ID: 1138415105

View in Genome Browser
Species Human (GRCh38)
Location 16:56867124-56867146
Sequence ATGACTGATGGGCTGGTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 341}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138415093_1138415105 9 Left 1138415093 16:56867092-56867114 CCCTGGCCTTTGACAGCCGGCCC 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1138415105 16:56867124-56867146 ATGACTGATGGGCTGGTGGAGGG 0: 1
1: 0
2: 0
3: 27
4: 341
1138415095_1138415105 3 Left 1138415095 16:56867098-56867120 CCTTTGACAGCCGGCCCAGCCAC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1138415105 16:56867124-56867146 ATGACTGATGGGCTGGTGGAGGG 0: 1
1: 0
2: 0
3: 27
4: 341
1138415091_1138415105 17 Left 1138415091 16:56867084-56867106 CCTGCATGCCCTGGCCTTTGACA 0: 1
1: 0
2: 0
3: 20
4: 244
Right 1138415105 16:56867124-56867146 ATGACTGATGGGCTGGTGGAGGG 0: 1
1: 0
2: 0
3: 27
4: 341
1138415094_1138415105 8 Left 1138415094 16:56867093-56867115 CCTGGCCTTTGACAGCCGGCCCA 0: 1
1: 0
2: 2
3: 5
4: 113
Right 1138415105 16:56867124-56867146 ATGACTGATGGGCTGGTGGAGGG 0: 1
1: 0
2: 0
3: 27
4: 341
1138415096_1138415105 -7 Left 1138415096 16:56867108-56867130 CCGGCCCAGCCACGAGATGACTG 0: 1
1: 1
2: 2
3: 21
4: 176
Right 1138415105 16:56867124-56867146 ATGACTGATGGGCTGGTGGAGGG 0: 1
1: 0
2: 0
3: 27
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138415105 Original CRISPR ATGACTGATGGGCTGGTGGA GGG Exonic
900390669 1:2432542-2432564 ATGACTGCTGGGCACGTGGCCGG + Intronic
900735299 1:4296011-4296033 ATGACTGATGGGTGGGTGGGTGG - Intergenic
901006723 1:6175299-6175321 ATGAATGAATGGATGGTGGATGG + Intronic
901262550 1:7884887-7884909 ATGGATGATGGGCAGATGGATGG - Intergenic
901668398 1:10839367-10839389 AGGACTGGGGGGATGGTGGATGG + Intergenic
904064925 1:27742071-27742093 CTTACTGATGGGTTGGGGGATGG + Intronic
904318133 1:29679363-29679385 ATGAGTGTAGGGCTGGGGGAAGG + Intergenic
904464962 1:30702159-30702181 ATGAGTGATGGGAAAGTGGAGGG - Intergenic
906515699 1:46437643-46437665 AAGACTGATGGGATGGAGGTGGG + Intergenic
907570530 1:55479011-55479033 ATGATTGATGGGTGGGAGGAAGG - Intergenic
907747507 1:57227915-57227937 ATAACTTATGGGCGAGTGGAAGG + Intronic
908755308 1:67464299-67464321 ATGAAAGATGGGCTGTAGGAGGG - Intergenic
910471389 1:87556761-87556783 AAGAGTGATGGGCTGGAGGTTGG + Intergenic
910516553 1:88067882-88067904 AAGGCTGATGGGGTGGTGAAAGG + Intergenic
911090855 1:94015820-94015842 GTGAGTGCTGGGCTGGTGGTGGG - Exonic
911411567 1:97515787-97515809 ATCATTGATGTGCTGGTGGCTGG + Exonic
912183346 1:107245111-107245133 ATGAATGATGTGGTGGGGGAGGG + Intronic
912301056 1:108517842-108517864 ATGGTTGTTGGGCTGGGGGACGG - Intergenic
914196421 1:145450350-145450372 ATGAATGATGAACAGGTGGAGGG + Intergenic
916748114 1:167699932-167699954 ATAACTGATGGGATGGAGGGAGG - Intronic
918041474 1:180916542-180916564 CTGCCTGATGGGCAGCTGGACGG + Exonic
918139633 1:181709536-181709558 ATGAATGAGGGGCTGGGGGATGG - Intronic
919807865 1:201391419-201391441 ATGGAAGATGGGCTGGTGGGAGG - Intronic
919850043 1:201666421-201666443 AAGACAGATGGGGTGGGGGATGG + Intronic
921463438 1:215456610-215456632 ATGTGTGATGGGCTTATGGAAGG - Intergenic
1063103294 10:2970265-2970287 AGGACACATGGGGTGGTGGAGGG - Intergenic
1063530330 10:6824729-6824751 ATGGGTGTTGGGCTGGGGGACGG + Intergenic
1063978951 10:11438285-11438307 CTGACTGGTGGGTGGGTGGATGG + Intergenic
1064724284 10:18261660-18261682 TTGAATGATGGGATGGTGGGGGG + Intronic
