ID: 1138410571

View in Genome Browser
Species Human (GRCh38)
Location 16:56836481-56836503
Sequence CAAGTGGAATTGCTTGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138410571_1138410573 -10 Left 1138410571 16:56836481-56836503 CCCAGGGCAAGCAATTCCACTTG 0: 1
1: 1
2: 0
3: 13
4: 166
Right 1138410573 16:56836494-56836516 ATTCCACTTGAAGTATTTTTTGG 0: 1
1: 0
2: 4
3: 26
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138410571 Original CRISPR CAAGTGGAATTGCTTGCCCT GGG (reversed) Intronic
901014864 1:6222896-6222918 GAAGTGGAATTTGCTGCCCTAGG + Exonic
901222183 1:7589463-7589485 CAAGAGGATTTGCCTCCCCTGGG - Intronic
901843192 1:11966375-11966397 GAAGGGAAACTGCTTGCCCTGGG + Intronic
901890381 1:12258489-12258511 CCAGTGGACTTGATTGACCTTGG + Intronic
902454762 1:16524819-16524841 CAAGTGGAAGCGCTTTCTCTTGG + Intergenic
904979325 1:34483756-34483778 CAAGTGGACAGGCTTGCCCTGGG - Intergenic
905765144 1:40594342-40594364 CAAGTCGAGTTGCATGCTCTGGG + Intergenic
906137247 1:43508054-43508076 CAAGTGGGAGTGTTTGTCCTGGG + Intergenic
907872158 1:58453331-58453353 CAAGTCGACTTCCTTTCCCTGGG - Intronic
911727561 1:101258065-101258087 CATTTGGTACTGCTTGCCCTGGG + Intergenic
913320107 1:117582162-117582184 CACTTGGAGTTGCTTGGCCTTGG - Intergenic
916012182 1:160716366-160716388 CAAGTCAAATGGCTTGCCCAAGG + Intergenic
917266505 1:173226357-173226379 AAAAGGAAATTGCTTGCCCTGGG + Intergenic
918060448 1:181056611-181056633 CATGTGGAGCTACTTGCCCTGGG + Exonic
920555206 1:206899421-206899443 AAAGTGGAATTCTTGGCCCTGGG - Exonic
922680173 1:227588367-227588389 CAAGTGGTATTTCTGCCCCTGGG + Intronic
923933275 1:238727951-238727973 GAAATGGAATTGCTGGCCATGGG + Intergenic
924535962 1:244936033-244936055 GAAGTTGAATTAATTGCCCTTGG - Intergenic
1063084252 10:2800629-2800651 GAAGTGGAATTTCTGGCCCACGG - Intergenic
1064304991 10:14157463-14157485 AAAGTGAAATTGCTTGCCGAAGG - Intronic
1065112088 10:22450148-22450170 CACCTGGAATTGCTGGGCCTTGG - Intronic
1067170314 10:43900528-43900550 CAAGTCAAATTGCTTGCTCTGGG - Intergenic
1070891277 10:79943721-79943743 CCAGTGGAATTCCGTGCCCTGGG + Intronic
1071417060 10:85451205-85451227 CAAGTGGAATTCCTTGCCCTTGG + Intergenic
1072237843 10:93468607-93468629 CAACTGGAAATTCTTGGCCTGGG - Intronic
1077922514 11:6652336-6652358 CAAATGTAACTGCTTTCCCTAGG - Intronic
1083102331 11:60321311-60321333 CAAGTGGCATTTCTTGTTCTAGG + Intergenic
1085362432 11:75902440-75902462 CAGGTGGTGATGCTTGCCCTGGG + Intronic
1085543584 11:77296369-77296391 GAAGTGGAATGGCGTGCTCTCGG + Intronic
1085546382 11:77322201-77322223 CAAATGGAAATGCTTACACTGGG - Intronic
1092870532 12:12802000-12802022 GCAGGGGAATTGCTTGACCTGGG - Intronic
