ID: 1138417381

View in Genome Browser
Species Human (GRCh38)
Location 16:56879249-56879271
Sequence CACCAGACACAGTGGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 289}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138417373_1138417381 -8 Left 1138417373 16:56879234-56879256 CCAGGAGAGCTGACCCACCAGAC 0: 1
1: 0
2: 0
3: 9
4: 159
Right 1138417381 16:56879249-56879271 CACCAGACACAGTGGGGGCTGGG 0: 1
1: 1
2: 1
3: 23
4: 289
1138417368_1138417381 26 Left 1138417368 16:56879200-56879222 CCACTACGGCCTCATCAACTATT 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1138417381 16:56879249-56879271 CACCAGACACAGTGGGGGCTGGG 0: 1
1: 1
2: 1
3: 23
4: 289
1138417372_1138417381 2 Left 1138417372 16:56879224-56879246 CCAGGTACTGCCAGGAGAGCTGA 0: 1
1: 0
2: 1
3: 14
4: 207
Right 1138417381 16:56879249-56879271 CACCAGACACAGTGGGGGCTGGG 0: 1
1: 1
2: 1
3: 23
4: 289
1138417370_1138417381 17 Left 1138417370 16:56879209-56879231 CCTCATCAACTATTACCAGGTAC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1138417381 16:56879249-56879271 CACCAGACACAGTGGGGGCTGGG 0: 1
1: 1
2: 1
3: 23
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138417381 Original CRISPR CACCAGACACAGTGGGGGCT GGG Intronic
900356959 1:2269689-2269711 CACCAGGGACAGTGGGGACGTGG + Intronic
900395540 1:2451799-2451821 GCCCAGACGCAGTGGGGGCAGGG - Intronic
900622510 1:3593779-3593801 CATCAGCAACAGTGGGGGCTGGG + Intronic
900827889 1:4941231-4941253 GACCGGGCACTGTGGGGGCTGGG - Intergenic
901112322 1:6808363-6808385 CACCAGACACTGTGGGACCTTGG - Intronic
901624719 1:10617483-10617505 CCGCAGGTACAGTGGGGGCTGGG - Intronic
902301467 1:15505594-15505616 CACCAGGCCCACTGGGGGCTTGG - Intronic
902361152 1:15943323-15943345 CAGAAGACAAACTGGGGGCTTGG - Intronic
902640427 1:17763133-17763155 CCCCAGACACTGTGGGCTCTGGG + Intronic
902797463 1:18808751-18808773 CCCCAGGCAGAGTCGGGGCTTGG + Intergenic
902931181 1:19732593-19732615 TAACAAAGACAGTGGGGGCTGGG + Intronic
903006453 1:20302092-20302114 CCCCAGACACCGTGGTGGCTTGG + Intronic
903063252 1:20684652-20684674 CTCCAGGCGCAGTGGGGACTAGG - Intronic
903063797 1:20687254-20687276 CAGCAGACACAGTGGAGCCACGG + Intronic
904360739 1:29970129-29970151 CACCACAGACAGGGAGGGCTGGG - Intergenic
904493908 1:30876421-30876443 AGCCAGACAAAGTGGGGGCGAGG - Intronic
904784237 1:32973409-32973431 CAGCAGACACAGCGGGGGATGGG + Intergenic
905925502 1:41746700-41746722 CAGCAGACACTGTTGGAGCTTGG + Intronic
906696483 1:47826960-47826982 CCCCACACACTGTGGGGCCTAGG + Intronic
906891027 1:49715121-49715143 CACCAGAGCCTGTTGGGGCTGGG - Intronic
909340315 1:74524320-74524342 TGCCAGAAACAGAGGGGGCTTGG + Intronic
910195213 1:84633260-84633282 CACCACTCACAGTGGGGTTTTGG - Intronic
911124294 1:94326055-94326077 CACCAAACACTGTGGGGGTGGGG - Intergenic
911707088 1:101026138-101026160 CTCCAGAAACAGGGAGGGCTGGG + Intergenic
914982869 1:152430718-152430740 CAGCAGCCACAGTGGGCTCTGGG + Intergenic
915941882 1:160123471-160123493 CCCCCAACACAGTGGGGGGTGGG + Intronic
916811865 1:168312846-168312868 CACCAGCCGAAGTGGGTGCTTGG - Exonic