1069784290 10:70977879-70977901 ATGACTGCAGGGATGATGGATGG + Intergenic
1069862966 10:71482613-71482635 TGGACTGCTGGGCAGGTGGAGGG + Intronic
1070384043 10:75907927-75907949 ATGACTCTTGGGCAGGTGAAGGG + Intronic
1072631803 10:97151498-97151520 TTGACTGATGGGTTGGTAGATGG + Intronic
1073043097 10:100620727-100620749 GTCACTGATGGGCAGGTGGATGG + Intergenic
1073152405 10:101321092-101321114 CTGACTGAGGGGCTGGGAGAAGG + Intergenic
1073537320 10:104289523-104289545 ATAACTGATGGGCAGCAGGAGGG + Intronic
1073824322 10:107303163-107303185 GTGACTGATGGGATGGTGGGTGG + Intergenic
1074148686 10:110739605-110739627 AGGACTGACGTGGTGGTGGAAGG + Intronic
1076073929 10:127517042-127517064 ATGAGAGGGGGGCTGGTGGAGGG + Intergenic
1076586355 10:131550721-131550743 AGGACTGTTGGGCAGGTGGGTGG + Intergenic
1077587698 11:3466564-3466586 CTGACTGATAAGCTGGTGGTGGG + Intergenic
1080192302 11:29566770-29566792 ATGACTGAAGGGGTGGTTGTAGG - Intergenic
1080544290 11:33300434-33300456 TTGGCTGGTTGGCTGGTGGAGGG - Intronic
1082257391 11:50046442-50046464 ATGACTGTTGGGCAGGTGACAGG - Intergenic
1083664558 11:64267434-64267456 ATGCCGGAGGGGCTGGGGGACGG + Exonic
1084243405 11:67838232-67838254 CTGACTGATCAGCTGGTGGTGGG + Intergenic
1084545566 11:69813533-69813555 ATGTCAGATGGGTGGGTGGATGG + Intronic
1084596245 11:70118653-70118675 ATGATTGATGGGTGGGTGGGTGG + Intronic
1084596355 11:70119166-70119188 ATGGATGATGGGTGGGTGGATGG + Intronic
1084596392 11:70119302-70119324 ATGGGTGATGGGTGGGTGGATGG + Intronic
1084596433 11:70119501-70119523 ATGGATGATGGGTGGGTGGATGG + Intronic
1084596507 11:70119884-70119906 ATGAATGATGGGTGGGTAGATGG + Intronic
1084785641 11:71440331-71440353 ATGGATGACGGGCAGGTGGATGG + Intronic
1084950552 11:72662925-72662947 ATGGCTCCTGGGCTGGAGGAAGG - Intronic
1085304508 11:75477550-75477572 AAGCCTGAGGGGCTGGGGGAGGG - Intronic
1086404199 11:86486228-86486250 ATGAATGATGGACTGTAGGATGG - Intronic
1086935775 11:92744108-92744130 ATGACTGATGAGATGTTGGGAGG + Intronic
1088827790 11:113510322-113510344 ATGAATGATGGGATGGGGGTAGG + Intergenic
1089808899 11:121115253-121115275 TTGATGGATGGGTTGGTGGATGG - Intronic
1090275704 11:125417858-125417880 ATGGAAGATGGGGTGGTGGATGG - Intronic
1090660498 11:128878695-128878717 ATGACTGAGGGGGTGGTGGGTGG - Intergenic
1090666050 11:128915747-128915769 ATGAGTGATTGGATGGTTGAAGG + Intronic
1091187351 11:133658433-133658455 ATGGATGATGGGTGGGTGGATGG + Intergenic
1093979545 12:25460352-25460374 ATGACTGATAGGCTTTGGGAAGG + Intronic
1094527045 12:31238252-31238274 AGGGCTGATGGTCTGGTTGAGGG + Intergenic
1096092497 12:48912487-48912509 ATGACTGTTAGGCTCCTGGAGGG + Intronic
1096104629 12:48989797-48989819 ATGACAAATAGGTTGGTGGATGG + Intergenic
1098516111 12:71377857-71377879 ATGACTGAAGAGCTTGTGGGAGG - Intronic
1100330540 12:93577764-93577786 ATGACTGCTGTGCAGGTGGGCGG + Intronic
1102506919 12:113389567-113389589 AAGACGGATGGGTGGGTGGAAGG - Exonic
1102640239 12:114360680-114360702 ATGAGTGATGGATGGGTGGATGG + Intronic
1102856116 12:116295538-116295560 ATGAAGGATGGGTGGGTGGATGG + Intergenic
1103255955 12:119541445-119541467 ATGAATGAATGGATGGTGGATGG + Intergenic
1103431107 12:120887440-120887462 ATGACTGAAGGTTTGGTGGGTGG - Intronic
1104281322 12:127380663-127380685 ATGACCGATGTGCCCGTGGACGG + Intergenic
1104778491 12:131404971-131404993 ATGATGGATGGGTGGGTGGATGG - Intergenic
