ID: 1138407698

View in Genome Browser
Species Human (GRCh38)
Location 16:56811217-56811239
Sequence TCTCACATACTGCTGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 9, 3: 52, 4: 263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138407698 Original CRISPR TCTCACATACTGCTGGTGGG AGG (reversed) Intronic
900663833 1:3800263-3800285 TCTCATGCTCTGCTGGTGGGAGG + Intergenic
901226341 1:7614886-7614908 CATCAGATACTGCTGGGGGGAGG + Intronic
901573240 1:10179195-10179217 TGTCAGCTACTGCTGGGGGGAGG - Intronic
902871634 1:19317229-19317251 TCCCACATACAGCTGTTGTGTGG - Intronic
902885600 1:19402633-19402655 CCTGAGATACAGCTGGTGGGTGG - Intronic
902950542 1:19879467-19879489 TCTCGCACACTGCTGTTGGGAGG - Intergenic
903999399 1:27330427-27330449 TCTCATTCACTGCTGGTGGGAGG - Intronic
904243301 1:29165948-29165970 ACTCACATCCTGCTGATGGTTGG - Intronic
904305860 1:29589536-29589558 TCTCATGAACTGCTGGTGGGAGG + Intergenic
904332585 1:29771913-29771935 TCTCATACACTGCTGGTGGGAGG + Intergenic
905111415 1:35597383-35597405 CCTAACATCCTGCTGGGGGGGGG - Intergenic
905853628 1:41292605-41292627 TCTCCCACACTGCTGATGGTGGG - Intergenic
906671675 1:47659823-47659845 TCTCAAATGTTGTTGGTGGGAGG + Intergenic
908097555 1:60755236-60755258 ACTCATATGCTGCTGGTGGGAGG - Intergenic
909711175 1:78651136-78651158 TTCCACAGACTGGTGGTGGGGGG + Intronic
913532091 1:119740655-119740677 GCTCCCTTACTACTGGTGGGAGG + Intronic
914883205 1:151563817-151563839 CTTCATATAGTGCTGGTGGGAGG - Intronic
915090446 1:153420515-153420537 TCTTACACACTGCTGCTGGTAGG - Exonic
915759479 1:158296050-158296072 ACTCACATGCTGGTGGTGGTGGG - Intergenic
916022920 1:160809720-160809742 TCTCAAACATTGCTGGTGGGAGG - Intronic
916508912 1:165454023-165454045 TCTCACATCATGCTCATGGGTGG - Intergenic
918205611 1:182306393-182306415 TCTCATATTCTGCTGGTAGGTGG - Intergenic
918418294 1:184335566-184335588 TCTCACATATTATTGGTGTGGGG + Intergenic
918444390 1:184602258-184602280 TTTCACATGCTGGTGGTGGGAGG + Intronic
921075289 1:211695734-211695756 TCTCACAGACAGCTGGAGGAGGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
922771257 1:228184558-228184580 ACTCACACACTGCTGGTGGAAGG - Intergenic
924159797 1:241219063-241219085 GCTCACATCCAGCTGGTGTGAGG + Intronic
1064168963 10:13012576-13012598 GCTTATATACTGCTGGTGGGAGG + Intronic
1064408360 10:15084253-15084275 CCTCACGGACTGCTGGTGGGTGG + Intronic
1065193393 10:23236513-23236535 TCTCAAAGATTGCTGGTGTGAGG + Intronic
1067220874 10:44343430-44343452 TCTCATCTCCTGCTGATGGGGGG + Intergenic
1067780461 10:49199778-49199800 CCTCATATACTGCTGGTAGGAGG + Intergenic
1067856532 10:49798359-49798381 TCTCATATACTGCTGGCGAAAGG + Intergenic
1068185339 10:53578074-53578096 TCTTATACACTGTTGGTGGGAGG + Intergenic
1069197298 10:65569066-65569088 TCTCATACGTTGCTGGTGGGAGG - Intergenic
1072076918 10:91985593-91985615 TCTCACATACTGATGGTCAGAGG - Intronic
