ID: 1138404467

View in Genome Browser
Species Human (GRCh38)
Location 16:56778539-56778561
Sequence CTCAGCTACCACATTGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138404467_1138404473 13 Left 1138404467 16:56778539-56778561 CCAGGACCAATGTGGTAGCTGAG 0: 1
1: 0
2: 1
3: 11
4: 122
Right 1138404473 16:56778575-56778597 AAGATGTGTGAGGGACATTTGGG 0: 1
1: 0
2: 5
3: 25
4: 244
1138404467_1138404472 12 Left 1138404467 16:56778539-56778561 CCAGGACCAATGTGGTAGCTGAG 0: 1
1: 0
2: 1
3: 11
4: 122
Right 1138404472 16:56778574-56778596 AAAGATGTGTGAGGGACATTTGG 0: 1
1: 0
2: 1
3: 26
4: 237
1138404467_1138404470 3 Left 1138404467 16:56778539-56778561 CCAGGACCAATGTGGTAGCTGAG 0: 1
1: 0
2: 1
3: 11
4: 122
Right 1138404470 16:56778565-56778587 ACAGAGGAAAAAGATGTGTGAGG 0: 1
1: 0
2: 3
3: 53
4: 533
1138404467_1138404471 4 Left 1138404467 16:56778539-56778561 CCAGGACCAATGTGGTAGCTGAG 0: 1
1: 0
2: 1
3: 11
4: 122
Right 1138404471 16:56778566-56778588 CAGAGGAAAAAGATGTGTGAGGG 0: 1
1: 0
2: 3
3: 58
4: 581

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138404467 Original CRISPR CTCAGCTACCACATTGGTCC TGG (reversed) Intronic
901115482 1:6840493-6840515 CTCAGCTACTGCGTTGGTGCTGG + Intronic
901149189 1:7089057-7089079 CACAGGTACCAAAATGGTCCAGG - Intronic
901572790 1:10175170-10175192 GTGGGATACCACATTGGTCCTGG + Intronic
906962417 1:50426612-50426634 CTCAGCCGCCTCATTTGTCCCGG - Intergenic
911040068 1:93584342-93584364 CTCAGCTGCTGCATTGGTCATGG - Intronic
919830012 1:201534024-201534046 CTCAGCCTCCACATTGGATCTGG + Intergenic
921546038 1:216476102-216476124 CACAGATCCCACAGTGGTCCTGG + Intergenic
922889952 1:229054146-229054168 CTCTGCTACCTCACTGGGCCCGG - Intergenic
1064075587 10:12266055-12266077 TACAGATAACACATTGGTCCTGG - Intergenic
1067153250 10:43753507-43753529 CTCACCTTCCACATGGGGCCCGG + Intergenic
1072717333 10:97760575-97760597 CTCAGCCCCCTCATGGGTCCTGG - Exonic
1074189608 10:111124373-111124395 CCCAGGCACCACATTTGTCCAGG - Intergenic
1075462978 10:122631063-122631085 CTCAGCTTCCTGAATGGTCCAGG - Exonic
1077715557 11:4576489-4576511 CTCAGCTGCCACTTTGCTTCTGG - Intronic
1078556547 11:12331524-12331546 CTCAGCTACCTCCCCGGTCCTGG - Intronic
1080966949 11:37224402-37224424 CTCAGGTACCACATTCTTCCTGG - Intergenic
1082909523 11:58354370-58354392 CTCAGCCAGCACCTTGGTGCAGG - Intergenic
1083768227 11:64852494-64852516 CTCAGCTCCCACCTTGCTCAGGG + Exonic
1085204572 11:74723109-74723131 CACAGCTTCCATCTTGGTCCAGG - Intronic
1087051252 11:93888480-93888502 TAAAGCTACTACATTGGTCCTGG - Intergenic
1088288311 11:108209592-108209614 ATCAATTACCACATTGGGCCAGG + Intronic