1098389349 12:69952671-69952693 CAAATGGAATCTCTTGACCTGGG + Intronic
1102277794 12:111597469-111597491 GAAATGGACTTGCGTGCCCTTGG + Intronic
1102575004 12:113850635-113850657 CAAAAGGCATTGCATGCCCTTGG + Intronic
1103274551 12:119700751-119700773 CAAGTGGAGTCGCTTACCTTTGG - Exonic
1103374051 12:120441361-120441383 CAAGAGGAAGTGCTTGATCTGGG + Intronic
1110561401 13:76914257-76914279 TAGGTGGCATTGCTTTCCCTGGG + Intergenic
1111664765 13:91253320-91253342 CAAGGAGAATTGCATTCCCTTGG + Intergenic
1116438155 14:44918395-44918417 GAAGTGGAATTGCTGGGCCAGGG - Intergenic
1117688407 14:58279491-58279513 GCAGTTGAATTGCTTGACCTTGG + Intronic
1119729368 14:76941320-76941342 GAAGTGGAATTGCTTACCAGTGG - Intergenic
1119793433 14:77375177-77375199 CAAGAGGAAGAGCTTGCTCTGGG + Intronic
1120474402 14:84969377-84969399 CAAGAGGAAGTGCTTGCTCCAGG - Intergenic
1121889098 14:97572530-97572552 CAAGCTGAATTGGTTGTCCTGGG + Intergenic
1122040258 14:98982671-98982693 GAGGTGGAATGGCTTGCCCAAGG + Intergenic
1123502877 15:20906792-20906814 CAGGTAGAATTGCTTGAACTCGG + Intergenic
1123596365 15:21917758-21917780 CAGGTAGAATTGCTTGAACTCGG + Intergenic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1125178047 15:36847993-36848015 TAAGAGTAATTGCTGGCCCTTGG + Intergenic
1129042697 15:72703616-72703638 GAAGTGAAATAACTTGCCCTAGG + Intronic
1130159874 15:81388171-81388193 CAAGTGGTTTTGCTGGCACTTGG - Intergenic
1132308062 15:100832023-100832045 AAAGTGGAAATGAATGCCCTTGG + Intergenic
1202968472 15_KI270727v1_random:207618-207640 CAGGTAGAATTGCTTGAACTCGG + Intergenic
1133665126 16:7959711-7959733 GAAGTGGAATTACTTGGTCTTGG + Intergenic
1133733679 16:8597406-8597428 CAAATAAAATTACTTGCCCTCGG + Intergenic
1138142284 16:54579146-54579168 CAAGTGAAACTTTTTGCCCTAGG + Intergenic
1138410571 16:56836481-56836503 CAAGTGGAATTGCTTGCCCTGGG - Intronic
1140526245 16:75625407-75625429 GAGGTAGAATTGCTTGCCCCTGG - Intergenic
1143098598 17:4492059-4492081 CAACTGGAATCTCTTGCCCAGGG - Intergenic
1145088548 17:19965950-19965972 CAAGTTGAATACTTTGCCCTAGG + Intronic
1146826494 17:36027931-36027953 CCTGTGGAACTGCATGCCCTGGG + Intergenic
1149577964 17:57727383-57727405 CAAGTGTCATTGTGTGCCCTTGG - Intergenic
1153048728 18:881267-881289 CAGGTCGAATTTATTGCCCTGGG + Intergenic
1156722591 18:40088373-40088395 AAACTGGAATTGCTTCCTCTGGG - Intergenic
1157200785 18:45657709-45657731 GAAATGGAATGACTTGCCCTAGG - Intronic
1157351011 18:46885425-46885447 CAAGGAGAATTGCTTGAACTTGG + Intronic
1157565504 18:48676619-48676641 CAAGTGGGATTTCTGGCCTTAGG + Intronic
1157745279 18:50129660-50129682 GAAGTGGAATAACTTGCCCGAGG + Intronic
