ID: 1138409234

View in Genome Browser
Species Human (GRCh38)
Location 16:56825008-56825030
Sequence TTCTGACTCATTTTGCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138409234_1138409235 6 Left 1138409234 16:56825008-56825030 CCAGTCAGCAAAATGAGTCAGAA 0: 1
1: 0
2: 0
3: 13
4: 195
Right 1138409235 16:56825037-56825059 ATACTATATAAAAACTTCCCAGG 0: 1
1: 0
2: 3
3: 26
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138409234 Original CRISPR TTCTGACTCATTTTGCTGAC TGG (reversed) Intronic
905935571 1:41821491-41821513 CTCTGAGTCATTCTGCTGAAGGG + Intronic
907981311 1:59484264-59484286 TGCTGACTCATTTGGCTTCCTGG + Intronic
908788858 1:67761415-67761437 TTCTGTCTGATTTTGTTGAATGG + Intronic
911357218 1:96837334-96837356 TGCTGAGTCCTTTTGCTCACAGG + Intergenic
911388415 1:97206526-97206548 TTCTGGCTCAGTTTGCCCACAGG + Intronic
911591278 1:99751010-99751032 TTTTTACTCAGTTTCCTGACTGG - Intronic
911720348 1:101184061-101184083 TTCAGAGTAATTTTGCTGAATGG - Intergenic
913260175 1:116990722-116990744 TTCTGACTCATGATGCAGTCTGG + Intergenic
913561270 1:120022851-120022873 TTCTGTCCCATTTTATTGACAGG + Intronic
913636856 1:120770751-120770773 TTCTGTCCCATTTTATTGACAGG - Intergenic
914281857 1:146182261-146182283 TTCTGTCCCATTTTATTGACAGG + Intronic
914623735 1:149438044-149438066 TTCTGTCCCATTTTATTGACAGG - Intergenic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
916314979 1:163438955-163438977 TTTGTACTCATTTTGCTGATGGG + Intergenic
916809774 1:168295365-168295387 TTCTGACTCAGTTGGCTGAGTGG - Intronic
917659287 1:177162278-177162300 TTCTGACTCAGTATGCTCAAAGG - Intronic
922146566 1:222951283-222951305 TTCTGACTCATTTTTCTCAGAGG + Intronic
1065459926 10:25949686-25949708 TTCTGATTCATTATACTTACGGG - Intronic
1068175577 10:53453084-53453106 TACTGCTTCATTTTGATGACTGG - Intergenic
1068255244 10:54500717-54500739 TTCTGCCTCATCTTCCTGAATGG - Intronic
1068318227 10:55375329-55375351 TTTTGACTAATTTTGATCACAGG - Intronic
1069511418 10:69045463-69045485 TTGTGATTCATTTTGCTGAAGGG + Intergenic
1070398921 10:76035868-76035890 TTGTCATTCACTTTGCTGACAGG + Intronic
1070762938 10:79036208-79036230 TTCTGACACATTCTGCTCATGGG + Intergenic
1078714316 11:13825569-13825591 TTCTGCCTCCATTTGCTGAGGGG - Intergenic
1080177568 11:29384525-29384547 TTCTGACTCAGTTTTCTGGAAGG - Intergenic
1080823412 11:35827827-35827849 CTCAGAATCATTTTTCTGACAGG - Intergenic
1082045673 11:47724425-47724447 TTCTGAGTGATTTTGAGGACTGG - Intronic
1082133871 11:48524982-48525004 GTCTGTCTCAGTTTGCTCACTGG - Intergenic
1082566887 11:54691365-54691387 GTCTGTCTCAGTTTGCTCACTGG - Intergenic
1082568140 11:54705790-54705812 GTCTGCCTCAGTTTGCTCACTGG - Intergenic
1082623793 11:55459136-55459158 GTCTGTCTCAGTTTGCTCACTGG - Intergenic
1085918867 11:80927050-80927072 TTCTAGCTCCATTTGCTGACAGG - Intergenic
1087092900 11:94293272-94293294 CTCTGGCTCATTTTGCCAACAGG + Intergenic
1087284205 11:96247068-96247090 GTCTGATTCATTCTGTTGACTGG + Intronic
1087305389 11:96483696-96483718 TTCTGCCTCCTTCTGCTGCCAGG + Intronic