1072908928 10:99482877-99482899 TCTCATACATTGTTGGTGGGAGG + Intergenic
1073164471 10:101432835-101432857 TGTCACACACTGCGGCTGGGAGG - Intronic
1073486403 10:103821680-103821702 TCCCAGCTACTGGTGGTGGGGGG - Intronic
1073537209 10:104288476-104288498 TTTCACATACTGCTGGTGAGGGG - Intronic
1074112317 10:110431244-110431266 CCTCCTCTACTGCTGGTGGGAGG - Intergenic
1074503718 10:114048114-114048136 TCTTACATACTCATGGTCGGGGG - Intergenic
1074530752 10:114297226-114297248 GCTCACATTCTCCAGGTGGGTGG + Exonic
1074709184 10:116163007-116163029 TGTCACATGCTGCTGCTGGCAGG + Intronic
1075426432 10:122345272-122345294 ACTCATATGCTGCTAGTGGGAGG + Intergenic
1076294079 10:129370543-129370565 TCTCACATAGTGCTGGGGGCAGG + Intergenic
1076666686 10:132097154-132097176 CCTCATACACGGCTGGTGGGAGG + Intergenic
1077338998 11:2017710-2017732 TCTCTAACACTGCTGGAGGGCGG - Intergenic
1077734866 11:4780294-4780316 TCTCATGCACTGCTTGTGGGAGG - Intronic
1082055235 11:47809308-47809330 TCTCATATACTGCTGGTGCTGGG + Intronic
1083143542 11:60740607-60740629 TCTCAAATTCTGCTCCTGGGAGG - Intronic
1084275782 11:68050297-68050319 TCTCACATACCGCTGCTGGCTGG + Intronic
1084650970 11:70489134-70489156 TTTAACATACTCCTTGTGGGAGG + Intronic
1085021187 11:73209848-73209870 TCCCATACACTGCTGGTGGAAGG + Intergenic
1085703204 11:78763480-78763502 GCTCACATGCTGCTGGTGCATGG + Intronic
1085805364 11:79630946-79630968 TCTCATACACTGCTGGTGGGAGG + Intergenic
1085885606 11:80518283-80518305 TTCCACATACTGGGGGTGGGTGG - Intergenic
1085895556 11:80635340-80635362 TCTCATGTACTGCTCATGGGAGG - Intergenic
1086085299 11:82947017-82947039 CCTCATACACTGTTGGTGGGAGG + Intronic
1087647390 11:100824138-100824160 ACCCACATGCTGCCGGTGGGTGG - Intronic
1087997860 11:104833448-104833470 TCTCATACAGTGTTGGTGGGCGG - Intergenic
1088306132 11:108410156-108410178 ACTCATATATTGCTGGTGGGGGG - Intronic
1090410241 11:126503217-126503239 TCTCAGATCTTCCTGGTGGGGGG + Intronic
1202821982 11_KI270721v1_random:72892-72914 TCTCTAACACTGCTGGAGGGCGG - Intergenic
1094436492 12:30425608-30425630 TTGCACATCCTGCTGGGGGGGGG + Intergenic
1096399519 12:51293863-51293885 TCTTACTCACTGCTGATGGGTGG + Intronic
1097573127 12:61357019-61357041 TCTCACATGCTGCTGCTGCGAGG - Intergenic
1098067717 12:66636980-66637002 TGTCACATGCTGCTGATGGGAGG + Intronic
1101627967 12:106464393-106464415 TCTCACACAATTCTGGAGGGAGG + Intronic
1105533045 13:21237358-21237380 TCTCACACACAGCTGGTCTGTGG - Intergenic
1105956555 13:25288233-25288255 TCTCAAATGGTGGTGGTGGGGGG + Intergenic
1106211335 13:27650139-27650161 TATCACACACTGATGCTGGGAGG - Intronic
1106211345 13:27650264-27650286 TATCACACACTGATGCTGGGAGG - Intronic
1106732662 13:32557546-32557568 TCTCATATATTGCTGGTAGAAGG - Intergenic
1106795440 13:33200336-33200358 TTCCACATACAGATGGTGGGTGG - Intronic
1106856178 13:33855583-33855605 GCTTATACACTGCTGGTGGGAGG - Intronic
1107262023 13:38504106-38504128 TCTCATACATTGCAGGTGGGAGG + Intergenic