1158044684 18:53141959-53141981 CATGTTGAATTCCTTTCCCTAGG + Intronic
1160197764 18:76770759-76770781 CAAGAGAAATTGCTTCCCTTGGG + Intergenic
1161007457 19:1943740-1943762 CAGCCGGAGTTGCTTGCCCTGGG + Intronic
928119081 2:28568952-28568974 AAAGTGGAATGGTTTGTCCTAGG - Intronic
932088470 2:68783554-68783576 CAAGGAGAATTGCTTGAACTGGG - Intronic
933770775 2:85742573-85742595 CAACTGGAAATGTTTGCTCTGGG + Intergenic
934933412 2:98446216-98446238 CACGTAGAATTGCTTGCTATAGG + Intronic
937956877 2:127426644-127426666 CAAGTGGGAGTATTTGCCCTGGG + Intronic
938630463 2:133161015-133161037 CAGGTGGCAATGCTTGCTCTTGG - Intronic
939520410 2:143223277-143223299 CACTTGGCATTTCTTGCCCTAGG + Intronic
941292358 2:163693137-163693159 CAAGGGGATTTGCTTTCACTTGG - Intronic
942571767 2:177322578-177322600 CTAGTGGCATGGTTTGCCCTTGG + Intronic
944433984 2:199666949-199666971 GAAGTGGAGTTGCTTTTCCTTGG + Intergenic
944723873 2:202450014-202450036 GCAGGGGAATTGCTTGACCTAGG + Intronic
945035705 2:205702339-205702361 CAACTGGAAATGCTGGCCTTGGG - Intronic
945692742 2:213061080-213061102 TAAGTGGAATTGCTTAAACTAGG - Intronic
946505936 2:220300849-220300871 CAAGTTAAATTCCTTTCCCTAGG - Intergenic
948955704 2:241288932-241288954 CAAGTGTAAATTGTTGCCCTGGG - Intronic
1169763795 20:9127270-9127292 CAAGAGAAATGGCTTTCCCTAGG - Intronic
1170152182 20:13237215-13237237 CAGGTGGAATTGCTGGGCCAAGG - Intronic
1172583187 20:36064609-36064631 CAAGTGGAGGTCCTGGCCCTGGG - Intergenic
1172888166 20:38245775-38245797 CAAGTATCATTGCTTGCCCAGGG - Intronic
1173689805 20:44951893-44951915 GAGGTGGAATTCCTTGCCTTCGG - Exonic
1174995781 20:55566930-55566952 AAAATGGCATAGCTTGCCCTCGG + Intergenic
1178639795 21:34336774-34336796 CAGGTGAAATTGCTTTCGCTAGG + Intergenic
1178745190 21:35242556-35242578 CAAGTGGAATTGCTGGGCCAAGG - Intronic
1181044090 22:20206477-20206499 CCAGTGGAGGTGTTTGCCCTGGG - Intergenic
952015146 3:28947946-28947968 CAATTTGAATTGCTTGGCTTGGG - Intergenic
953501112 3:43435413-43435435 GCAGGGGAATTGCTTGCACTTGG + Intronic
955961263 3:64343494-64343516 CGAGTGGAAGTGCTTAACCTAGG + Intronic
962024784 3:131536389-131536411 CCATTGAAATTGCTTGCCCAGGG - Intronic
962942169 3:140134960-140134982 CACATGGAATTCCTTGCCCCAGG + Intronic
963837526 3:150071972-150071994 TATGTGTAATTACTTGCCCTCGG - Intergenic
969668898 4:8578852-8578874 CAAGTGGAATTGTCTCCCTTTGG + Intronic
970426507 4:15950779-15950801 CCAGTGGAATTTCTTCCCCTTGG - Intergenic
971134528 4:23853910-23853932 CAAGTTCAGTAGCTTGCCCTAGG - Intronic
976206590 4:82628341-82628363 CTATTGGAATTGCTTTCCCTGGG + Intergenic
977416654 4:96742618-96742640 CAGCTGGCATTGCTGGCCCTGGG + Intergenic