1096181655 12:49554516-49554538 CTCAGCTACAACCTGGGTGCTGG + Exonic
1097508016 12:60500846-60500868 CTCAGCTACCACATAGGCTGAGG - Intergenic
1104708843 12:130970601-130970623 CTTTGCTACCACATGGGTCAGGG - Intronic
1108546887 13:51503843-51503865 CTCAGCTAGCACATATGACCTGG + Intergenic
1108619478 13:52167153-52167175 CTCTGCTGCCAGTTTGGTCCAGG + Intergenic
1113940445 13:114016001-114016023 CTCAGCCACCACCTTTGGCCTGG - Intronic
1122921285 14:104881363-104881385 CTCGGCTCCCACCTCGGTCCAGG + Intronic
1125972373 15:43922180-43922202 CTCAGAAACCACACTGGCCCTGG + Intronic
1129238741 15:74239530-74239552 CTCAGCTACTCCACTGGGCCTGG - Intronic
1129866229 15:78910793-78910815 CTCAGTTACCACCCTGGGCCTGG + Intergenic
1131188653 15:90295278-90295300 CTCAGCTGCCATACTGGTGCCGG - Intronic
1132974801 16:2705924-2705946 CTCAGATGCCACACTGCTCCTGG + Intronic
1134106584 16:11489675-11489697 CTCAGCCTCCACAGTGGCCCTGG - Intronic
1134135181 16:11672820-11672842 CTCAGTTTCCTCATTAGTCCTGG + Intronic
1138404467 16:56778539-56778561 CTCAGCTACCACATTGGTCCTGG - Intronic
1138644321 16:58412494-58412516 CTCAGCTATCTCTTTGGTTCAGG + Intergenic
1139292482 16:65871178-65871200 CTCTGCAGCCACCTTGGTCCTGG - Intergenic
1140243050 16:73220929-73220951 CTCAGGGACAACAGTGGTCCAGG + Intergenic
1141130757 16:81434929-81434951 ACCAGCAACCACATTTGTCCAGG + Intergenic
1142145344 16:88490722-88490744 CTCAGCTTCCCCATGGGGCCGGG - Intronic
1142748677 17:1974459-1974481 CTCAGCTGACACAGTGGTCCTGG - Intronic
1146658507 17:34649337-34649359 CTCAGCTACCTCACAGGCCCAGG - Intergenic
1147392435 17:40118552-40118574 CTCAGCAGCCACAGTGGTCCTGG - Intergenic
1147878038 17:43635447-43635469 CTCAGCTACCACATGATGCCTGG - Intergenic
1152341787 17:79729672-79729694 CACAGCCACCACCCTGGTCCGGG + Intergenic
1153567240 18:6430626-6430648 TTCAGCCACCACATTTGTCTTGG + Intergenic
1158128586 18:54128270-54128292 CTCAGCTGCCACATGGGGCAGGG - Intergenic
1161480063 19:4505949-4505971 CTCACCTCCCACATCGGACCCGG + Intronic
1163317290 19:16549556-16549578 CACAGCTGCCACAATGTTCCTGG + Intronic
1166903718 19:46087773-46087795 ATCAGTTTCCACTTTGGTCCTGG + Intergenic
1168281624 19:55308916-55308938 CTCAGCTACGACAATGGTGAAGG - Intronic
926228718 2:10986672-10986694 CTGAGCAACCACAATGTTCCAGG + Intergenic
926628535 2:15116336-15116358 CTCAGCTGCCACCTTGATCTTGG - Intergenic
927745848 2:25620122-25620144 CTCAGCTCCCACATCTGTCTGGG - Intronic
932075509 2:68659226-68659248 CTCTTCTACCACAGTGTTCCTGG + Intergenic
933782820 2:85813775-85813797 TTCAGCTCCCACAGTGTTCCAGG - Intergenic
935382486 2:102466630-102466652 ATCAGCTACCACCTTGATCTTGG + Intergenic
935774999 2:106465748-106465770 GTCAGCTACCAAAGTGTTCCGGG + Intronic