1087765318 11:102145838-102145860 TGCTCACTCATTTTGCTCATTGG + Intronic
1092278339 12:7080199-7080221 TTTTGACTCATTTTGCACACTGG + Exonic
1095505457 12:42892859-42892881 TCCTGACCCATCTTGCTGTCTGG - Intergenic
1100020576 12:90064706-90064728 TTCTGGCTCATGTTGCTTTCCGG - Intergenic
1102019677 12:109673585-109673607 CTCTGAGTCATTTTGTTGAAGGG + Intergenic
1103357656 12:120333585-120333607 TACTGCCTCATTTTGCTCATTGG - Intergenic
1103746300 12:123126739-123126761 TGCTGAGTCATTCAGCTGACTGG - Intronic
1104531791 12:129578848-129578870 TACTCACCCACTTTGCTGACAGG + Intronic
1104579841 12:130003106-130003128 TATTGCCTCATTCTGCTGACAGG + Intergenic
1107017596 13:35720260-35720282 TTCTGATTCATTTTGTTGCTGGG + Intergenic
1109649592 13:65309235-65309257 TTATGATTCTTTTTTCTGACTGG + Intergenic
1109921822 13:69073875-69073897 GTCTGATACATTTTTCTGACGGG + Intergenic
1110555440 13:76854324-76854346 TTTTTACACATTTTGCTAACTGG - Intergenic
1113326567 13:109288018-109288040 TTCTGTCTCATACTGCTGATAGG + Intergenic
1113911830 13:113845301-113845323 CTCTGACTCCTTCTGCTGACTGG + Intronic
1115165272 14:30441149-30441171 TTTTGACTCTGGTTGCTGACAGG - Intergenic
1115392159 14:32866093-32866115 TTCTGCCTGAATTTGCTGAGGGG - Intergenic
1116123479 14:40751850-40751872 TTAGGACACATTTTGTTGACAGG - Intergenic
1116917682 14:50541120-50541142 TTCTGATTATTTTTGCTGACGGG - Intronic
1119128412 14:72149840-72149862 TTTTGACTCATGTTTTTGACTGG - Intronic
1119605817 14:76015418-76015440 TCCTGACTCATGTTGCTCAGGGG + Intronic
1119654459 14:76407314-76407336 TTTTTAGTCATTTTGCTGAGCGG + Intronic
1120766572 14:88332877-88332899 TTATGACTCAGTTTTCTCACTGG - Intergenic
1125270322 15:37932061-37932083 TTCTGACTCATTCTTCTGGAAGG - Intronic
1126387236 15:48106762-48106784 TTCTTACTCATTTAGATCACAGG + Intergenic
1126620069 15:50629616-50629638 TTCTGACCCATTTTTCTAAGAGG + Intronic
1127972723 15:63974220-63974242 GTTTGACTCTTTTTGTTGACAGG - Intronic
1128417424 15:67459465-67459487 TTCTGCCTCTTTCTGGTGACAGG - Intronic
1128889916 15:71322328-71322350 TTCTGACACATTTTTCTGGATGG - Intronic
1129836371 15:78709805-78709827 TCCTGTCTCATTTTGTAGACGGG + Intronic
1130764018 15:86851880-86851902 TTCAGACTCATTGTGGTGAATGG + Intronic
1135587083 16:23679556-23679578 GTCTGAGTCATGTTGCTGATAGG + Intronic
1138190919 16:55013446-55013468 TTCTCTCTCATTTTCCTGCCAGG + Intergenic
1138409234 16:56825008-56825030 TTCTGACTCATTTTGCTGACTGG - Intronic
1140054364 16:71512760-71512782 TTCTGAATGACTTTGCTGCCTGG + Intronic
1140536707 16:75716358-75716380 TTCTGAAACTTTTGGCTGACTGG + Intronic
1140613453 16:76630583-76630605 TTCTTACTGATTTTCCTGTCTGG + Intronic
1140948492 16:79793640-79793662 CTATGACTCTTTTTGGTGACTGG + Intergenic
1142751270 17:1989373-1989395 TTCTGACTCACTGTGCTTGCAGG + Intronic
1143708879 17:8719539-8719561 TTCTGGCTCACTGTGCTCACCGG - Intergenic
1144078458 17:11740257-11740279 TGCTGAATTTTTTTGCTGACTGG + Intronic
1145774430 17:27518139-27518161 TTCAGACTCCTTTTGGGGACAGG - Intronic
1145776093 17:27530071-27530093 ATTAAACTCATTTTGCTGACGGG - Intronic