1108398853 13:50018672-50018694 TCTCATAAACTAATGGTGGGAGG + Intronic
1108457096 13:50627240-50627262 TCTCACGCATTGCTGGTAGGAGG + Intronic
1110796144 13:79640653-79640675 TCTCATCCACTGCTGGTAGGAGG - Intergenic
1111333335 13:86790330-86790352 TCTATCATACTTCTGGTGGCCGG + Intergenic
1111642194 13:90982623-90982645 GCTTTCACACTGCTGGTGGGAGG + Intergenic
1112074704 13:95898839-95898861 TCTCTCATACTTCTGGAGGCTGG - Intronic
1112193258 13:97199008-97199030 TCTTACAAACTGCTTGTGGAAGG + Intergenic
1112297822 13:98203883-98203905 ACTCATATACTGCTGGTTGCTGG - Intronic
1112813962 13:103251040-103251062 TGTCAGAAACAGCTGGTGGGGGG + Intergenic
1113525416 13:110971111-110971133 TTTCACATACTTCTGGAGGCTGG + Intergenic
1116468898 14:45264884-45264906 ACTCACATACTGCTGCTGGTAGG - Intergenic
1116801196 14:49444915-49444937 TCTCATGTACTGGTAGTGGGAGG - Intergenic
1116931813 14:50698040-50698062 ACTTATACACTGCTGGTGGGAGG - Intergenic
1116958436 14:50946251-50946273 TCACACATGGTGGTGGTGGGGGG + Intergenic
1118327507 14:64791651-64791673 TCTGACACACTGCTGGGGGCCGG - Intronic
1118877926 14:69800229-69800251 ACTTATACACTGCTGGTGGGAGG - Intergenic
1119676202 14:76556845-76556867 GCTTACACATTGCTGGTGGGAGG - Intergenic
1120711494 14:87797845-87797867 TCTCACATCATGCTGGGGGCGGG + Intergenic
1123586105 15:21762008-21762030 TCTCACATACAGAAGGTGGCTGG - Intergenic
1123622746 15:22204598-22204620 TCTCACATACAGAAGGTGGCTGG - Intergenic
1124088558 15:26576018-26576040 TCCCACATTTTGCTGGTGAGCGG + Intronic
1125790985 15:42365534-42365556 TCTCACTTGCTGATGGTGGCTGG + Intronic
1125953826 15:43776143-43776165 TCTCAGATACTGGGGGTGGAAGG + Exonic
1126448472 15:48778448-48778470 TCTAATAAACTGCTGGTGGGTGG + Intronic
1126672682 15:51130562-51130584 TAACACCTACTACTGGTGGGAGG + Intergenic
1126779755 15:52129341-52129363 TCTCACCTCCCGCTGGTAGGAGG - Intronic
1126782673 15:52151657-52151679 ACTCACATACTGCTGTTGGGAGG - Intronic
1126893717 15:53235439-53235461 GGTCACACACTGCTGGTGGTGGG + Intergenic
1127367008 15:58300501-58300523 TGCCACATACTGCTGCTGTGTGG - Intronic
1127552137 15:60050876-60050898 TCTCTCATAGTTCTGGTGGCTGG - Intronic
1127847355 15:62882546-62882568 TCTCACAAATTACTGATGGGAGG - Intergenic
1128637187 15:69310354-69310376 TCTCATCCACTGCTGGTAGGTGG - Intronic
1128963803 15:72037169-72037191 GCACACATAGTGATGGTGGGTGG - Intronic
1133806883 16:9132493-9132515 GCTCACATGCTGCTGCTGAGAGG + Intergenic
1135730865 16:24894132-24894154 ACTCACAAAGAGCTGGTGGGGGG + Intronic
1135826235 16:25731054-25731076 TCTCACATCTTGTTGCTGGGAGG - Intronic
1138407698 16:56811217-56811239 TCTCACATACTGCTGGTGGGAGG - Intronic
1141452964 16:84117667-84117689 CTTCAGGTACTGCTGGTGGGCGG + Intergenic
1142633835 17:1244120-1244142 TCTCAGACATTGTTGGTGGGGGG - Intergenic
1144132259 17:12257986-12258008 TGTCACATACAGGTGTTGGGAGG - Intergenic