1104896221 12:132166312-132166334 ATGACGGATGGCTGGGTGGATGG - Intergenic
1104896236 12:132166386-132166408 ATGAAGGATGGGTGGGTGGATGG - Intergenic
1104896277 12:132166546-132166568 ATGAGGGATGGGTGGGTGGATGG - Intergenic
1104896319 12:132166698-132166720 ATGATGGATGGGTGGGTGGATGG - Intergenic
1104896332 12:132166753-132166775 ATGATGGATGGGTGGGTGGATGG - Intergenic
1104896355 12:132166848-132166870 ATGATGGATGGGTGGGTGGATGG - Intergenic
1104896424 12:132167109-132167131 ATGATGGATGGGGGGGTGGATGG - Intergenic
1105621673 13:22073605-22073627 GTGACTGATGGGTGGGTGGGTGG + Intergenic
1106798433 13:33231505-33231527 ATGAATGAGGGACTGGAGGAGGG + Intronic
1108842187 13:54632691-54632713 ATCAGTGATGGGCAGGTAGAGGG - Intergenic
1111707894 13:91774482-91774504 GTGAAGGATGGGCTGGTGCAGGG + Intronic
1113901108 13:113798620-113798642 ATGACAGATGGGTGGATGGATGG + Intronic
1113901133 13:113798742-113798764 ATGACAGATGGGTGGATGGATGG + Intronic
1113934096 13:113984335-113984357 GTGAGTGATGGGTAGGTGGACGG - Intronic
1113934169 13:113984662-113984684 ATGAGTGATGGGTGGATGGAAGG - Intronic
1113934551 13:113986820-113986842 ATGAGTGATGGGTGGATGGAAGG - Intronic
1113934846 13:113988572-113988594 ATGAGTGATGGGTGGATGGAAGG - Intronic
1113935058 13:113989546-113989568 ATGAGTGATGGGTGGATGGAAGG - Intronic
1114609112 14:24024868-24024890 ATGGATGTTGGGCTGGGGGACGG + Intergenic
1115706761 14:36007307-36007329 AAGACAGATGAGATGGTGGAGGG + Intergenic
1116984427 14:51204098-51204120 CTGACTGCTGGGCTGGGAGAAGG - Intergenic
1117144822 14:52827029-52827051 ATGGCTCATGGTCTGATGGAGGG + Intergenic
1118365447 14:65091521-65091543 ATGAGTGAAGGGATGGTGGCAGG - Intronic
1119715166 14:76853959-76853981 GAGACTGAGGGGCTGGGGGAAGG - Intronic
1124003157 15:25776320-25776342 CTGACGGATGGGGTGGGGGAGGG + Intronic
1124241289 15:28030215-28030237 GTCACTGAGGGGCTGGTGGCAGG + Intronic
1125244560 15:37620205-37620227 ATGTGTGATGGGCTTGTAGAAGG + Intergenic
1127285660 15:57530951-57530973 ATGACAGATTGGCTGGTGACAGG + Intronic
1127350736 15:58149537-58149559 AGGACTGATGGGCTAATGCATGG + Intronic
1127617987 15:60706318-60706340 ATGGCTGATGTGCTGCTTGAGGG - Intronic
1127884644 15:63189019-63189041 GTGACTGAGGGGCTGCGGGAGGG + Intergenic
1129738199 15:77977230-77977252 ATGACTGATAGGCTTGGGGGTGG + Intergenic
1130254034 15:82317553-82317575 ATGACTGATAGGCTTGGGGGTGG + Intergenic
1131414760 15:92244961-92244983 AGGACTAAGGGGTTGGTGGAAGG - Intergenic
1132653820 16:1033344-1033366 TGGATTGATGGACTGGTGGAAGG - Intergenic
1132653870 16:1033580-1033602 TGGATTGATGGACTGGTGGATGG - Intergenic
1133027614 16:2995524-2995546 ATAACTGAAGGGCTGCTGGGAGG + Intergenic
1133111571 16:3551053-3551075 TGGACTGATGGGTAGGTGGATGG - Intronic
1133266561 16:4588117-4588139 ATGGCTGCTGGGATGGAGGAAGG - Intronic
1134106979 16:11492298-11492320 ATGGATGATGGGTGGGTGGATGG - Intronic
1134224756 16:12381499-12381521 ATGAATGATGGGTGGGTGGGTGG - Intronic
1134224792 16:12381618-12381640 ATGAATGATGGGTGGGTGGGTGG - Intronic
1134224852 16:12381810-12381832 ATGGATGATGGGTGGGTGGATGG - Intronic
1135350592 16:21726124-21726146 TTGATTGATGGACTGGTTGAGGG - Intronic
1135726537 16:24858440-24858462 ATGAGTGAGTGGATGGTGGATGG + Intronic
1135933239 16:26757273-26757295 ATGAATGATGGGCAGATGGATGG + Intergenic
1136607835 16:31348461-31348483 ATGGGTGATGGGAGGGTGGATGG + Intergenic
1137734931 16:50716746-50716768 GTGAGTGATGGGCTGGGGCAGGG + Intronic