1146081693 17:29786139-29786161 TGATGACCCACTTTGCTGACCGG - Intronic
1148706042 17:49633521-49633543 TTTTGATTTTTTTTGCTGACTGG - Intronic
1149060992 17:52421625-52421647 TTCTCACTCATTTTTTTCACTGG - Intergenic
1155687050 18:28566544-28566566 TTCTGAGTTCTTTTGTTGACTGG + Intergenic
1155689082 18:28594636-28594658 TTCAGACTCAGTTTCCTCACTGG - Intergenic
1158574271 18:58623069-58623091 TTCTGACTGGACTTGCTGACAGG - Intronic
1159949588 18:74473110-74473132 TTCTGCTTCATTCTGCTTACTGG + Intergenic
1166022465 19:40044560-40044582 TTCTGTCACCTTTTGCTGTCTGG - Intronic
1166696773 19:44856381-44856403 TTTTGTGTCATTTTGCTGTCTGG + Intronic
927510186 2:23639488-23639510 TTCTCACTCCTTTTGCTCTCTGG - Intronic
928122669 2:28594534-28594556 TTCTGAGTCAGTTTGCTTCCTGG + Intronic
936766855 2:115861209-115861231 TTTTGTCTCATTTTGGTAACAGG + Intergenic
936867642 2:117093679-117093701 TTCTGACTCTTGTTGGTCACGGG + Intergenic
938044926 2:128110247-128110269 CTATGTATCATTTTGCTGACTGG + Intronic
938891246 2:135707452-135707474 TTCTTACTCATTTACCTAACGGG + Intronic
939068091 2:137507877-137507899 TGCTGGCTCAATTTGTTGACTGG - Intronic
940380051 2:153004436-153004458 TTTAAACTCATTTTGCTTACAGG - Intergenic
940498723 2:154467172-154467194 TTCTGTCTCATTTTGCACAATGG - Intergenic
942977509 2:182036079-182036101 TTCTAACTCACTTTGTTGAAAGG - Intronic
944521411 2:200572445-200572467 TTTTGATTCATTTTGCTGAACGG - Exonic
945276554 2:207993331-207993353 TACTGACTAATCTTGCTGAAGGG + Intronic
945511222 2:210705506-210705528 TTCTTATTAATTTTGCAGACAGG + Intergenic
946515974 2:220412084-220412106 TTCTGCCTGAATTTGCTGAGAGG - Intergenic
947119690 2:226801058-226801080 TGCTGTCTCATTTTGATGCCTGG + Intergenic
947351058 2:229245731-229245753 ATTAGACTCATTTTGCTGAATGG + Intronic
948703513 2:239775497-239775519 TTCAGAGTCATGTGGCTGACGGG - Intronic
1169663733 20:8010273-8010295 TTCTGAATCAGTCTGCTGGCAGG + Exonic
1173984868 20:47253195-47253217 CTCTGACTCAATTGGCTGAGGGG + Intronic
1174231067 20:49046070-49046092 TTCTGACCCATTTTGATGTCAGG - Intergenic
1174520169 20:51123292-51123314 TTCTGATTTATTTGGCTGGCCGG - Intergenic
1176701659 21:10059368-10059390 TTCTTACACATTTTACTGTCTGG - Intergenic
1177563594 21:22788696-22788718 TTTTGCTTCATTGTGCTGACTGG - Intergenic
1177598603 21:23280944-23280966 TTCTGACTCATGTTACTCAATGG + Intergenic
1180903364 22:19390884-19390906 TGCTGACACGTGTTGCTGACAGG - Intronic
1184949654 22:47832333-47832355 TTCTGCCTCTTTCTGCTGATTGG + Intergenic
949271453 3:2222686-2222708 ATCTGACTCATTTTTCTGTTTGG - Intronic
952629862 3:35453371-35453393 TTCTGCCTAAATTTGCTGAAGGG + Intergenic
953270585 3:41439092-41439114 TTCTGTCTCCTTTTGTTCACGGG - Intronic
954869696 3:53758384-53758406 TTCAGATTCCTTTTGCTGCCTGG - Intronic
956489815 3:69758786-69758808 TTCTTACACATTTTCCTGAAAGG - Intronic
959808566 3:110589448-110589470 TTCTGACTTAATTGGCTGATGGG + Intergenic
965312558 3:167148850-167148872 TCATGATTCATTTTGCTGGCAGG - Intergenic
968023008 3:195411991-195412013 TTCTTAAGCATTTTGCTGGCAGG - Intronic
970255488 4:14165229-14165251 TTCTGACTCCTTTTGCTCTTAGG - Intergenic
