ID: 1138405330

View in Genome Browser
Species Human (GRCh38)
Location 16:56788301-56788323
Sequence CGGGCTCTGGCCTGATTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 106}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138405328_1138405330 -7 Left 1138405328 16:56788285-56788307 CCTTCTCACTAGGACACGGGCTC 0: 1
1: 0
2: 1
3: 9
4: 92
Right 1138405330 16:56788301-56788323 CGGGCTCTGGCCTGATTTTCTGG 0: 1
1: 0
2: 2
3: 12
4: 106
1138405327_1138405330 -6 Left 1138405327 16:56788284-56788306 CCCTTCTCACTAGGACACGGGCT 0: 1
1: 0
2: 0
3: 11
4: 86
Right 1138405330 16:56788301-56788323 CGGGCTCTGGCCTGATTTTCTGG 0: 1
1: 0
2: 2
3: 12
4: 106
1138405319_1138405330 28 Left 1138405319 16:56788250-56788272 CCACCACAGCCTGGCACATCCTG 0: 1
1: 1
2: 4
3: 38
4: 415
Right 1138405330 16:56788301-56788323 CGGGCTCTGGCCTGATTTTCTGG 0: 1
1: 0
2: 2
3: 12
4: 106
1138405320_1138405330 25 Left 1138405320 16:56788253-56788275 CCACAGCCTGGCACATCCTGCTG 0: 1
1: 0
2: 1
3: 44
4: 462
Right 1138405330 16:56788301-56788323 CGGGCTCTGGCCTGATTTTCTGG 0: 1
1: 0
2: 2
3: 12
4: 106
1138405323_1138405330 9 Left 1138405323 16:56788269-56788291 CCTGCTGCATCACGGCCCTTCTC 0: 1
1: 0
2: 1
3: 12
4: 158
Right 1138405330 16:56788301-56788323 CGGGCTCTGGCCTGATTTTCTGG 0: 1
1: 0
2: 2
3: 12
4: 106
1138405321_1138405330 19 Left 1138405321 16:56788259-56788281 CCTGGCACATCCTGCTGCATCAC 0: 1
1: 0
2: 1
3: 15
4: 215
Right 1138405330 16:56788301-56788323 CGGGCTCTGGCCTGATTTTCTGG 0: 1
1: 0
2: 2
3: 12
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138405330 Original CRISPR CGGGCTCTGGCCTGATTTTC TGG Intronic
901263185 1:7888859-7888881 GGGGCTCTGGACAGACTTTCTGG + Intergenic
901677925 1:10897680-10897702 AGGGCTCTGGCCTGTTTTTCCGG + Intergenic
902821048 1:18943734-18943756 CAGCCTCTGGCCTGGTTTTGAGG - Intronic
903482222 1:23662043-23662065 CGGCATATGGGCTGATTTTCAGG + Intergenic
905880338 1:41459265-41459287 GGGGCTTAGGCCTGAGTTTCTGG + Intergenic
906699097 1:47844522-47844544 CAGGCTCTGGCCTGAGTGCCTGG + Intronic
916078662 1:161218331-161218353 GGGGCTCTAGCCTGGGTTTCCGG + Intronic
918065988 1:181102058-181102080 CGGGCTCTTCCCTGTCTTTCTGG + Intergenic
920609177 1:207421090-207421112 CCGGCTCTGCCCTGCCTTTCGGG + Intergenic
923419750 1:233800831-233800853 AGGGCTCTGTCTTGATTTCCTGG + Intergenic
1067494647 10:46750908-46750930 TAGGCTCTAGCCTGATTTTCTGG + Intergenic
1067600008 10:47589489-47589511 TAGGCTCTAGCCTGATTTTCTGG - Intergenic
1070852953 10:79582778-79582800 CAGGCTCTGGCCTGAACTGCTGG - Intergenic