1138415105 16:56867124-56867146 ATGACTGATGGGCTGGTGGAGGG + Exonic
1139431805 16:66914767-66914789 ATGAGTGATGGGAGGTTGGATGG + Intronic
1139579246 16:67862502-67862524 TTGACTGAAGTGGTGGTGGAAGG - Intronic
1141096813 16:81168623-81168645 ATGAATGGTGGGGGGGTGGATGG + Intergenic
1141360968 16:83394808-83394830 CTGACTGATTTGCTGATGGATGG + Intronic
1141641872 16:85346324-85346346 ATGGATGATGGGCAGGTAGATGG + Intergenic
1141641892 16:85346396-85346418 ATGGATGATGGGCGGGTGGATGG + Intergenic
1141641897 16:85346415-85346437 ATGGGTGATGGACAGGTGGATGG + Intergenic
1141641992 16:85346833-85346855 ATGGATGATGGGCAGGTGGATGG + Intergenic
1141642263 16:85348223-85348245 ATGGATGATGGACAGGTGGATGG - Intergenic
1142675079 17:1508575-1508597 AAGACAGACGGGCTGGAGGAAGG + Intronic
1143900394 17:10170156-10170178 ATGAATGATGGGGGGATGGAGGG - Intronic
1144728516 17:17513682-17513704 AGAACTGAGGGGCTGGTGCAGGG + Intronic
1147187789 17:38722073-38722095 ATGGCTGAGGGGCTGTTGGGGGG + Exonic
1147322819 17:39656431-39656453 ATGTCTGGTGGGCTGGGGTAGGG + Intronic
1148805446 17:50261534-50261556 GTGACTGATGGGCAGAAGGATGG + Intergenic
1149990229 17:61379071-61379093 TGGACTGAGGGGCTGGGGGAGGG + Intronic
1150730074 17:67684988-67685010 ATGCCTGTTGGGATGGTGGGGGG + Intronic
1152301845 17:79499465-79499487 ATGAATGAATGGATGGTGGATGG - Intronic
1152306021 17:79520546-79520568 ACGGCTGGTGGGCTGGTGGCAGG - Intergenic
1156762893 18:40614676-40614698 ATGTCTGATGGGATGATGGATGG + Intergenic
1157156326 18:45270079-45270101 ATGATGGAGGGGTTGGTGGATGG + Intronic
1157557865 18:48624409-48624431 ATGACTGATTGGGTGTTGGGTGG + Intronic
1157565188 18:48675025-48675047 AACACTGATGGGGTGGTGGGGGG + Intronic
1157575914 18:48742921-48742943 CTGAGTGATAGACTGGTGGAGGG - Intronic
1157630485 18:49090524-49090546 TTTGCTGTTGGGCTGGTGGACGG + Intronic
1158609593 18:58927160-58927182 ATACCTGTTGGGCTGGTGGTGGG + Intronic
1158844641 18:61428849-61428871 ATGGCTGGAGGGCTGGTGGGTGG - Intronic
1160090171 18:75819323-75819345 ATTACTTAAGGGGTGGTGGAAGG + Intergenic
1160579237 18:79874233-79874255 ATGACTGATGGCATAGAGGAAGG - Intronic
1160767849 19:816380-816402 ATGGATGATGGGTGGGTGGATGG - Intronic
1160767938 19:816750-816772 ATGGATGATGGGTGGGTGGATGG - Intronic
1160940376 19:1617999-1618021 AGGATTCCTGGGCTGGTGGAAGG + Intronic
1161088680 19:2346833-2346855 ATGGCTGATGGACACGTGGATGG + Intronic
1161499056 19:4603259-4603281 AGGATTGATGGGTGGGTGGATGG + Intergenic
1161641119 19:5423916-5423938 ATGGATGATTGGGTGGTGGATGG - Intergenic
1163937895 19:20466723-20466745 ATGGGTGTTGGGCTGGGGGATGG - Intergenic
1165022151 19:32934112-32934134 AGGACTCAGGGGCTGGTGGCTGG + Intronic
1165349949 19:35269824-35269846 GTGACTGATGGTCAGCTGGACGG + Exonic
1165427244 19:35752960-35752982 ATGGATGATGGGCTGGCTGAGGG + Exonic
1165790202 19:38486781-38486803 AGGACTGATGGATTGATGGATGG - Intronic
1166201405 19:41239915-41239937 ATGACAGATGAGTGGGTGGATGG + Intronic
1168447230 19:56430466-56430488 CTGATTGATTGGATGGTGGAAGG + Intronic
925260198 2:2522054-2522076 ATGGGGGATGGGCAGGTGGATGG - Intergenic
925545301 2:5009369-5009391 ATGACAGATGGGCAGCTTGAGGG - Intergenic
927364694 2:22280815-22280837 ATGACTACTGGGCTTTTGGAAGG - Intergenic
928010080 2:27599182-27599204 ATGATTTAGGGGCTGGTGTAAGG + Intronic
929445970 2:42001760-42001782 AGGACGGATGGGCGGGTGGGCGG - Intergenic
930063243 2:47308462-47308484 ATGAGTCAGGAGCTGGTGGAGGG - Intergenic
