ID: 1138415997

View in Genome Browser
Species Human (GRCh38)
Location 16:56871658-56871680
Sequence CTCATTTAGCAGGATGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138415997 Original CRISPR CTCATTTAGCAGGATGACCT GGG (reversed) Intronic
902914640 1:19629432-19629454 CTCATTTAGGTGAATGACTTTGG + Exonic
905497507 1:38404131-38404153 CTCATTCCACAGGATGCCCTCGG - Intergenic
906672080 1:47663596-47663618 ATCATTCAGCAGGCTAACCTGGG + Intergenic
906685578 1:47761183-47761205 TTCACTTTGCTGGATGACCTTGG - Exonic
907737464 1:57128664-57128686 CTCAAATTGCTGGATGACCTTGG - Intronic
911473862 1:98352265-98352287 CTAATTAACCAAGATGACCTTGG - Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
916036847 1:160929804-160929826 CTGATTTAACAGGATGACTTTGG - Intergenic
916406806 1:164506171-164506193 AGTACTTAGCAGGATGACCTAGG - Intergenic
916511543 1:165476198-165476220 ACCATCTAGCTGGATGACCTTGG - Intergenic
916823366 1:168421880-168421902 CTCTTCTAGCTGCATGACCTTGG + Intergenic
916896793 1:169171859-169171881 CTCATCTAGCAGCATGTCCCTGG - Intronic
917884513 1:179370127-179370149 CTCATTTTGAATGATTACCTTGG + Intronic
918752401 1:188289597-188289619 CTCTTGCATCAGGATGACCTGGG - Intergenic
919669815 1:200328511-200328533 CTCATTTTGTGGAATGACCTGGG - Intergenic
920392303 1:205615679-205615701 CACTTTTAGGAGGATGAACTTGG - Exonic
922359555 1:224809093-224809115 CTCACTTAGCACGGTGTCCTGGG + Intergenic
922942828 1:229482842-229482864 CTCAACTAGCAGGCTGCCCTGGG - Intronic
923523720 1:234756639-234756661 TTCATTTAGCAGGAGGGCCCTGG - Intergenic
923663735 1:235980555-235980577 ATCCTTGTGCAGGATGACCTGGG - Exonic
924028265 1:239861022-239861044 GTCACTTAGCAGGAGGAACTAGG + Intronic
1063892785 10:10647399-10647421 TTCATTTATCAGAAAGACCTGGG - Intergenic
1064527346 10:16270993-16271015 CTGATTTAGCAGGACAGCCTCGG - Intergenic
1065259013 10:23905495-23905517 CTCCTTTAGCTTTATGACCTTGG - Intronic
1067384528 10:45806321-45806343 CTCACCTTGCTGGATGACCTGGG - Intergenic
1067879667 10:50032485-50032507 CTCACCTTGCTGGATGACCTGGG + Intergenic
1067892220 10:50146883-50146905 CTCACCTTGCTGGATGACCTGGG - Intergenic
1070388409 10:75947582-75947604 CCCTTTTAGCTGGGTGACCTTGG + Intronic
1071399839 10:85258359-85258381 CTCATTTAGCCCCATGACCATGG - Intergenic
1074265562 10:111899637-111899659 CACATTTAGCAGTGTGACTTTGG + Intergenic
1074362352 10:112833493-112833515 CTGAATTAGCTGGATAACCTTGG + Intergenic
1077605479 11:3608008-3608030 CTTATTTGGCAGTGTGACCTGGG - Intergenic
1078307608 11:10205776-10205798 CACAATAAGCAGGATGGCCTGGG + Intronic
1079880515 11:25921556-25921578 CTCTTGTATCAGTATGACCTAGG - Intergenic
1080255608 11:30287512-30287534 CTCTTTTTCCAGAATGACCTTGG + Intergenic
1081176101 11:39928383-39928405 CTAATTTAACAGGATTACCTAGG + Intergenic
1082931734 11:58615045-58615067 TTCATTTATCAGTATGACCTTGG - Intronic