942496453 2:176545160-176545182 CTCAGCTACAACACTGATACGGG + Intergenic
944943734 2:204659018-204659040 GCCAGCTATCACATTGTTCCAGG + Intronic
946360145 2:219214476-219214498 CTCAGTGACCACAATGGTCAGGG + Exonic
947441360 2:230124558-230124580 CTCAGCTCCAGCATAGGTCCAGG - Intergenic
1169857159 20:10115492-10115514 CTCAGCTCCCAAAATGGCCCAGG + Intergenic
1174039119 20:47686673-47686695 CTCAGATATCACAATCGTCCGGG + Intronic
1174668988 20:52288369-52288391 TTCTGCCACCACCTTGGTCCAGG - Intergenic
1176287173 21:5024277-5024299 CACTGCTACCAAAGTGGTCCCGG + Intronic
1178282285 21:31293879-31293901 ATAAACTACCACATTGTTCCTGG - Intronic
1179870008 21:44239198-44239220 CACTGCTACCAAAGTGGTCCCGG - Intronic
1180824142 22:18851487-18851509 CTCAGCCACCTCATTGGCCACGG + Intronic
1181124568 22:20694641-20694663 CTCAGCCACCTCATTGGCCACGG + Intergenic
1181188595 22:21123061-21123083 CTCAGCCACCTCATTGGCCACGG - Intergenic
1181210605 22:21287432-21287454 CTCAGCCACCTCATTGGCCACGG + Intergenic
1181398907 22:22639459-22639481 CTCAGCCACCTCATTGGCCACGG - Intergenic
1181402538 22:22660014-22660036 CTCAGACACCACCTTGGTCTAGG - Intergenic
1181650514 22:24256600-24256622 CTCAGCCACCTCATTGGCCACGG + Intergenic
1181976470 22:26734302-26734324 CTCAGCTCCCTCATGGGTACTGG - Intergenic
1182942143 22:34286925-34286947 CTCAGCCACCACATCCGGCCTGG + Intergenic
1183426843 22:37744609-37744631 CTCACCTACCACCAGGGTCCTGG - Intronic
1203216343 22_KI270731v1_random:7998-8020 CTCAGCCACCTCATTGGCCACGG - Intergenic
949325212 3:2856042-2856064 CTCAACTAACACTTTGGGCCTGG + Intronic
949848298 3:8394583-8394605 ATGAGATACCACCTTGGTCCTGG + Intergenic
950064923 3:10104427-10104449 CTCAGCCACCAAAGTGGACCGGG - Exonic
950906165 3:16540443-16540465 CTCTGCCACCATCTTGGTCCAGG - Intergenic
952631225 3:35469862-35469884 GTCAGCATCCACATTGATCCAGG - Intergenic
952929572 3:38348490-38348512 CTCAGCTTCTACACTGGTCCAGG - Intronic
957810810 3:85219821-85219843 CCCAGCTACCAAAATGTTCCTGG - Intronic
957969086 3:87360181-87360203 CTCAGGTCCCACACTGGTGCTGG - Intergenic
960290024 3:115872752-115872774 CTCAGCTACCTCATTTGTTCAGG - Intronic
962461854 3:135621461-135621483 CTCAGGCACCTCATTGGTCCTGG - Intergenic
963148098 3:142015588-142015610 CTCTGCTAACACTCTGGTCCCGG + Intronic
968789283 4:2648362-2648384 CTCAGAGATCACTTTGGTCCTGG + Intronic
972341792 4:38158397-38158419 CACTGCTACCATATTGGTTCAGG + Intergenic
975854207 4:78606034-78606056 CCCAGCTTCCACTTTGTTCCAGG - Intronic
977710663 4:100120668-100120690 CTCAGCAACCACACTTGTACTGG + Intergenic
978854608 4:113380376-113380398 GTGAGCCACCACATTGGGCCAGG - Intronic
980866786 4:138561845-138561867 CTCAGCTACCCTACAGGTCCGGG + Intergenic