932338551 2:70944588-70944610 AGGTCTGAAGGGCTGGAGGATGG - Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
934884699 2:98014409-98014431 TGGACTGGTGGGCTGGTGGCTGG - Intergenic
935268716 2:101415689-101415711 ATGGCTGCTGAGCTGATGGACGG + Intronic
935373957 2:102376669-102376691 AACACTGATGTGCTGGTGGGAGG + Intronic
936472529 2:112811697-112811719 AAGGCTGATGGGCTGGGGGTTGG + Intergenic
936956990 2:118032428-118032450 ATGAGTGATGGGTGGATGGATGG + Intergenic
937977375 2:127589845-127589867 ATGGGTGGTGGGCGGGTGGATGG + Intronic
939186411 2:138866299-138866321 ATGACTGCTGCGCTGGTCAAAGG - Intergenic
939702938 2:145416804-145416826 ATGACTCATGAGTTGGTGGAGGG - Intergenic
942100719 2:172580513-172580535 ATTACTTCTGTGCTGGTGGATGG + Intronic
942307798 2:174625573-174625595 CTGCCTCATAGGCTGGTGGAGGG + Intronic
944161461 2:196664773-196664795 ATGACTGATTGGCTGGGGGGTGG - Intronic
946171883 2:217900459-217900481 ATACCTGATGGGCTGGAGGTGGG + Exonic
948330116 2:237157896-237157918 GTGAGTGAGGGGCTGGTGAATGG - Intergenic
1169230985 20:3888962-3888984 AGCACTGCTGGGCTGGAGGAGGG + Intronic
1170846390 20:19965499-19965521 AAGACTGATGGGCTGGTTTAAGG - Intronic
1171114977 20:22517646-22517668 ATGGCTAATGAGCAGGTGGAAGG + Intergenic
1171958340 20:31476108-31476130 ATGACAGACAGGCAGGTGGAGGG - Intronic
1172113773 20:32562248-32562270 AAGCCTGATGGGCGGGTGGGGGG - Intronic
1172709036 20:36906071-36906093 ATGACTGCTGAGCTGGGTGATGG + Intronic
1173350480 20:42240727-42240749 ATGGATGATGGGTGGGTGGATGG - Intronic
1174894215 20:54431282-54431304 ATCACTAATGGGATGGTAGAAGG - Intergenic
1175817193 20:61889364-61889386 ATGATGGATGGGTGGGTGGATGG + Intronic
1179230382 21:39498766-39498788 ATGATAGATGGACAGGTGGATGG - Intronic
1179821701 21:43940775-43940797 TTGCCTGATGGGCTGGTTTATGG + Intronic
1181537080 22:23551959-23551981 AGGATTGATGGGAGGGTGGATGG - Intergenic
1181877079 22:25948079-25948101 ATGATCGATGGGTGGGTGGATGG - Intronic
1182047377 22:27285912-27285934 ATGAATGATGGGTATGTGGATGG + Intergenic
1182071997 22:27470278-27470300 ATGAATGATGGATAGGTGGATGG + Intergenic
1182077468 22:27504775-27504797 AATCCTGATGGGGTGGTGGAGGG + Intergenic
1183368696 22:37420254-37420276 ATGGCTGCTGGGCCGGAGGAGGG - Intronic
1184651343 22:45920672-45920694 ATGAGGGATGGGATGGGGGATGG + Exonic
1184744645 22:46449236-46449258 ATGCATGATGGGTTGTTGGATGG - Intronic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
1184900627 22:47444415-47444437 ATGTCTGATGGGCAGGTGGGTGG + Intergenic
1184928318 22:47660076-47660098 AGGACTGCTTTGCTGGTGGACGG + Intergenic
950145461 3:10646753-10646775 ATGATTGATGGGCTTGTTGTTGG - Intronic
950486441 3:13276671-13276693 AAGGCTGATGGGCTGGAGAAAGG + Intergenic
950629545 3:14273240-14273262 AAGGGTGTTGGGCTGGTGGATGG - Intergenic
951932032 3:27978626-27978648 ATGACTCATGTACTGCTGGAGGG - Intergenic
952000285 3:28777370-28777392 GTGACTGGAGGGCTGGTGGAGGG + Intergenic
953375865 3:42428177-42428199 AGGACTGATGGGCAGATGGCAGG - Intergenic
953564494 3:44019819-44019841 AGAAATGATGGGCTGGTGGCTGG - Intergenic
953576828 3:44119518-44119540 GTGACTGATGGACTGCTGGCAGG - Intergenic
953619586 3:44521518-44521540 ATAAATGAGGGGCTGATGGAAGG + Intergenic
953717848 3:45331139-45331161 AGGACAGATGGCCTGGTGGCAGG + Intergenic
954628780 3:52037114-52037136 GAGACTGCTGGGCTGGGGGAAGG + Intergenic
954666242 3:52254232-52254254 AAGATTTATGGGCTGGTGGGAGG - Intergenic
956623862 3:71247836-71247858 AACACTGATTGGCTGATGGATGG + Intronic