1083267207 11:61552157-61552179 TTCCTTTAGCTGGAGGACCTGGG - Intronic
1088591143 11:111404375-111404397 CTCCTCTAGCTGGATGACATTGG - Intronic
1088630746 11:111771696-111771718 TTCATTTGGCAAGATGACCCTGG + Intergenic
1090447335 11:126775537-126775559 CTCATTTAGAAAGATGAACTGGG - Intronic
1091012138 11:132011688-132011710 CTCACTTAGCTGTGTGACCTAGG - Intronic
1091624986 12:2115014-2115036 CTGGTTTAGCTGGGTGACCTTGG - Intronic
1095523696 12:43098986-43099008 CTCCTTTAGGATGATGACTTAGG + Intergenic
1097803133 12:63937245-63937267 CTCATTTAGTAGGAAAAACTGGG + Intronic
1101578852 12:106023376-106023398 CCCAGTTAGCAAAATGACCTTGG - Intergenic
1101621736 12:106395481-106395503 CTGATTTAGCACCATCACCTTGG - Intronic
1102220100 12:111188484-111188506 CCCATGTAGCAGGATGGCCAGGG + Intronic
1102868449 12:116393244-116393266 CTCATCTGGCTGTATGACCTTGG + Intergenic
1103328284 12:120136297-120136319 CTCTGTGACCAGGATGACCTTGG - Intronic
1104574194 12:129951686-129951708 CTTTTTTAACAGGCTGACCTAGG - Intergenic
1108198027 13:48014579-48014601 CTCATTTAGAAGGGTGATCATGG - Intergenic
1109327399 13:60884958-60884980 CTCAGTTAGGAGGAAGTCCTGGG - Intergenic
1110453739 13:75666818-75666840 CACATTTCAGAGGATGACCTGGG - Intronic
1110781318 13:79468889-79468911 TTCATTTAGCATAATGTCCTCGG - Intergenic
1110941179 13:81351034-81351056 CTAATTTAGAAGAATCACCTTGG + Intergenic
1111578325 13:90188855-90188877 TTCATTTAGCAGGCTACCCTTGG - Intergenic
1112366797 13:98762154-98762176 CTCATTTATTATGATGACCAAGG + Intergenic
1113218738 13:108073726-108073748 CTCATTTAACAGGATGAAAAGGG + Intergenic
1113379783 13:109792977-109792999 CTCTTTTAGCAAGACAACCTTGG - Intergenic
1113658955 13:112090949-112090971 CTCATGTATCAGAATTACCTAGG + Intergenic
1113725491 13:112596990-112597012 AACATATAGAAGGATGACCTTGG + Intergenic
1113818333 13:113191647-113191669 CGCATTTGGGAGGATGGCCTTGG + Intronic
1116245292 14:42404012-42404034 CTCATTTACCAAGAGGATCTAGG + Intergenic
1118084824 14:62402674-62402696 TTCATTTAGAAGTGTGACCTCGG + Intergenic
1118562477 14:67101540-67101562 CTTATTTAAAAGGAAGACCTTGG - Intronic
1120113154 14:80582048-80582070 GTCATCTAGCAGGTTGGCCTGGG - Intronic
1120524554 14:85562805-85562827 ATCATTTGTCAGAATGACCTGGG + Intronic
1120625181 14:86816792-86816814 CTCATTTTGCAGCATGCTCTGGG - Intergenic
1121525872 14:94618966-94618988 CTCATTTAGCACAAGGAACTAGG + Intronic
1123681285 15:22765949-22765971 CTCATTAAGCAAGAAGACATTGG - Intergenic
1124035820 15:26052881-26052903 CTCCTGCAGCAGGCTGACCTCGG + Intergenic
1124333497 15:28840411-28840433 CTCATTAAGCAAGAAGACATTGG - Intergenic
1125356711 15:38824038-38824060 TTCACTTAGCATAATGACCTTGG + Intergenic
1127717977 15:61669158-61669180 CTCATTTATGAGAAGGACCTAGG - Intergenic
1129825794 15:78634340-78634362 CTCATTAAGCAAGAAGCCCTGGG + Intronic