978453164 4:108859244-108859266 GAAGTGAAATAACTTGCCCTAGG + Intronic
978908225 4:114034972-114034994 GAAGTGAAATTACTTGCCCGAGG + Intergenic
981780473 4:148423794-148423816 GAAGGGGAATTGCTTGAACTAGG - Intronic
982360379 4:154512998-154513020 CATTTGGAATTGATTCCCCTTGG + Intergenic
982450910 4:155551185-155551207 GCAGTAGAATTGCTTGACCTGGG + Intergenic
984598673 4:181701489-181701511 CAGGTAAAAGTGCTTGCCCTTGG - Intergenic
987316411 5:16728699-16728721 CAAGTGGAGTGGCTTGCTCAAGG + Intronic
987991725 5:25221206-25221228 CAAGTGAAAGTAATTGCCCTTGG + Intergenic
989264134 5:39453431-39453453 CAAGAAGAATGGCTTGGCCTTGG + Intronic
989305894 5:39955586-39955608 CAAATGGTATTTCTGGCCCTAGG - Intergenic
990687483 5:58322517-58322539 GAAGTAGAATTTCTTTCCCTAGG - Intergenic
992380159 5:76228832-76228854 GAAGTTAAATGGCTTGCCCTAGG + Intronic
992396010 5:76370389-76370411 CAGGAGGAATTGCTTGAACTTGG - Intergenic
994445259 5:99864184-99864206 GAAGTGGAATTGCTAGGCCATGG + Intergenic
996192203 5:120558804-120558826 CAATTGTTATTGCTTGCCTTTGG + Intronic
996423415 5:123286773-123286795 GAAGTGGAATTGCTGGGCCACGG + Intergenic
999833147 5:155339909-155339931 AAGGTGAAATTGCTTGCCCAAGG + Intergenic
1001628160 5:173154224-173154246 CAAGTGCTATTGTATGCCCTTGG + Intronic
1001784500 5:174400581-174400603 GAATTGGAATTGCTTGCACTGGG + Intergenic
1001969043 5:175938950-175938972 CAAGTGGAAGAGCAGGCCCTGGG + Intronic
1002248400 5:177904793-177904815 CAAGTGGAAGAGCAGGCCCTGGG - Intergenic
1002518422 5:179775941-179775963 CAAGTGGAATTGCTTCCTCCGGG - Exonic
1003112348 6:3260545-3260567 CAAAGGGACTTGCTTGCCTTTGG - Intronic
1005234417 6:23743269-23743291 AAAGGGGATTTGCTAGCCCTAGG - Intergenic
1005611784 6:27532862-27532884 CAAGTGGAGTGGCCTGTCCTGGG + Intergenic
1005622751 6:27635220-27635242 CAGGTGGAATTGATTGACTTGGG - Intergenic
1006788427 6:36683265-36683287 CAAGTTAAGTTGCTTGCCCAGGG + Intronic
1006869936 6:37242321-37242343 CATGTGGAATTTCCTTCCCTTGG - Intronic
1007761015 6:44133764-44133786 CCAGTGGAAAAGCTTGCCGTAGG + Intronic
1012687078 6:102265259-102265281 AAAGTGGATCTGCTTGCCCATGG - Intergenic
1016044646 6:139468256-139468278 CATGTGGATTTGCATGGCCTTGG + Intergenic
1016372257 6:143387300-143387322 CAAGTGGAAGAGTTTGCCTTCGG + Intergenic
1016448096 6:144153382-144153404 CAAGTGGAATTGTCTGCTGTAGG + Intronic
1018238541 6:161750025-161750047 CAAGTGGTATTGCTTCAACTGGG - Intronic
1020069133 7:5214150-5214172 AAACTGCAATTGCTTCCCCTGGG - Intronic
1020479874 7:8645827-8645849 CAAGTGGAATTGCTTATCAGTGG - Intronic
1021180721 7:17502350-17502372 GAAGGGAAATTGCTGGCCCTGGG + Intergenic