957058973 3:75466203-75466225 CTGACTGATCAGCTGGTGGTGGG + Intergenic
960807595 3:121598950-121598972 ATGAAACATAGGCTGGTGGAAGG - Intronic
961026619 3:123564104-123564126 ATGACTGAATGGCTGGTGGCCGG + Intronic
961294473 3:125873528-125873550 CTGACTGATCAGCTGGTGGTGGG - Intergenic
961857862 3:129891181-129891203 ATGACTGAAAGGTGGGTGGAGGG - Intronic
962702444 3:138012553-138012575 AGGACAGTTGGGGTGGTGGAGGG - Intronic
962900176 3:139755066-139755088 ATGACAAATGGGGTGGAGGAGGG + Intergenic
964413467 3:156423395-156423417 GCGATTGATGGGGTGGTGGAGGG + Intronic
964666352 3:159178423-159178445 ATGACTTCTGGGCTGATCGAAGG - Intronic
966916828 3:184588985-184589007 GTGACTGATGGGATGTGGGAGGG + Intronic
967852313 3:194091400-194091422 GTGACTCATGGGATGGTGGAAGG - Intergenic
968375045 4:32753-32775 ATGCGAGATGGGCTGGTGGCAGG + Intergenic
968393029 4:208347-208369 ATGGGTGTTGGGCTGGTGGATGG + Intergenic
968594610 4:1475953-1475975 ATGATGGATGGGTGGGTGGATGG + Intergenic
968594767 4:1476635-1476657 ATGACGGATGGGTGGGTGGATGG + Intergenic
968598652 4:1498580-1498602 ATGAGGGGTGGGCAGGTGGATGG + Intergenic
968647631 4:1748435-1748457 TGGAGTGATGGGCTGGAGGAGGG - Intergenic
968935906 4:3610258-3610280 ATGATGGATGGGTGGGTGGATGG - Intergenic
968936031 4:3611025-3611047 ATGATGGATGGGTGGGTGGATGG - Intergenic
969206506 4:5651245-5651267 ATGATAGATGGGTGGGTGGATGG + Intronic
969523038 4:7689865-7689887 ATGAATGATGGATAGGTGGATGG + Intronic
970788979 4:19833975-19833997 TGGACTGATGGACTGATGGATGG + Intergenic
972156610 4:36170948-36170970 ATGCCTGGTGGCCTGGTGGTAGG + Intronic
973273582 4:48285912-48285934 ATGGGTGTTGGGCTGGGGGACGG + Intergenic
973368189 4:49224739-49224761 ATGACTCTTGGGCTGGAGGATGG - Intergenic
973392858 4:49570686-49570708 ATGACTCTTGGGCTGGAGGATGG + Intergenic
974621136 4:64356273-64356295 ATGGGTGTTGGGCTGGGGGACGG - Intronic
977269973 4:94905759-94905781 ATCACTGCTGGGCTTGTGGTGGG + Intronic
978207581 4:106096674-106096696 ATGACTGACAGGATGGTGGAGGG + Intronic
979501604 4:121446598-121446620 ATGGGTGTTGGGCTGGGGGATGG + Intergenic
979994901 4:127420121-127420143 CTGTCTGATGGGGTGGTAGAGGG - Intergenic
981316610 4:143346473-143346495 AAGACTAAGGTGCTGGTGGAGGG + Intronic
981447236 4:144854273-144854295 CTGACGGATGGGCTGATGAAGGG - Intergenic
981792854 4:148559610-148559632 ATGACAGATGGGTAGGAGGAGGG + Intergenic
982518793 4:156386933-156386955 ACGGGTGATGGGCTGGGGGACGG + Intergenic
985459998 4:190096291-190096313 ATGCGAGATGGGCTGGTGGCAGG - Intergenic
985709177 5:1418723-1418745 ATGATGGATGGGTGGGTGGATGG - Intronic
985726891 5:1521236-1521258 ATGACAGATGGGCTGGCTGGAGG + Intronic
987331418 5:16860745-16860767 ATGAACGATGGGTGGGTGGAGGG + Intronic
988033767 5:25798690-25798712 ATGTTGGATGGGCTGGTGGGTGG - Intergenic
988839348 5:35067854-35067876 ATGATTGAGGGGGTGGTGGTGGG + Intronic
989836526 5:46000588-46000610 ATGGGTGTCGGGCTGGTGGATGG + Intergenic
990356852 5:54976137-54976159 ATGACTGAAGGGATGGTTGGTGG - Intergenic
995740063 5:115346973-115346995 ATGGGTGTCGGGCTGGTGGACGG - Intergenic
999231814 5:150066144-150066166 ATGCCTCTTGGGATGGTGGAAGG - Intronic
1000064976 5:157686506-157686528 ATGGGTGTTGGGCTGGGGGACGG + Intergenic
1000338677 5:160260605-160260627 AAGACTCAGGGGCTGGTGGGGGG + Intronic
1000673992 5:164098031-164098053 TTGAATGAAGGGTTGGTGGATGG + Intergenic
1000855403 5:166391923-166391945 ATGAATGATGGGTAGATGGATGG - Intergenic