1131392722 15:92062310-92062332 CTCAAGGAGCAGGCTGACCTGGG + Intronic
1133631913 16:7629824-7629846 CGCAGTTTGCAGGATGAGCTAGG + Intronic
1138415997 16:56871658-56871680 CTCATTTAGCAGGATGACCTGGG - Intronic
1141397440 16:83717493-83717515 GTCCTTCAGCAGGATGGCCTGGG - Intronic
1144514315 17:15905624-15905646 CTCATTTAGGAGGCTGAGGTGGG - Intergenic
1144711003 17:17401444-17401466 CGCCTTTGGCAGGATGCCCTTGG + Intergenic
1146074327 17:29713937-29713959 GTCAGTTACCAGGAGGACCTGGG - Intronic
1147935641 17:44009226-44009248 CTTATTTAGGAGGCTGACATGGG - Intergenic
1150331150 17:64295344-64295366 CACAATTAGCTGTATGACCTTGG + Intergenic
1150566447 17:66345477-66345499 CTCTATTGGCAGGATGACCCGGG - Intronic
1152140046 17:78530837-78530859 CTCAGGTAGAAGGATGAGCTAGG - Intronic
1153175288 18:2365203-2365225 CTCTTTTAGCTGAAAGACCTAGG + Intergenic
1154193764 18:12251579-12251601 CTCCTCTAGCTGGGTGACCTTGG - Intergenic
1156379646 18:36546380-36546402 TTCATTTAAAAGGTTGACCTGGG + Intronic
1156483361 18:37449857-37449879 CTTATTTAGCTGGAGGCCCTTGG + Intronic
1157571189 18:48713409-48713431 CTCACTCAGCAGGAAGACCCTGG + Intronic
1157574941 18:48737235-48737257 CTCATTTTGCAGCAAGAGCTGGG + Intronic
1157775419 18:50391794-50391816 ATCATTTAACTGGATGACCTTGG - Intronic
1160174684 18:76583294-76583316 GTGAGTTAGGAGGATGACCTTGG - Intergenic
1162828846 19:13271514-13271536 ATCAATTAGCAGAATGAGCTGGG - Intronic
1163443938 19:17335659-17335681 CACATTTAGCTGGGCGACCTGGG + Intronic
1166646546 19:44536076-44536098 GTCATTTTGCAAGATGCCCTAGG - Intergenic
926502422 2:13673002-13673024 CTCTTGTATCAGCATGACCTGGG - Intergenic
929866448 2:45721235-45721257 CTTAACTAGCAGGCTGACCTTGG - Intronic
933554445 2:83814479-83814501 CCCATTGAGCAGGCTGCCCTGGG - Intergenic
935900951 2:107792676-107792698 TTCACTTAGCATAATGACCTTGG - Intergenic
937741927 2:125364823-125364845 CTCAATTAGCAGGATGTGATAGG + Intergenic
938886197 2:135651721-135651743 CTTTTTTAGCAGGATAACCTAGG + Exonic
939282973 2:140088907-140088929 CGCATTTGGCAGGATGAGTTTGG + Intergenic
940368792 2:152877698-152877720 CTCAGTTGGGAGGATGAGCTAGG - Intergenic
941609493 2:167643630-167643652 CCCATTTAGCATGATGACTATGG - Intergenic
942096774 2:172542043-172542065 CTCATTTAGAGGGAAGACTTAGG - Intergenic
943343453 2:186709166-186709188 CTCATGTAGCACCATGCCCTGGG - Intronic
945360429 2:208889774-208889796 CTCATATTGCAAGATGACCTGGG + Intergenic
945556919 2:211288284-211288306 CTTCTTCAGCAGGTTGACCTGGG + Intergenic
945576369 2:211534934-211534956 TTCATTTAACAGGCTAACCTTGG + Intronic
945784717 2:214218548-214218570 CTCATTTGGCAGAAGAACCTGGG + Intronic
947103529 2:226646385-226646407 CTCATGCAGCAGGATGCTCTGGG + Intergenic
947251759 2:228114472-228114494 CTCATTCAGTAGGATGAAATGGG - Intronic
1170328726 20:15184476-15184498 CTCAACTAGGAGGATGACATTGG - Intronic