1144366043 17:14545799-14545821 CCTCACCTACTGCAGATGGGAGG + Intergenic
1144379926 17:14684700-14684722 ACTTACATACTGTTGGTGGGAGG - Intergenic
1145006039 17:19338347-19338369 TCTCACCTGCTGCCTGTGGGTGG + Intronic
1147351527 17:39849900-39849922 TCTCAGACATTGCTAGTGGGAGG + Intronic
1148600588 17:48891626-48891648 TCTCCTATATTGCTGGTGAGAGG - Intergenic
1148684848 17:49495582-49495604 TCCCAGATACTGAGGGTGGGTGG + Intronic
1148799719 17:50216044-50216066 TCTTACATACTTCTGGTGACAGG + Intergenic
1150350070 17:64437543-64437565 ACTGTCATAGTGCTGGTGGGAGG - Intergenic
1150730150 17:67685782-67685804 TTTCACATACTGAAGGTGGATGG + Intronic
1151338670 17:73455900-73455922 ACTCACATGCGGCTGCTGGGCGG + Exonic
1152469188 17:80481541-80481563 TATCACACAGAGCTGGTGGGTGG - Intergenic
1152532649 17:80928895-80928917 TCTCAGACACTGTTGGTGGGTGG + Intronic
1152912950 17:83015865-83015887 TTTCACAGACCGATGGTGGGGGG - Intronic
1152988271 18:339123-339145 TCAGACAGACTGCTGGTGGGGGG + Intronic
1153211339 18:2768390-2768412 TCCCATATACTGCTGGTGAGAGG + Intronic
1153577839 18:6540549-6540571 TTTCAAATACTGTTGGTGTGTGG + Intronic
1153973999 18:10250750-10250772 ACTTATACACTGCTGGTGGGAGG - Intergenic
1155060132 18:22221065-22221087 ACTTACACACTGTTGGTGGGAGG - Intergenic
1155434434 18:25796821-25796843 TCTCATACATTGCTTGTGGGAGG - Intergenic
1156141807 18:34121422-34121444 TCTTACACACTGCTGGTCTGTGG + Intronic
1156271968 18:35543677-35543699 TCTCATATGATGCTGGTAGGGGG - Intergenic
1157283988 18:46364731-46364753 GCTCACATACTGATGGAGGGTGG + Intronic
1158439502 18:57462034-57462056 TCTCCTAGGCTGCTGGTGGGAGG - Intronic
1161314053 19:3609617-3609639 TGTCACATAGAGCTGGTGGGAGG + Intergenic
1164093744 19:21985624-21985646 TCTCACAGACTGTGGCTGGGAGG - Intronic
1164113298 19:22191366-22191388 TCTCACAGACTGTGGCTGGGAGG - Intronic
1164197696 19:22985674-22985696 TCTCACAGACTGTGGCTGGGAGG - Intronic
1165654238 19:37519320-37519342 TCTCTTACACTGCTGGTAGGAGG - Intronic
1168268615 19:55237359-55237381 TCTCACATTCTGCTTGTGCCTGG - Intronic
925781518 2:7386416-7386438 TCTCACATGCTGCTAGTGTCTGG - Intergenic
926623487 2:15069997-15070019 TCTGACATTCTCATGGTGGGGGG - Intergenic
926649499 2:15326855-15326877 ACTCACATGCTGCTGGAGAGAGG - Intronic
929109791 2:38397113-38397135 TCTCCCAAAGTGCTGGTGAGAGG + Intergenic
929723404 2:44396624-44396646 TCTCATACACTGTTGGTGGAGGG + Intronic
932962950 2:76436698-76436720 TCTCAAATCCTCCTGGTAGGAGG - Intergenic
933402994 2:81822358-81822380 TCTCACATAGTTCTGGAGGCTGG - Intergenic
935395077 2:102599052-102599074 TCTCATCTATTGCTGGTAGGAGG - Intergenic
935538568 2:104323041-104323063 TATCTCATACTGTTGGTAGGAGG + Intergenic
938699456 2:133863211-133863233 TCGCACATCCTGCAAGTGGGGGG - Intergenic
939440503 2:142243505-142243527 TCTCACATATTGATGATGGGAGG + Intergenic
940425386 2:153525648-153525670 TTTCACATACTGGTGGGGGTGGG - Intergenic
943738584 2:191385981-191386003 GCTCTCAAAATGCTGGTGGGTGG - Exonic