1001010475 5:168093246-168093268 GTGAGTGATGGCCTGGGGGAAGG - Intronic
1001217082 5:169866056-169866078 AAGACTGATGGGTTGTTGCAGGG + Intronic
1002436436 5:179234639-179234661 ATGGCTGATGGGTTGGGGTAGGG - Intronic
1002554021 5:180020192-180020214 ATGACTGACGGGCCTGTGGAAGG + Intronic
1002658961 5:180777532-180777554 ATGGATGATTGGGTGGTGGATGG - Intergenic
1004458403 6:15813106-15813128 ATGGATGATGGGCAGGTGGACGG + Intergenic
1004545245 6:16592101-16592123 ATGAGTGACAGGCTGGTGGTGGG - Intronic
1006388162 6:33743618-33743640 ATGACTCAAGGGCTGTAGGATGG + Intronic
1006903355 6:37516897-37516919 GAGAGTGATGGGCTGGGGGATGG + Intergenic
1007459447 6:42007331-42007353 TTGATAGATGGGCGGGTGGATGG + Intronic
1007695942 6:43734329-43734351 ATGGCAGATGGGCTGGGGCAGGG - Intergenic
1009772283 6:68159283-68159305 ATGATGGATAGGCTGGTAGAGGG + Intergenic
1018080574 6:160256254-160256276 AAGGCTGATGGCCAGGTGGATGG + Intronic
1018897862 6:168033578-168033600 GTGAATGCTGAGCTGGTGGATGG + Intronic
1018953165 6:168391925-168391947 ATGACAGGTGTGCTGGGGGATGG - Intergenic
1019422813 7:958891-958913 ATAACCGACGGGCTGGTGGCAGG + Intronic
1019457145 7:1134939-1134961 AAGCCTGATGGGATGGGGGAAGG - Intronic
1019464815 7:1181773-1181795 AGGCCTGATGGGGTGGTGGGAGG - Intergenic
1019567181 7:1690106-1690128 TTGATGGATGGGCGGGTGGATGG + Intronic
1019704642 7:2491678-2491700 AGGACTGATGAGTGGGTGGATGG - Intergenic
1019704753 7:2492171-2492193 AGGACTGATGTGTGGGTGGATGG - Intergenic
1019704785 7:2492330-2492352 AGGACTGATGTGTGGGTGGATGG - Intergenic
1019914730 7:4125373-4125395 ATGGGTGATGGGTGGGTGGATGG + Intronic
1020321835 7:6944541-6944563 CTGACTGATCAGCTGGTGGTGGG + Intergenic
1020761492 7:12272336-12272358 ATGTATGATGGGCTTGTTGAAGG + Intergenic
1021777968 7:24072469-24072491 CTGGCAGATGGGCTGGGGGAAGG + Intergenic
1021975265 7:26006340-26006362 ATGAAGGATGGGCTGATGGATGG + Intergenic
1022553127 7:31261382-31261404 CTAACTGATAGGGTGGTGGAAGG - Intergenic
1024478583 7:49840280-49840302 ATGTCTGGTGGTATGGTGGAGGG + Intronic
1024823363 7:53360515-53360537 TTGAATGATGGGCTGGATGATGG + Intergenic
1025244998 7:57310265-57310287 AGGAAGGATGGGCAGGTGGAAGG - Intergenic
1026457857 7:70588555-70588577 AAAACAGATGAGCTGGTGGAAGG + Intronic
1027866583 7:83655773-83655795 AGTACTTATGGGGTGGTGGAGGG - Intergenic
1028446611 7:90931583-90931605 ATGGCTGATGTGATGGGGGAAGG + Intronic
1028884619 7:95917561-95917583 ATGACTGAAGGGATTGGGGATGG - Intronic
1030009163 7:105149063-105149085 ATGGGTGTTGGGCTGGGGGACGG - Intronic
1031779104 7:125940100-125940122 ATGGGTGTTGGGCTGGGGGACGG - Intergenic
1031871352 7:127092009-127092031 ATGACTAGTGGGATGGTGGGGGG - Intronic
1032285539 7:130536226-130536248 AGGACTGTTGGGCAGGGGGAGGG + Intronic
1034277239 7:149829296-149829318 ATGACTGAGGGGACTGTGGAGGG - Intergenic
1034277505 7:149830168-149830190 ATGACTGAGGGGACTGTGGAGGG - Intergenic
1034277700 7:149830858-149830880 ATGACTGAGGGGACTGTGGAGGG - Intergenic
1034518948 7:151604017-151604039 GTGGCTGATGGACTGGTGGGTGG + Intronic
1036696907 8:10980899-10980921 ATGACTGATGGGCTGCAGGCTGG + Intronic
1038195874 8:25367156-25367178 ATGACTGATGGGAAGATGGTTGG - Intronic
1038609713 8:29049125-29049147 GTGGCTGATGGGGTGGGGGAGGG + Intronic
1038955953 8:32468986-32469008 TTGACTGCTGTGCTAGTGGAAGG - Intronic
1039661816 8:39476441-39476463 ATGCCTGAGGGGTTTGTGGAAGG + Intergenic
1039882322 8:41632683-41632705 ATGCCTTCTGGGCTGGCGGAGGG + Intergenic