1070888127 10:79922527-79922549 CAGGCTCTGGCCTGAACTGCTGG + Intergenic
1071651549 10:87397370-87397392 TAGGCTCTAGCCTGATTTTCTGG - Intergenic
1075730254 10:124631594-124631616 CGGGCTCTGGCCTGCGTGGCGGG - Intronic
1077106255 11:843772-843794 GGGGCTCTGGGCTGGTTTGCCGG + Intronic
1078509681 11:11976167-11976189 CTGGCTCAAGCCTGATGTTCTGG - Intronic
1078588055 11:12611043-12611065 CAGGCTCTGGGCTGATGTTGGGG - Intergenic
1084490706 11:69476700-69476722 GGGGCTCTGGCCTAATTTGGAGG - Intergenic
1084497101 11:69511510-69511532 CGGGCTCCAGCTTGGTTTTCCGG + Intergenic
1089594384 11:119567935-119567957 TGGACTCTGGCCTGAGTTTCAGG + Intergenic
1103898464 12:124290108-124290130 CGGGCTCTTGCCTATTTTTAGGG - Intronic
1112251527 13:97785006-97785028 CGTGCTCTGACCTGGCTTTCTGG - Intergenic
1113175869 13:107563286-107563308 TGTGCTCTGGCCTGTTTTTAAGG - Intronic
1120048935 14:79842424-79842446 CGGGCTCTGGCCATACTCTCTGG - Intronic
1127350036 15:58142084-58142106 TGGGCTCTGGGCTGATTCCCGGG - Intronic
1127903725 15:63360580-63360602 CGTGCTCTCGCCTGCTTTTTAGG + Intronic
1128638954 15:69321727-69321749 CAGGGTCTGGCCTGGTTGTCTGG - Intronic
1129693100 15:77724792-77724814 CAGGCTCTAGCCTCATGTTCAGG + Intronic
1130742346 15:86614245-86614267 GGGGCTCTTGCCTTAATTTCTGG + Intronic
1137267748 16:46883231-46883253 GGAGCTCTGGGCTGTTTTTCTGG + Intergenic
1138405330 16:56788301-56788323 CGGGCTCTGGCCTGATTTTCTGG + Intronic
1139601390 16:67989579-67989601 CTGGTTCTGGCCTGGATTTCAGG + Intronic
1142004265 16:87681813-87681835 TGGGTCCTGGGCTGATTTTCGGG + Intronic
1146820735 17:35982137-35982159 CGGACTTTGGACTGATTTTTAGG + Intergenic
1147459287 17:40558052-40558074 CTGCCTCTGGCCTGAGCTTCTGG + Intronic
1148132541 17:45270743-45270765 CTGGCTCTGGCCTGTTTTACTGG - Intronic
1150115018 17:62539882-62539904 AGGGCTCTGCCCTGAATTTCAGG + Intronic
1155185226 18:23381831-23381853 CAGGCTCTGGCCTGCTCATCAGG + Intronic
1156389916 18:36640735-36640757 TGGGCTCTGGGCTGGTCTTCTGG + Intronic
1160871621 19:1280339-1280361 CGGGCTCTGCCCTCACTTTAAGG - Intergenic
1161125974 19:2557676-2557698 CGGTCACTGTCCTGATTTTATGG - Intronic
1161985443 19:7650902-7650924 CGGCCTCTCTCCTGATTTTGAGG + Intergenic
1163020953 19:14480514-14480536 GGGGCTCTGCCCTGGTTTCCGGG + Intronic
925190803 2:1881924-1881946 CGGGCTTTGCCCTGATTTTGAGG + Intronic
928095571 2:28402777-28402799 GGGGCTCTGGCCTCTTTGTCAGG + Intronic
940745379 2:157561902-157561924 TGGACTCTGCCCTGCTTTTCTGG - Intronic
941085716 2:161115216-161115238 CTGGCTCTGCCCTCATTTTCGGG + Intergenic