917429744 1:174953746-174953768 CAGCAGACACTGTGGGAGATCGG + Intronic
920031506 1:203040159-203040181 AACCAGACCCAGAGAGGGCTGGG + Intronic
923281267 1:232445367-232445389 CCCCAGACACAGTGGTGCCTGGG - Intronic
1062879534 10:966828-966850 CATCAGCCACAGTGGGGGTGAGG - Intergenic
1062950854 10:1502181-1502203 CACCAGCCTCAGTGGGGGCCCGG + Intronic
1063118332 10:3086652-3086674 AACCAAACACAGTGTGCGCTTGG - Intronic
1063161205 10:3420284-3420306 CCCCAGACCCAGTGGTAGCTGGG + Intergenic
1063420997 10:5912478-5912500 AAGCAGAGACCGTGGGGGCTGGG + Intronic
1065139747 10:22708616-22708638 CATCACATACAGTTGGGGCTGGG + Intronic
1067087813 10:43252133-43252155 CCCCAGAAGCAGAGGGGGCTTGG + Intronic
1067549446 10:47223537-47223559 CACCAGGCTCAGTGGGGGCAGGG + Intergenic
1067793076 10:49302170-49302192 CTCCTGACACAGTGGGGAGTAGG - Intronic
1070281251 10:75050630-75050652 ACCCACACACAGTGGGGACTGGG + Intronic
1070782677 10:79146696-79146718 CACCAGACACAGGCAGGGCTGGG + Intronic
1071561919 10:86651804-86651826 CACCAGCCAGAGTTGGGACTGGG + Intergenic
1072760312 10:98051238-98051260 CTCCAGTCACATTGGGGGTTAGG + Intergenic
1073179976 10:101577783-101577805 CAAGAGCCACAGTGGGGGCCTGG - Intronic
1073208426 10:101780712-101780734 CCCCACACACCGTGGGGTCTGGG - Intergenic
1073445057 10:103575559-103575581 CCCCAGACAGAGTGGAGGCAGGG + Intronic
1074780770 10:116800435-116800457 CTCAGGACACAGTGGGGTCTAGG - Intergenic
1074887852 10:117708589-117708611 CATGAGCCCCAGTGGGGGCTGGG - Intergenic
1075306864 10:121375806-121375828 CACCAAACACAGTAGAGCCTGGG - Intergenic
1077899221 11:6476270-6476292 CACCAGATCCAGAGGGGGTTGGG - Exonic
1079362137 11:19777889-19777911 ATCAAGACACAATGGGGGCTCGG - Intronic
1081710858 11:45214410-45214432 CCCCAGCCATAGTGGGAGCTGGG + Intronic
1083764649 11:64836059-64836081 CTCCAGGCACACTGGGGGCAGGG + Intronic
1084360359 11:68665040-68665062 CACCAGACACAGCTGGGGACTGG + Intergenic
1084771984 11:71349307-71349329 CAGCAGACACTGTGGGAGTTGGG + Intergenic
1085346180 11:75769348-75769370 CACCAGCCGCAGTGGGGGCTGGG - Intronic
1086018104 11:82191908-82191930 CACCTGCCACAGTGGGGCCCAGG - Intergenic
1086069162 11:82780498-82780520 CACCGGTCAGAGTGGGGACTAGG - Intergenic
1086108876 11:83176671-83176693 CACCAGGCACAGTCGGGGGGTGG + Intronic
1088083864 11:105954770-105954792 AACCTGATACAGTGGGGGTTAGG + Intronic
1089520582 11:119060121-119060143 CACAAGAGAGAGTGGGGGTTTGG - Intergenic
1090398622 11:126434814-126434836 CACAAGCCACAGCAGGGGCTGGG + Intronic
1090639756 11:128720485-128720507 AACCAGAAACACTGGGGGGTGGG + Intronic
1090828677 11:130405712-130405734 CTCCACGCACAGTGGGTGCTGGG - Exonic
1091033907 11:132216017-132216039 CACCAGGCACAGTGGGCAGTTGG - Intronic
1091757160 12:3061493-3061515 CAGAAGACACAGTGTGTGCTGGG - Intergenic
1096225572 12:49864869-49864891 CTCCAGTCTCACTGGGGGCTGGG + Intergenic
1096239162 12:49950438-49950460 CACAAGACCCTGTGGGGGCTGGG + Intergenic
1105204326 13:18207409-18207431 GACCAGGCAGAGTGGGTGCTGGG + Intergenic
1108503634 13:51090027-51090049 CACCAGGCACAATAAGGGCTGGG + Intergenic
1113881947 13:113631959-113631981 CACCAGACACAAAGCGGGGTGGG - Intronic