946299827 2:218815909-218815931 TCTCACATACAGCTGAGAGGAGG + Intergenic
947478580 2:230475145-230475167 GCTCATACACTGTTGGTGGGAGG - Intronic
947889879 2:233608039-233608061 TCTCATATGCTTGTGGTGGGAGG - Intergenic
947895308 2:233665892-233665914 TCTCATATGCAGGTGGTGGGAGG - Intronic
1168968010 20:1911733-1911755 TCCCACGCACTGCCGGTGGGAGG - Intronic
1170108690 20:12780984-12781006 ACTTATATGCTGCTGGTGGGAGG - Intergenic
1171044077 20:21794092-21794114 GCTCTCAGGCTGCTGGTGGGAGG + Intergenic
1173275921 20:41582056-41582078 TCCCAAAAACTGTTGGTGGGAGG + Intronic
1174126026 20:48307232-48307254 TCTCTAACACTGCTGGTGGGGGG - Intergenic
1175911953 20:62409220-62409242 TGTCACAGGCTGCAGGTGGGAGG + Intergenic
1178566935 21:33695179-33695201 TCTCTCACACCACTGGTGGGAGG - Intronic
1179930378 21:44567604-44567626 TCTCACATACTGCCAGTGACAGG + Intronic
1180656966 22:17430003-17430025 TCTCATACACTGTTGGTGGGGGG - Intronic
1181076269 22:20379393-20379415 TCACACATACTGGTGGTGGAGGG - Intronic
1181852245 22:25757930-25757952 TCTCACACACTGCAGGGGTGGGG + Intronic
1181995089 22:26871468-26871490 TCTCATCTACTGTTGGTGGGAGG - Intergenic
1182661708 22:31929707-31929729 TCTCACACACATCTGGTGGTTGG + Intergenic
1183337326 22:37257350-37257372 TCCCACACACCGCCGGTGGGAGG - Intergenic
1184135888 22:42549721-42549743 TCTCACCGCCTGCTGGAGGGAGG - Intergenic
949097796 3:106661-106683 ACTCACATGCTGCTGGTTGCTGG - Intergenic
950040974 3:9918949-9918971 TCCCATACACTGCTGGTAGGAGG - Intronic
950925978 3:16742388-16742410 TCTTATACACTGCTGGTGGGGGG - Intergenic
951742792 3:25942797-25942819 TCTCATCTACTGCTGGTGGGAGG - Intergenic
951962629 3:28346535-28346557 TGTCACATACTGCTGTGGTGAGG - Intronic
952181352 3:30919757-30919779 TCTCACACATTGCTGGGCGGTGG + Intergenic
952333948 3:32389040-32389062 TCGCAGGTACTGCTGGTTGGGGG + Intergenic
952860107 3:37806027-37806049 TCTGATACACTGCTTGTGGGAGG - Intronic
952962235 3:38599503-38599525 GCTTACATATGGCTGGTGGGGGG + Intronic
953277751 3:41519979-41520001 GTTCACATTCTGCTGGTGAGAGG - Intronic
953741412 3:45542149-45542171 GCTCACATGCTTCTGGTGTGTGG - Intronic
953940734 3:47093781-47093803 TCTCATACACTGTTGGTGAGGGG - Intronic
955124126 3:56093126-56093148 TCTCAAATACTCCTGGAGGATGG + Intronic
955223116 3:57039337-57039359 TCTCATATACTGCTGTTGCTGGG + Intronic
955491569 3:59488258-59488280 GCTTACATTCTGCTGATGGGAGG - Intergenic
958518868 3:95158312-95158334 TCTCATATAATGCTGGTAAGTGG + Intergenic
960163052 3:114371281-114371303 TCTCAGATACTGGTGATGTGAGG + Intronic
960790225 3:121421941-121421963 TCTCACAAACTCCTGGTTAGTGG + Exonic
962002533 3:131313426-131313448 ACTTACACACTGCTGGTGGGAGG - Intronic
962268285 3:133959091-133959113 TCACTCATACTGCTGCTGAGGGG - Intronic
963063629 3:141244930-141244952 TTTCATACACTGCTGGTGAGAGG - Intronic
963145175 3:141986753-141986775 GCTCATACACTGCTGGTGGCAGG - Intronic