992381200 5:76239600-76239622 CTTGGCTACCAAGTTGGTCCTGG + Intronic
996031677 5:118712055-118712077 CTCACCAGCCACAGTGGTCCTGG + Intergenic
999644647 5:153705720-153705742 CTTAACTATCACTTTGGTCCGGG + Exonic
1002182377 5:177437376-177437398 CTGAGCTCCCCCATTGGTGCAGG - Intronic
1003097170 6:3151458-3151480 CTCAGCCACCACATTGGGGGTGG - Intronic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1005758138 6:28943876-28943898 CTCAGCTCCCAGATGGATCCTGG + Exonic
1006792648 6:36714059-36714081 CCCGGCTGCCACAGTGGTCCGGG + Intronic
1009663891 6:66651491-66651513 ATCACCTACCACTTTGGTCTTGG + Intergenic
1011674100 6:89714538-89714560 CTCACCTACAACAGTGCTCCGGG + Exonic
1013178230 6:107695210-107695232 CTCAGCTCCCACACTGGCTCAGG - Intergenic
1015251498 6:131132570-131132592 TTAAGCTACCACACTGTTCCTGG + Intergenic
1015550380 6:134405934-134405956 CTCAGTTACCACAGAGGACCTGG + Intergenic
1016373682 6:143399066-143399088 CTCAGCCACCACCCTGGGCCAGG + Intergenic
1020153207 7:5699930-5699952 CTCAGCTACCACATTGCAACTGG + Intronic
1032001833 7:128270918-128270940 CTCAGCCACCACATGGGTCGGGG + Intergenic
1032508203 7:132451781-132451803 CTAAGCTACCCCAGTGGCCCAGG + Intronic
1035470499 7:159106134-159106156 CTCAGCTCCCACCGAGGTCCTGG - Intronic
1036149108 8:6281689-6281711 GTCAGCAAGCAAATTGGTCCTGG - Intergenic
1037098411 8:15014165-15014187 CTCAGCTACCACAGTGCTCCAGG - Intronic
1039224957 8:35378347-35378369 CTGATCTTCCACATGGGTCCTGG + Intronic
1039440432 8:37591462-37591484 CTGACCTACCCCATTGGTCCTGG - Intergenic
1042823468 8:72956920-72956942 CTCTGCTTGCACTTTGGTCCTGG - Intergenic
1043067622 8:75595176-75595198 CTCAGCTTCCAAATTCCTCCTGG - Intergenic
1047942254 8:129837169-129837191 CTGAGGTACCACCTAGGTCCGGG - Intergenic
1048190166 8:132281156-132281178 CTCTGTTTCCAAATTGGTCCAGG - Intronic
1048992218 8:139767100-139767122 GTCAGCTACCACATGGCTCCAGG + Intronic
1051202714 9:14646560-14646582 CTCATCTACCACTTTCTTCCTGG + Intronic
1051579078 9:18651109-18651131 CACATCTGCCACATTGTTCCTGG - Intronic
1052906763 9:33841853-33841875 CTCAGCAATCACATTGGTTATGG - Intronic
1053430610 9:38039729-38039751 CTCAGCTCCCTCATGAGTCCAGG + Intronic
1059112301 9:111568862-111568884 CCCTGCTACCACCCTGGTCCAGG - Intronic
1060194254 9:121612988-121613010 CTCAGTTTCCCCATTTGTCCTGG + Intronic
1061750364 9:132772869-132772891 CACAGCTACCACCCTGGTCCAGG + Intronic
1194965878 X:100288428-100288450 CACTGCTACCACAGTGGCCCAGG - Intergenic
1195860775 X:109380585-109380607 CTCTGATGCCACATTGGGCCTGG - Intronic
1198137589 X:133769681-133769703 CTTAGCTACCACCTTAGTTCTGG + Intronic
1199544122 X:148989346-148989368 CACAGCCATCACATTGCTCCTGG - Intronic