1040339173 8:46431556-46431578 ATGGGTGCTGGGCTGGGGGACGG + Intergenic
1041697513 8:60751758-60751780 ATGACTGCAGGAGTGGTGGAGGG + Intronic
1043692605 8:83174381-83174403 CTGAGCGATGGGATGGTGGAGGG - Intergenic
1045148315 8:99372909-99372931 ATCACTGATGGGCATTTGGATGG - Intronic
1045239633 8:100387948-100387970 ATGGCTGATGAGCTGAGGGAGGG + Intronic
1045790529 8:105978329-105978351 ATGAGTGATGGCCTGGTGTCTGG - Intergenic
1047253969 8:123201752-123201774 AACACTGAAGGGCTGGTTGAGGG + Intronic
1048294366 8:133203359-133203381 GTGTGTGATGGGCGGGTGGAGGG + Intronic
1048679458 8:136823713-136823735 ATGTCTGATGGTCTGTAGGAGGG + Intergenic
1048985390 8:139732187-139732209 CTTACAGATGTGCTGGTGGACGG - Exonic
1049008467 8:139872417-139872439 TGGATGGATGGGCTGGTGGATGG + Intronic
1049008502 8:139872549-139872571 CGGATGGATGGGCTGGTGGATGG + Intronic
1049084220 8:140465082-140465104 ATGACTACTGGGCTGGGGGGGGG - Intergenic
1049096548 8:140551648-140551670 ATGGTTGATGGGTGGGTGGATGG + Intronic
1049096554 8:140551667-140551689 ATGGTTGATGGGTGGGTGGATGG + Intronic
1049097890 8:140559562-140559584 ATGACTGTGGGGCTGCTGGACGG + Intronic
1049350864 8:142163919-142163941 ATGACGGATGGATGGGTGGATGG + Intergenic
1049471194 8:142775748-142775770 GGGCCTGATGGGCTGGAGGAGGG - Intronic
1051938419 9:22472869-22472891 ATAACTCATGGGCTTTTGGATGG + Intergenic
1052263602 9:26546352-26546374 ATTACTAAAGGGCTGGTGGCTGG + Intergenic
1053321987 9:37106869-37106891 ATGACTGATGGCCTCATGGGAGG + Intergenic
1054454314 9:65421743-65421765 ATGATGGATGGGTGGGTGGATGG + Intergenic
1056688373 9:88785144-88785166 ATACCTGCAGGGCTGGTGGATGG - Intergenic
1058060584 9:100491655-100491677 ATGACACATGGGATGGTTGAAGG + Intronic
1058785221 9:108380475-108380497 AGGTCTAATGGGCTGGAGGAAGG - Intergenic
1059252177 9:112895613-112895635 ATGAATGATGGGTGGGTGGGTGG - Intergenic
1059252225 9:112895789-112895811 ATGGATGATGGGTGGGTGGATGG - Intergenic
1059252240 9:112895843-112895865 ATGGATGATGGGTGGGTGGATGG - Intergenic
1059627369 9:116081375-116081397 ATGGGTGATGGCCTGGTAGAAGG - Intergenic
1060043271 9:120320031-120320053 ATGACTGAAGGGGTGGGGAAAGG - Intergenic
1060730838 9:126036018-126036040 ATGACTTAGGGGCTGATGGCCGG + Intergenic
1060775058 9:126367049-126367071 ATGCCTGATGGGGTGCTGGCAGG - Intronic
1061398840 9:130357514-130357536 ATGATGGATGGGTGGGTGGATGG + Intronic
1061399583 9:130361047-130361069 ATGACTGAATGGATGGTGAATGG - Intronic
1061994168 9:134175580-134175602 AAGACGGATGGGCTGGGTGAGGG - Intergenic
1062354885 9:136157228-136157250 ATGGATTATGGGCTGGAGGAAGG + Intergenic
1062520842 9:136957255-136957277 ATGGATGATGGGTGGGTGGATGG + Intronic
1062698311 9:137886485-137886507 ATGAATGATGAACAGGTGGAGGG - Intronic
1203574179 Un_KI270744v1:161397-161419 ATGCGAGATGGGCTGGTGGCAGG - Intergenic
1185497488 X:566341-566363 ATGATGGATGGGATGATGGATGG + Intergenic
1185583242 X:1226846-1226868 TAGACAGATGGGTTGGTGGATGG + Intergenic
1185583278 X:1227010-1227032 TAGACAGATGGGTTGGTGGATGG + Intergenic
1185962243 X:4557346-4557368 TTGACTGATGGGCAGGGGGCCGG - Intergenic
1189317084 X:40064017-40064039 ATCACTAATGGGGTGGGGGAGGG + Intronic
1190214335 X:48469786-48469808 AAGACAGATGGGCGGGAGGAGGG + Exonic
1196814144 X:119651731-119651753 ATGGCTGCAGGCCTGGTGGATGG - Intronic
1197496092 X:127183234-127183256 ATTATTGATGGGCTGGTTAATGG + Intergenic
1200752457 Y:6958978-6959000 ATGGGTGTTGGGCTGGGGGACGG + Intronic