943887066 2:193232542-193232564 CTGGCCCTGGCCTTATTTTTGGG - Intergenic
946004997 2:216517360-216517382 AGGTCTCTGGCCTCATTTTCAGG + Intronic
946332262 2:219017138-219017160 CTGGCTCTGGGCTGGTCTTCAGG - Intronic
946578059 2:221097819-221097841 CAGGCCCTGGCCTCATTCTCTGG + Intergenic
946604746 2:221391200-221391222 CGGGCTCAGGCATTACTTTCTGG + Intergenic
948708789 2:239812512-239812534 CGGAGTTTGGCCTGGTTTTCAGG - Intergenic
1169257689 20:4111364-4111386 TGGGCTCTGGCCTGAGTTCCTGG - Intergenic
1170467737 20:16638161-16638183 CGGGCTCTGGACAGAGTTCCCGG - Intergenic
1176093811 20:63330446-63330468 TGGGCTCTGACCTGATTCTTGGG - Intronic
1178485697 21:33019026-33019048 CCAGCTCTGGCCAGTTTTTCAGG + Intergenic
1179043219 21:37823181-37823203 AGGGCTCTGGCCTGGTGTTGGGG - Intronic
1182504487 22:30772065-30772087 TTGTCTCTGGCCTGATTCTCTGG - Intronic
1182548013 22:31086715-31086737 AGGGCTCTGGCCTGAGTTTCAGG + Intronic
1182890182 22:33811645-33811667 TGGGCTCTGGCCTTCTTTCCTGG - Intronic
1183261483 22:36798527-36798549 AGGGCTCTGACCTGGTTTCCGGG + Intergenic
1184022764 22:41832434-41832456 TGGGCACTGGCGTGGTTTTCAGG + Intergenic
1184687770 22:46104253-46104275 CGGGCACTGTGCTGCTTTTCCGG + Intronic
1185211780 22:49574560-49574582 TGGGCTGTGGCCTGGTTTTCAGG - Intronic
950661582 3:14469929-14469951 CAGTCTCTGGCCTGCTTTTGGGG - Intronic
951609453 3:24475974-24475996 CAGGCTCTTTCCTGATCTTCAGG - Intronic
951658586 3:25036819-25036841 GGGGATCTGGCCAGATTCTCTGG + Intergenic
953704769 3:45222714-45222736 CAGGCTCTGTCCTCACTTTCTGG + Intergenic
953903090 3:46854232-46854254 CGGGCTCTGGCCAGCCTTCCTGG - Intergenic
954973610 3:54672503-54672525 AGGACTCTGGCCTCATTTTAGGG + Intronic
956693839 3:71901826-71901848 TGGGCTCTGGTCTGAGTGTCTGG + Intergenic
958724926 3:97893441-97893463 CGGGCTCTGAACTGCTTTTGAGG + Intronic
961493228 3:127271045-127271067 AGGGCTCTGGCTTTATTTTGTGG - Intergenic
961552920 3:127679397-127679419 CAGGCTCTGGCCTGAATCTGAGG + Intronic
962966960 3:140364441-140364463 TGGTCTCTGGTCTGATTCTCTGG + Intronic
964710577 3:159667500-159667522 CAGGCTGTGGCCTGAGTCTCCGG - Intronic
966591443 3:181687896-181687918 TGGCCTGTGGCCTGATTTCCTGG + Intergenic
968620140 4:1600260-1600282 AGGGCTCTGGCCTGAAGTTGGGG + Intergenic
973866623 4:55120519-55120541 CGGGCCCTGCCTTGATATTCTGG - Intronic
975861893 4:78686219-78686241 AGGGCTCTGCCCTGATTCTGTGG - Intergenic
977749745 4:100595175-100595197 TCTGCTCTGTCCTGATTTTCTGG - Intronic
981885028 4:149664643-149664665 CGGGCACTGGGCTGATTGTCAGG + Intergenic