971233841 4:24823564-24823586 TTCTGATTTATCTTGCTGAAAGG - Intronic
973840877 4:54859306-54859328 TTCTGCCTCCTTATGATGACAGG - Intergenic
977406441 4:96605340-96605362 TTCTTACACATTTTTCTCACAGG - Intergenic
978495322 4:109353560-109353582 TTCTGACTCATTTTTTGGGCGGG + Intergenic
978709476 4:111761324-111761346 GTCTGACTCATTTTTCTTATTGG - Intergenic
979642124 4:123021668-123021690 ATCTGACTTATTTTGAAGACAGG - Intronic
980193605 4:129558795-129558817 TTCTTACCTATTATGCTGACGGG + Intergenic
980373822 4:131915622-131915644 TTCTTACACATTTTACTGGCTGG - Intergenic
981916021 4:150034135-150034157 TTCTGGCTCATTTTCTTGGCTGG - Intergenic
982393039 4:154886159-154886181 TTCTGCCTGATTTTTATGACTGG + Intergenic
984129056 4:175850594-175850616 TTCAGACTATTTTTGCTGTCAGG - Intronic
984351170 4:178595707-178595729 TGCTGACTCACTTCGCTCACAGG - Intergenic
984586396 4:181569493-181569515 TTCTAACTCATTTTCCAGCCTGG + Intergenic
989722786 5:44549773-44549795 TTATGATACATTTTGATGACAGG - Intergenic
990026319 5:51194854-51194876 GTCTGATCCATTGTGCTGACTGG + Intergenic
990928626 5:61060469-61060491 TTCTAAATCAGTTTGTTGACTGG - Intronic
991082856 5:62620043-62620065 GTATGACTCTTTTTGTTGACAGG - Intronic
991562247 5:67965891-67965913 TTCTGTCTCATTTTTCTCCCTGG + Intergenic
996642669 5:125776271-125776293 TTCCCACACATTTTGGTGACTGG - Intergenic
998296700 5:140977152-140977174 ATCAAACTCATTTTGCTGAAAGG - Intronic
998393308 5:141801811-141801833 TTCTGACTCAGTCTCCTGAGTGG + Intergenic
999477906 5:151918237-151918259 TTCTGAATGAATTTGCTGGCTGG + Intronic
1000398855 5:160803981-160804003 TTCTGACTCCAGTTCCTGACTGG + Intronic
1001844514 5:174910188-174910210 TCCTGTCTCATTTTGTAGACGGG - Intergenic
1002348096 5:178561954-178561976 TTCAGCCTCATTTTACAGACGGG + Intronic
1002948698 6:1787244-1787266 GTCTCGCTCATTTTTCTGACTGG - Intronic
1004362557 6:14984149-14984171 TACTGACTTATTTTGCAGACTGG - Intergenic
1005735435 6:28741238-28741260 CCCTGGCTCATTTTGCTGATAGG + Intergenic
1006125790 6:31837134-31837156 TTCTGACTCATTTAGGGAACTGG + Intronic
1006376211 6:33673016-33673038 TTCTGACTCATTCTGAGGGCTGG + Intronic
1006394704 6:33779624-33779646 TTCTGCCTCATTTTTATCACTGG - Intronic
1008894620 6:56538398-56538420 TTCTGAGTCATTATCCTGAAGGG + Intronic
1011812558 6:91149917-91149939 TTCTGACTCTATTATCTGACAGG - Intergenic
1011913231 6:92468242-92468264 TTCTGACACTTCTTGCTGAGAGG + Intergenic
1013588547 6:111600944-111600966 GTCAGACTCATTTTACAGACAGG + Intronic
1015738698 6:136429698-136429720 TTCTGACACATTGCGCTGACAGG + Intronic
1018044505 6:159953796-159953818 TTATGATACATTTTTCTGACAGG - Intergenic
1019894270 7:3971566-3971588 TTGTAACTGATTGTGCTGACCGG - Exonic
1020795545 7:12674872-12674894 TTGTGCCTCATTTTTCTTACTGG - Intergenic
1021897935 7:25255192-25255214 TTCTAACTCATATTCCTGATGGG + Intergenic
1023452904 7:40306872-40306894 TTCTGTCTCTCTTTGCTGTCTGG + Intronic
1024176353 7:46844711-46844733 TTCTGAATCATTTTGGTTTCAGG + Intergenic
1024751155 7:52467174-52467196 TACTGACTCTTTTTGCCTACTGG - Intergenic
