1056879976 9:90381575-90381597 CGCCAGGCTTTGGCTTTTCATGG - Intergenic
1061841677 9:133362128-133362150 TCTCATCCATTGGCTCTGCAGGG - Exonic
1062290037 9:135790315-135790337 CCTCATGCTGAGGCTGTGCAGGG - Intronic
1062385234 9:136306734-136306756 CCCCATGCAGTGGCTCTGCGTGG - Intronic
1062541122 9:137042007-137042029 CCCCGGGCCTGGGCTCTGCAGGG - Intronic
1203610511 Un_KI270748v1:91588-91610 CCCCAGGCTTTGGCTATGATGGG + Intergenic
1186336440 X:8594357-8594379 ACCCATCCCTTGGCTTTGCAAGG - Intronic
1187484958 X:19694537-19694559 TCCCAGGCTTTGGCACTGGAGGG + Intronic
1187905098 X:24058432-24058454 CCTTTTGCTTTGGCTCAGCATGG + Intronic
1188804249 X:34568738-34568760 CACATTGCTTTGGCTTTGCAGGG - Intergenic
1191096817 X:56681593-56681615 CCCTCTCCTGTGGCTCTGCAGGG - Intergenic
1191656328 X:63602979-63603001 CCCCTTTCTTTGGCTCAGAAAGG + Intergenic
1194254928 X:91623984-91624006 TGACATGCTTGGGCTCTGCAGGG + Intergenic
1195942911 X:110180010-110180032 CCCCATCCTGTTTCTCTGCAGGG + Intronic
1196869613 X:120100207-120100229 CCTCATGCTTTGACCATGCAAGG - Intergenic
1197859005 X:130949777-130949799 CCCTTTTCCTTGGCTCTGCAAGG + Intergenic
1197977728 X:132183101-132183123 CACCATGCTGGGGCTCTGCAGGG + Intergenic
1198119479 X:133578145-133578167 CTCCATGCTTTCTCTCTGAATGG + Intronic
1200573712 Y:4863587-4863609 TGACATGCTTGGGCTCTGCAGGG + Intergenic
1200948486 Y:8868851-8868873 CCTCATGCTTTGGCTGTGCATGG - Intergenic
1202298944 Y:23390027-23390049 CTCCTTGCTTTGACTCTGAATGG + Intergenic
1202571865 Y:26280571-26280593 CTCCTTGCTTTGACTCTGAATGG - Intergenic