982485800 4:155964455-155964477 CTGGCCCTGGCCTGCCTTTCAGG + Intergenic
985001742 4:185491875-185491897 AGGGCTCTGCGCTGATCTTCAGG + Intergenic
989740906 5:44770689-44770711 AGGGCTCTAACCTGAATTTCTGG + Intergenic
990567461 5:57043661-57043683 CGGGCGCTGCAGTGATTTTCTGG - Intergenic
999938316 5:156512947-156512969 GGGGCTATGTCTTGATTTTCTGG + Intronic
1001959549 5:175871978-175872000 CGGGCTCTGCCCGGAGTCTCCGG - Intronic
1002301933 5:178262309-178262331 CGGGGTCTGGCCTGAGATTTGGG - Intronic
1003297417 6:4844127-4844149 CGGGCTCTGGGCTGGTACTCGGG + Intronic
1004942498 6:20574700-20574722 GGGGCTCTTGCTGGATTTTCAGG + Intronic
1006217381 6:32456008-32456030 CTTTCTCTGGCCTGATGTTCTGG - Intergenic
1007356509 6:41321686-41321708 GGGGCCCTGGCCTGATCTTGGGG + Intergenic
1007400334 6:41599336-41599358 CTGGCTCTGGCCGTGTTTTCTGG + Exonic
1007585457 6:42986307-42986329 TTGGCTCTGGCCTGGTGTTCTGG + Intronic
1013191202 6:107805551-107805573 CTGACACTGGCCTGATTTTATGG + Intronic
1015634221 6:135260311-135260333 CGGGCTCTGGGCTGAACTCCAGG + Intergenic
1016433095 6:144008248-144008270 CGTGCTCTGGCCTCACTCTCCGG - Intronic
1018101670 6:160445999-160446021 CTTGCTTTGTCCTGATTTTCTGG - Intronic
1019842030 7:3456873-3456895 CAGGTTCTGGCCTGCTTTTGTGG + Intronic
1022449507 7:30502045-30502067 CTGCCTCTTTCCTGATTTTCAGG + Intronic
1022655855 7:32318886-32318908 CAGGCTCTGGACTGAGGTTCGGG + Intergenic
1031027293 7:116694024-116694046 CAGGCACTGGCCAGATTTTAGGG - Intronic
1032044735 7:128595536-128595558 AGAGCTCTGCCCTGAATTTCAGG + Intergenic
1037649419 8:20823114-20823136 GGGGCTCTGGACTGAGATTCAGG + Intergenic
1038212673 8:25534057-25534079 CTGGCTCTGCCCAGATGTTCGGG - Intergenic
1053055109 9:34989391-34989413 CGGGCTCGGGTCTGAGTCTCAGG + Intergenic
1053162965 9:35826209-35826231 TGGGCTCTGCCCTGACTTGCCGG - Intronic
1059380543 9:113920040-113920062 AGGGCCCTGGCCTGAATGTCAGG + Intronic
1060823190 9:126673167-126673189 CAGGCTCTGGCCCGAGCTTCTGG - Intronic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1062374043 9:136254022-136254044 CGGGCTCTGGCATGAGGTACGGG + Intergenic
1186983625 X:14986049-14986071 AGGGCTCTGGCTTCATTTTTTGG + Intergenic
1187790124 X:22941670-22941692 CGGGCTCTGGACTGATGCTGAGG - Intergenic
1193449406 X:81647174-81647196 CGGGCTCTGGCTTTGTTCTCTGG + Intergenic
1195386109 X:104314735-104314757 CTGGCCCTCTCCTGATTTTCTGG - Intergenic
1198712203 X:139517298-139517320 CAGGTCCTGGCCTAATTTTCTGG - Intergenic
1199991475 X:152989908-152989930 GGGGCTCTGGCCTGGTCCTCTGG - Exonic