1023812686 7:43924612-43924634 CAAGGGGAAGTGCTTGACTTGGG + Intronic
1024083497 7:45874876-45874898 CAAGTGGAATTGCTGGTTCAAGG - Intergenic
1025851465 7:65248064-65248086 GAAGTGGAATGGCGTGACCTCGG + Intergenic
1028730366 7:94140807-94140829 GAAGTGGAATTGCTGGTCTTAGG + Intergenic
1030196767 7:106860280-106860302 GAAGTTGAGTGGCTTGCCCTTGG - Intergenic
1033924878 7:146445442-146445464 CATGTGAAATTGCTTGCTCTAGG - Intronic
1037361800 8:18082468-18082490 CAAGTGGCATTGCTTTGTCTTGG - Intronic
1037499571 8:19472053-19472075 CAAGTGTAATTTCTAACCCTTGG - Intronic
1037508783 8:19560778-19560800 GAAGTGGAATTGCTGGCTCCTGG - Intronic
1041147178 8:54889332-54889354 GAAGTGTAAGTGCTTGACCTTGG + Intergenic
1041223620 8:55676193-55676215 TAAGAGGTTTTGCTTGCCCTGGG + Intergenic
1041784678 8:61618164-61618186 CATGTGGAATTGCTGGCCTCTGG - Intronic
1042276883 8:67014839-67014861 CAAGGAAAATTGCTTGCACTGGG - Intronic
1047399761 8:124536205-124536227 CAAGTGGAATTCTATTCCCTGGG - Intronic
1047465419 8:125108235-125108257 CCAGTGGGAGTGATTGCCCTTGG - Intronic
1048010468 8:130451394-130451416 GCAGGGGAATTGCTTGACCTGGG - Intergenic
1049384714 8:142337302-142337324 CAAGTTGAATTGCTGGCCGTAGG - Intronic
1049419941 8:142511954-142511976 GAGGTGGCATTGCTGGCCCTTGG + Intronic
1051303777 9:15685007-15685029 CATATGGAATTTGTTGCCCTAGG - Intronic
1051307427 9:15727672-15727694 CATTTGGAATTGCTTACACTTGG - Intronic
1055280405 9:74667547-74667569 CAAGTCTACTTGCTTGCCATTGG + Intronic
1055468208 9:76586183-76586205 CAGGTGGAATTGCGTCCCCCAGG - Intergenic
1055479669 9:76697143-76697165 CTAGTGGCATTGCTTGCTTTAGG - Intronic
1056596383 9:88011188-88011210 CAGGTGGATCTGCTTGCCCAAGG + Intergenic
1056605784 9:88083755-88083777 CAAGGGGAATTGCTTGAACCTGG - Intergenic
1057514299 9:95708383-95708405 CAAGTGGAACGGCATGCCATGGG - Intergenic
1058741299 9:107945221-107945243 TAAGTGGAAGGTCTTGCCCTCGG - Intergenic
1059344742 9:113620532-113620554 GAAGTGGAATAACTTGCCCAGGG + Intergenic
1186580189 X:10809384-10809406 CAAATGGTATTTCTAGCCCTAGG - Intronic
1187762800 X:22606484-22606506 CATGTGGTGTGGCTTGCCCTGGG - Intergenic
1191754364 X:64578190-64578212 CAAGTGGAATTGCTGGGTCAAGG + Intergenic
1192190299 X:68987183-68987205 GAAGTGCAATGGCTTGCCCATGG - Intergenic
1195308957 X:103611390-103611412 CAAGTGAAATTACTTGCCCAAGG - Intronic
1200125659 X:153813041-153813063 CAATTGGAATTGCTTGGCCAGGG - Intronic
1200345375 X:155441921-155441943 AAGGTGGAATTGCTTTCCCTGGG - Intergenic
1200591188 Y:5078403-5078425 CAAGTGGTATTTCTGGTCCTAGG + Intronic
1201642648 Y:16195975-16195997 GAAGTGCAATGGCTTGCTCTTGG + Intergenic
1201660167 Y:16389346-16389368 GAAGTGCAATGGCTTGCTCTTGG - Intergenic