963152228 3:142057167-142057189 TCAGACCTCCTGCTGGTGGGAGG - Intronic
963851055 3:150210870-150210892 TCCCACTTGCTGCAGGTGGGGGG - Intergenic
964354466 3:155837424-155837446 TCTCTTACACTGCTGGTGGTAGG + Intronic
965568262 3:170144590-170144612 TCTCATACATTGCTGGTGAGAGG - Intronic
966980761 3:185133205-185133227 TCTTACATGTTGCTGGTGGGAGG + Intronic
967432907 3:189408227-189408249 GCTCATATACTGCTAGTGGAAGG + Intergenic
968795965 4:2704657-2704679 ACTCAGATGCTGCTGGTGGGTGG - Intronic
969546170 4:7829750-7829772 TCTGATATATTGTTGGTGGGAGG + Intronic
969638005 4:8380603-8380625 CCTCACAGCCTGCTGCTGGGGGG - Intronic
970093122 4:12431711-12431733 TCTCACATCCTACAGGAGGGAGG - Intergenic
970492101 4:16585123-16585145 ACTGACATAGTGCGGGTGGGTGG - Intronic
970633649 4:17982389-17982411 ACTTACACACTGTTGGTGGGAGG - Intronic
970716500 4:18932373-18932395 TGTCACAGATGGCTGGTGGGAGG - Intergenic
972248277 4:37269951-37269973 TCACATATATTGCTGATGGGAGG - Intronic
972963287 4:44479827-44479849 TCACACATTCTGTTGGAGGGAGG - Intergenic
973612243 4:52646913-52646935 TCACACATATTGCTGATGGAGGG + Intronic
973641675 4:52909093-52909115 TCTTATACATTGCTGGTGGGAGG + Intronic
973927175 4:55750323-55750345 GCTTATACACTGCTGGTGGGAGG + Intergenic
977621726 4:99145444-99145466 TCTCATACACTGCTGCTGGTAGG - Intronic
980091876 4:128451354-128451376 TCTCACAGGCTGTTGGTTGGAGG + Intergenic
981655281 4:147105445-147105467 TCTAACATTCTCCTGGTAGGGGG + Intergenic
981730697 4:147894216-147894238 TCTCATACACTGCTGATGGGAGG - Intronic
981847925 4:149191085-149191107 GCTCACAGACGGATGGTGGGGGG + Intergenic
981944476 4:150325209-150325231 ACTCACACACTGCTTGGGGGTGG - Intronic
982138371 4:152294409-152294431 TTACACAGACTGTTGGTGGGAGG - Intergenic
982801942 4:159716675-159716697 TCTTACATAGGGCTGTTGGGAGG + Intergenic
982952452 4:161716726-161716748 TCTCACATTCTACTGGAGGGTGG - Intronic
983780178 4:171660879-171660901 ACTTATATACTGTTGGTGGGAGG + Intergenic
986010849 5:3713892-3713914 TCTCACAAGAAGCTGGTGGGAGG + Intergenic
986337718 5:6767628-6767650 TTTCACGTCCTGCAGGTGGGAGG + Intergenic
988781692 5:34528358-34528380 CCTCATATTCTGCTGGTGGATGG - Intergenic
990166789 5:53003465-53003487 TCTCACATACTGTTAGAGGGAGG + Intronic
991550020 5:67825699-67825721 ACTCACATCTTGCAGGTGGGAGG - Intergenic
991949732 5:71935840-71935862 TCTCACCTTCTGTTGGTGGGTGG + Intergenic
992842289 5:80707791-80707813 TCTCACACACTGCTGAGAGGAGG - Intronic
993071220 5:83166427-83166449 ACTTATATACTGTTGGTGGGAGG - Intronic
994680549 5:102881456-102881478 TTTCATACATTGCTGGTGGGAGG + Intronic
999331390 5:150675917-150675939 TCACACATGCTGCTGGTTAGAGG - Intronic
1000889042 5:166782373-166782395 TCTCATTTATTCCTGGTGGGGGG - Intergenic
1001516710 5:172360454-172360476 CCTCACACACTGCTGGAGGGAGG + Intronic
1002189422 5:177471026-177471048 TCACACATACTTCTGGTATGCGG - Intronic
1004487976 6:16085816-16085838 TTTCACATAGGGCTGGTGGAAGG - Intergenic