1172818771 20:37713069-37713091 CTCACTCAGCATGATGAACTTGG + Intronic
1174453466 20:50633759-50633781 CACACTGAGCAGGAGGACCTGGG - Intronic
1175579658 20:60088529-60088551 CACCTTCAGCAGGATGGCCTTGG + Intergenic
1175658366 20:60791650-60791672 CTCCTTTAGCAGGTGGAGCTGGG + Intergenic
1177093916 21:16807420-16807442 CTCATTTAGGAGGTTTACCTAGG - Intergenic
1177246180 21:18527299-18527321 CTGATTCAGCAGGATGATTTGGG - Intergenic
1183218713 22:36497990-36498012 CTCCTTCAACAGGATGACATCGG + Exonic
1183479230 22:38053890-38053912 CTCTTTTAGCTGGAGGACCTTGG - Intergenic
949252358 3:2001888-2001910 ATCAATTAGCAGGATGCCCTTGG + Intergenic
949446795 3:4143727-4143749 CTCACTTAGCTTTATGACCTTGG - Intronic
950683143 3:14598958-14598980 CTTCTATAGCAGGATGGCCTAGG - Intergenic
952746242 3:36784133-36784155 CTGATTTAGCTGAATAACCTTGG - Intergenic
952832345 3:37575700-37575722 CCCTTCTACCAGGATGACCTGGG - Intronic
955979677 3:64512282-64512304 CTCATCTACCATGATGGCCTGGG - Intergenic
957852579 3:85828858-85828880 CTCATTTAGTAGGATTTACTGGG - Intronic
961124944 3:124408938-124408960 CTCATCTAGCAGGAACACCTTGG + Intronic
962381441 3:134901478-134901500 CTCAGTTTGCAGGATGTCCAGGG - Intronic
962760156 3:138504411-138504433 CTCATTCATCAGGAGGATCTTGG + Intronic
965172236 3:165280574-165280596 CTCATTTGGCTGGATGTCTTAGG + Intergenic
965859098 3:173125355-173125377 TTCATTTAGAAGGATGACTTGGG - Intronic
965868082 3:173230345-173230367 CTCATTTTGGAGGCTGATCTTGG - Intergenic
966399802 3:179536770-179536792 CTCATTTAACTGGTTGACCAAGG + Intergenic
969134855 4:5021326-5021348 CACCTTTAGCAAGATGACATAGG + Intergenic
971618025 4:28818972-28818994 CCCAGTTAGCAGGAGTACCTGGG - Intergenic
976385431 4:84451924-84451946 CTCTTTTTGCAGGAAGAACTGGG + Intergenic
976552821 4:86415943-86415965 ATCATCTAGCTGGATGATCTTGG + Intronic
981303051 4:143212054-143212076 CTCATTTAGCTGTATGACCCTGG + Intronic
982240144 4:153291944-153291966 CTTATTTAGCTGAATGACCTTGG - Intronic
983601490 4:169534507-169534529 GTCATTTAGCAGGAAGCTCTAGG - Intronic
985608032 5:869188-869210 CTCATTTTCCAGGTTGACTTTGG - Intronic
986392275 5:7297943-7297965 CTCATTAAGCAAGAAGACATTGG - Intergenic
987817213 5:22918009-22918031 ATCGTTTAGAAGCATGACCTAGG - Intergenic
989324465 5:40175000-40175022 CTCATTTACTAGCAAGACCTGGG + Intergenic
992634884 5:78717822-78717844 CTCCTTCAGCAGGCTGACCCAGG - Intronic
993565064 5:89463816-89463838 CCCATTGAGAAGGCTGACCTTGG + Intergenic
993811123 5:92477386-92477408 CTCCTTAAGCAGTGTGACCTTGG - Intergenic
994978848 5:106846306-106846328 CTCCTTTAGGAGGCTGACCCAGG + Intergenic
995814929 5:116157480-116157502 ATCATTTAGCAGGTTACCCTGGG + Intronic
998431486 5:142074440-142074462 CTCTCTTGGCAGGATGACCCTGG - Intergenic
999871277 5:155753850-155753872 CACATTTGGGAGGAGGACCTGGG - Intergenic
1000897104 5:166868573-166868595 CCTCGTTAGCAGGATGACCTTGG + Intergenic