1030963589 7:115959240-115959262 TTCTCTCTCACTTTGTTGACTGG - Intronic
1032391437 7:131557352-131557374 TTTAGCCTCATTTTGCAGACAGG + Intronic
1033931032 7:146522001-146522023 TTCTCAGTCATTTTGCTTAATGG + Intronic
1034204652 7:149304893-149304915 TACTAACTCTTTTTGCTGGCGGG + Intergenic
1035014188 7:155750010-155750032 TTCCCACTCATTTTACTGTCTGG + Intronic
1037276404 8:17184486-17184508 TTCTGTATCATTTGGTTGACTGG - Intronic
1039277620 8:35950991-35951013 TGCTGGCACATTTTGCTGAATGG + Intergenic
1040429421 8:47324280-47324302 TTCTTAGCCATTTTGCTGAATGG + Intronic
1043822909 8:84890594-84890616 TTCTGATTCAGTATGCTGAAGGG + Intronic
1044261154 8:90123751-90123773 TCTTGACTCATTGTGTTGACTGG + Intergenic
1044466531 8:92513174-92513196 TCCTGGCTCATTCTGCTGCCTGG + Intergenic
1044680276 8:94770882-94770904 TTCTGACTTTTTTTTTTGACGGG - Intronic
1044965382 8:97569089-97569111 TCCTGACTCATCTTCCTGCCTGG - Intergenic
1045676540 8:104614247-104614269 TTCTGCCTGAATTTGCTGAGGGG - Intronic
1045942807 8:107757779-107757801 TTCTGACTCAGTTTTCTTACTGG - Intergenic
1046700341 8:117393385-117393407 TTCTGAATCATTTTGTTTTCAGG - Intergenic
1047344628 8:124015111-124015133 TTCTGACTCTTTGTGCTTGCTGG - Intronic
1047356849 8:124129944-124129966 TTCTGACTGAATTTCCTGAGAGG + Intergenic
1047515516 8:125551227-125551249 TTCAGATTCATTGTGCTGCCAGG - Intergenic
1048284136 8:133128560-133128582 ATCAGACCCATTTTACTGACAGG + Intronic
1050156701 9:2674612-2674634 TTTAGAATTATTTTGCTGACTGG - Intergenic
1050311959 9:4362319-4362341 CTCTCATTCTTTTTGCTGACTGG + Intergenic
1051408964 9:16769394-16769416 TTCTCTCCCATTTTACTGACAGG + Intronic
1051861255 9:21627502-21627524 TTCTGCCTGAATTTGCTGAGGGG + Intergenic
1053767275 9:41419345-41419367 TTCTTACACATTTTACTGTCTGG + Intergenic
1054319604 9:63642428-63642450 TTCTTACACATTTTACTGTCTGG - Intergenic
1058188494 9:101884826-101884848 TATTGACACATATTGCTGACTGG + Intergenic
1059630327 9:116114957-116114979 TTCAGCCTCAGTTTGCTGAAAGG + Intergenic
1202786676 9_KI270719v1_random:29456-29478 TTCTTACACATTTTACTGTCTGG - Intergenic
1185723562 X:2401409-2401431 TTCTGATTCATTTAGCTTCCTGG - Intronic
1186218342 X:7323958-7323980 GTCTGACTCTTTTTGTAGACAGG - Intronic
1188287092 X:28340971-28340993 TGCTGACTCAATTTGTTCACTGG + Intergenic
1193089850 X:77482347-77482369 TTCTGCCTGAATTTGCTGAGGGG + Intergenic
1193954094 X:87837141-87837163 TTCTCACACTTTTTGCAGACCGG + Intergenic
1195176178 X:102317467-102317489 TTCTGACTCATTTTTCTCTCCGG - Exonic
1195182686 X:102369626-102369648 TTCTGACTCATTTTTCTCTCCGG + Exonic
1197919488 X:131576491-131576513 ATCTGACTAGTTTTGCTTACAGG - Intergenic
1199503999 X:148541337-148541359 TTCTGATTCCTCGTGCTGACTGG + Intronic
1200700561 Y:6398702-6398724 CTCTGTCACATTTTGATGACTGG - Intergenic
1200852106 Y:7893890-7893912 GTCCCACTCACTTTGCTGACAGG + Intergenic
1200875596 Y:8151173-8151195 TTCTGACTCTATTTCCTGATGGG - Intergenic
1201033551 Y:9765996-9766018 CTCTGTCACATTTTGATGACTGG + Intergenic
1201891670 Y:18949325-18949347 GTCTGACTCTTTTTATTGACAGG + Intergenic