1005462761 6:26084757-26084779 TCTCATACACTGCTGATAGGAGG + Intergenic
1006922423 6:37635544-37635566 TATCACCAACAGCTGGTGGGTGG - Exonic
1006971538 6:38050439-38050461 CCCCACATCATGCTGGTGGGAGG + Intronic
1007185365 6:39966856-39966878 TCTCCCCTCCTGCTGGAGGGTGG + Intergenic
1007825505 6:44597173-44597195 CCTCATACACTGCTGGTAGGGGG - Intergenic
1007861125 6:44909926-44909948 TCTCACGAATTGCTGGTGGGAGG + Intronic
1008531068 6:52459592-52459614 TTTCACACACTGCTAGTGGAAGG + Intronic
1009795193 6:68457179-68457201 TCTCATATACTGCTAGGGGGAGG - Intergenic
1013757617 6:113480145-113480167 TATCCCATACTGCTAGTGGAGGG - Intergenic
1013847768 6:114475078-114475100 ACTCATATACTGCTGGTGGCAGG + Intergenic
1016361241 6:143269349-143269371 TCTCATACACTGCTGACGGGAGG + Intronic
1016588191 6:145713610-145713632 ACTCATACACTGCTGGTGAGTGG + Intronic
1018839294 6:167507180-167507202 GCTCACATCCTGCAGGTGTGGGG - Intergenic
1018862764 6:167722932-167722954 TCTCAGAAAGTGCTGGTAGGAGG + Intergenic
1020152861 7:5696936-5696958 GATCACATGCTGCTTGTGGGAGG - Intronic
1022063553 7:26826248-26826270 TCTAAGAAGCTGCTGGTGGGTGG + Intronic
1022260116 7:28695764-28695786 GGTCACATCCTGCAGGTGGGTGG - Intronic
1022347888 7:29534849-29534871 ATTCACATATTGCTGGTGGGAGG - Intergenic
1022951622 7:35344489-35344511 TCTCATATATTGCTGGTGGGAGG + Intergenic
1022967453 7:35486927-35486949 TCTCACTTACTCCTCGTGTGGGG - Intergenic
1023073726 7:36462843-36462865 TCTGACATCATGCTGGTGGGAGG + Intergenic
1023822106 7:43986184-43986206 GCTCATATACAGCTGGTGAGTGG - Intergenic
1024225833 7:47326383-47326405 ACTCAGACCCTGCTGGTGGGAGG - Intronic
1024731559 7:52259082-52259104 TGTGACATACAGCAGGTGGGAGG + Intergenic
1026620230 7:71943751-71943773 TTTCTCATAGTGCTGTTGGGAGG + Intronic
1027204382 7:76085729-76085751 TCCCACAGACTGGTGGTGGAGGG + Intergenic
1027729047 7:81846257-81846279 CCTCACTTTCTGCTGATGGGAGG - Intergenic
1028074229 7:86491866-86491888 TCTCCAATGCTGCTGGTTGGTGG + Intergenic
1029401535 7:100350026-100350048 TCTCACACCCTGCTGGGGGATGG + Intronic
1030745152 7:113156231-113156253 TCACACATACTTCTGGTTTGTGG + Intergenic
1031789167 7:126078464-126078486 TCTCATAAACTGCTGGTGGAAGG - Intergenic
1033396673 7:140980840-140980862 TTTCATGTACTGCTGGTGGTAGG - Intergenic
1036129825 8:6098690-6098712 TCTCCCATACATCTGGTGGTTGG - Intergenic
1037649133 8:20820810-20820832 TTTCACATATTGCTGGGGTGAGG + Intergenic
1041860213 8:62504223-62504245 TTCCACAGACTGGTGGTGGGGGG - Intronic
1042163198 8:65919302-65919324 CCTCATACACTGTTGGTGGGAGG + Intergenic
1042655242 8:71088687-71088709 TCTCCCATGTTTCTGGTGGGTGG - Intergenic
1042734447 8:71972024-71972046 TCTCACATAATGTTTGTGTGAGG + Intronic
1043153603 8:76749185-76749207 TATCACATACAGATGGTGGAAGG - Intronic
1044755134 8:95453617-95453639 TCTCATACACTGCTGGTGGAAGG - Intergenic
1044852000 8:96437720-96437742 ACTCACAGGCTCCTGGTGGGTGG + Intergenic