1003161411 6:3637539-3637561 CTTAGTGAGAAGGATGACCTTGG - Intergenic
1004215366 6:13698796-13698818 CGCTTTTAGCAGTATGACTTTGG - Intronic
1004351461 6:14893685-14893707 CTCATTTATATGGAAGACCTAGG - Intergenic
1011501939 6:88000177-88000199 CTCTCTTAGCAGAATGAGCTTGG - Intergenic
1013620884 6:111887683-111887705 CTCACTTAGAAAGAGGACCTAGG + Intergenic
1015935924 6:138405471-138405493 CTGATTTTGCTGGATGAACTGGG + Intronic
1017638386 6:156465978-156466000 CACATATACCAGGATGACATAGG - Intergenic
1026368205 7:69671273-69671295 CTCATTTAGTTGCATAACCTTGG + Intronic
1027795290 7:82685407-82685429 TTCATTAAGCACTATGACCTGGG + Intergenic
1028167042 7:87549405-87549427 CTCATCCAGCAGGAGGATCTTGG + Exonic
1028493983 7:91443869-91443891 CTCACTGAGCAACATGACCTGGG - Intergenic
1029159400 7:98541002-98541024 CCCACTTTGCAGGATGACCCTGG + Intergenic
1029957452 7:104654489-104654511 CTCAAATAGCTGCATGACCTTGG + Intronic
1032307939 7:130754504-130754526 CTCATTTCTCAGCATTACCTTGG + Intergenic
1034123334 7:148647365-148647387 CTCATTTATGAAGATGACCCTGG - Intergenic
1034522345 7:151630567-151630589 CTTATTTAGCTGTGTGACCTTGG - Intronic
1035840820 8:2810454-2810476 CCCATTTGGCAGCATGTCCTGGG - Intergenic
1041079870 8:54206228-54206250 ATCATTTAGCAGGATGACTCTGG + Intergenic
1043743493 8:83843986-83844008 CACATTTATCAGGATCACTTGGG + Intergenic
1044282408 8:90371375-90371397 CACATCTAGCAGCCTGACCTAGG + Intergenic
1044932288 8:97261597-97261619 CTTATTAACAAGGATGACCTGGG + Intergenic
1044995967 8:97838550-97838572 CTCGACTAGCAGGGTGACCTCGG - Intronic
1045528398 8:102961312-102961334 CTCGCTTTGCAGGGTGACCTTGG - Intronic
1047302026 8:123621729-123621751 CACAGTTAGCAGTAGGACCTGGG + Intergenic
1048290682 8:133179102-133179124 GTCTATTAGCTGGATGACCTTGG + Intergenic
1049451338 8:142663738-142663760 CTCATTCAGCAGAATGACTCTGG - Intronic
1051390374 9:16557107-16557129 CTCATTTATCAGGATGGAGTGGG + Intronic
1052617036 9:30854653-30854675 CTCATGAAGCAGGGGGACCTAGG - Intergenic
1056012528 9:82346757-82346779 CTCTTGTATCAGCATGACCTGGG + Intergenic
1058103236 9:100939521-100939543 CTTATGTAGCAGAATGAACTGGG - Intergenic
1059301220 9:113315026-113315048 TCCATTTAGCTGGATGATCTTGG - Exonic
1187251968 X:17606818-17606840 CTCATTTAGTGGGCTGAGCTTGG + Intronic
1188769456 X:34133908-34133930 CTCATTTACAAGGAGGAACTAGG - Intergenic
1189041643 X:37547250-37547272 CTCATTTACAAGGAGGAACTAGG - Intronic
1189869094 X:45363733-45363755 CTCATCTGGCAGGATGATCTGGG - Intergenic
1193206183 X:78750552-78750574 CACCTTTACCAGGATGTCCTAGG - Intronic
1195901665 X:109804235-109804257 CTGATTTAGCAGAATGAGTTGGG - Intergenic
1197887027 X:131229192-131229214 CTCTTATAGTTGGATGACCTTGG + Intergenic
1201344589 Y:12968434-12968456 TTCAGTTAGCAGGGTGACATTGG + Intergenic
1201701141 Y:16883603-16883625 CCCCTTCAGCAGGATGAACTTGG + Intergenic