1046195963 8:110862796-110862818 TCTCCTATACTGCTCATGGGAGG + Intergenic
1047105333 8:121725021-121725043 TCTAACAGACTTTTGGTGGGAGG - Intergenic
1047180748 8:122585338-122585360 TCTAACATACAGCTGGAGAGTGG - Intergenic
1047768089 8:128005755-128005777 TCTCACACACTGCTGCTGAAAGG + Intergenic
1048045294 8:130767206-130767228 GCTCCCATAATCCTGGTGGGAGG - Intergenic
1049596430 8:143485971-143485993 GCTCACATGCTGCTGCTGGCAGG + Intronic
1049862219 8:144907276-144907298 TGCCACATACTGCTCGAGGGGGG - Intergenic
1050259661 9:3828183-3828205 TCTCACAGACTGCTTGAGGAAGG - Exonic
1050502323 9:6312006-6312028 TCTGACATTCTGCAGGTGGAAGG + Intergenic
1051501386 9:17781665-17781687 TCTCAAATACTGCTGGTAGGAGG - Intronic
1051877356 9:21806453-21806475 TCCCAGATACTGCTGGTTAGGGG + Intronic
1053154399 9:35765755-35765777 TCTCATATAATGCTGGTAAGTGG - Intergenic
1053424074 9:37999663-37999685 TCCCACGTGCTGCTGGTGGTTGG - Intronic
1053507611 9:38657027-38657049 TCTCACACACTGCTGCTGCACGG + Intergenic
1053929188 9:43097858-43097880 TCTCACATAATAATAGTGGGAGG + Intergenic
1056318338 9:85413553-85413575 TCTTATATACTGCTGGTGAGAGG - Intergenic
1059862690 9:118482564-118482586 TGTCACATACTGCTGGAGGGAGG + Intergenic
1061622384 9:131819292-131819314 TCTCTTACACTACTGGTGGGAGG - Intergenic
1061780839 9:132995213-132995235 AATCACAGACTGCAGGTGGGTGG - Intergenic
1061912612 9:133733042-133733064 TCTCACATTCAGCTGCTGGAGGG - Intronic
1062086216 9:134650320-134650342 TCTTCCATTCTGCTGGCGGGTGG + Intronic
1062295726 9:135825368-135825390 ATTCCCACACTGCTGGTGGGAGG + Intronic
1186549546 X:10488410-10488432 TCTCACAAACTGCTGGAGGTGGG - Intronic
1186675273 X:11809835-11809857 TCTCATATATTGCTGGTGTGTGG - Intergenic
1187565774 X:20448108-20448130 TCTCACATACTCTCGGTGGTAGG + Intergenic
1188204868 X:27343776-27343798 TCTCATACACTGTTTGTGGGAGG - Intergenic
1188281529 X:28275937-28275959 TCTCATATACTGCTGGTGGTAGG - Intergenic
1188486866 X:30691726-30691748 CCTCCCAAAGTGCTGGTGGGAGG + Intronic
1188826604 X:34842567-34842589 TCTCTCATAATTCTGGTGGTCGG + Intergenic
1189593146 X:42536836-42536858 ACTCACACACTGTTGGTAGGAGG + Intergenic
1189729020 X:43999481-43999503 TCCCACATATTGGTGTTGGGAGG - Intergenic
1192254693 X:69445908-69445930 TCTTATACACTGCTGGTGGGAGG - Intergenic
1192888130 X:75359053-75359075 TTTCCCATACTGCTTTTGGGTGG + Intergenic
1194335234 X:92638922-92638944 GCTCACACACTGTTGATGGGAGG + Intergenic
1195108469 X:101623065-101623087 TCTGCCGCACTGCTGGTGGGAGG + Exonic
1197501637 X:127249685-127249707 TGTCATATACTGCTTGTGAGAGG + Intergenic
1200643703 Y:5755956-5755978 GCTCACACACTGTTGATGGGAGG + Intergenic
1200950532 Y:8894433-8894455 TGTCACATACTGCCTGTGGAGGG - Intergenic
1201253128 Y:12080743-12080765 TCTCACTAACTCCTGGTGGTTGG - Intergenic
1201355683 Y:13094650-13094672 TTACTCATACTGCTGGTGGTAGG - Intergenic
1201459052 Y:14202112-14202134 TCTCAGATACTCCTGGAGAGAGG + Intergenic