1113903359 13:113808193-113808215 CACTTGAGACAGTGGGGGATGGG + Intronic
1113920009 13:113901986-113902008 CACCCAACACACTGGGTGCTGGG - Intergenic
1115311684 14:31984789-31984811 GACTAGGCACAGTGGGGGCAGGG + Intergenic
1117402686 14:55372181-55372203 CCCCAGACAGAGTGGGAGGTGGG - Intronic
1118006369 14:61567776-61567798 AACCAGTCACAGTGGGGCCAGGG + Intronic
1118747074 14:68781915-68781937 TACCATGCACACTGGGGGCTGGG - Intergenic
1118776352 14:68976730-68976752 CACCAAACACAGTCTGGACTTGG + Intronic
1119036038 14:71231251-71231273 CCACAGACCCAGTGGGAGCTGGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119508080 14:75190133-75190155 AAGCAGTGACAGTGGGGGCTAGG - Intergenic
1119514454 14:75237024-75237046 TTCCAGACAAAGTGGGGGCCCGG + Intergenic
1119645653 14:76346538-76346560 CTCAAGACACCATGGGGGCTTGG + Intronic
1120039770 14:79739354-79739376 CACCATGCCCAGTGAGGGCTGGG - Intronic
1121006214 14:90492131-90492153 TCCCAGACACAGTGGTGGGTGGG + Intergenic
1121720524 14:96105600-96105622 CATCAGTCACATTGTGGGCTAGG - Intergenic
1123996418 15:25721007-25721029 CCCCAGGCACAGTGGTGGCGGGG + Intronic
1124349378 15:28943967-28943989 CAGCAGACACAGTAGGGAGTTGG - Intronic
1124563294 15:30794418-30794440 CTCCTCACACAGTGGGGACTGGG + Intergenic
1127774071 15:62252096-62252118 CTCCTCCCACAGTGGGGGCTGGG - Intergenic
1128349488 15:66879648-66879670 CCCTAGACACAGTGAGGGGTGGG + Intergenic
1128551942 15:68603548-68603570 CTCCAAACACACTGGGGGTTAGG - Intronic
1129029362 15:72607382-72607404 CTCCTCTCACAGTGGGGGCTGGG + Intergenic
1129037299 15:72658426-72658448 CTCCTCTCACAGTGGGGGCTGGG + Intronic
1129212588 15:74078799-74078821 CTCCTCTCACAGTGGGGGCTGGG - Intronic
1129397811 15:75262280-75262302 CTCCTCTCACAGTGGGGGCTGGG + Intronic
1129401422 15:75286561-75286583 CTCCTCTCACAGTGGGGGCTGGG + Intronic
1129729725 15:77923120-77923142 CTCCTCTCACAGTGGGGGCTGGG - Intergenic
1131507953 15:93032912-93032934 TTCCAGACACACAGGGGGCTGGG + Intergenic
1135150892 16:20004731-20004753 CACCAGAGCCAGTGGCTGCTGGG + Intergenic
1135744480 16:25004378-25004400 CACCAGATACAGTGAGTGCTTGG - Intronic
1136046845 16:27621990-27622012 CACCAGACACAGGGAGTGATTGG - Intronic
1136402937 16:30028364-30028386 GAACAGACACAGGGGGGCCTGGG + Intronic
1136567048 16:31076825-31076847 CACCAGACAAAGAGAAGGCTTGG + Exonic
1138417381 16:56879249-56879271 CACCAGACACAGTGGGGGCTGGG + Intronic
1140710152 16:77670267-77670289 ATACAGTCACAGTGGGGGCTGGG - Intergenic
1141822582 16:86457209-86457231 CTCCAGACAGAGTATGGGCTTGG + Intergenic
1142220941 16:88854636-88854658 CAGCAGACCCAGTGGGAGGTTGG - Intronic
1143703824 17:8682594-8682616 CACCAGGGACTGTGGGGGGTGGG - Intergenic
1145002521 17:19315196-19315218 CACCAGCCAAAGGAGGGGCTGGG - Intronic
1145030857 17:19504155-19504177 GTCCAAACACAGTGGAGGCTGGG + Intronic
1145174665 17:20688850-20688872 CACCAGTAACAGTGGGAGCAGGG - Intergenic
1145947392 17:28787217-28787239 TAGAAGATACAGTGGGGGCTGGG - Intronic
1146717355 17:35097873-35097895 CACCAGACACAGTGGGAGCTGGG + Intronic
1148070852 17:44907717-44907739 TAGCAGACACAGTTGGGGATGGG - Intronic
1148345727 17:46902605-46902627 AAACAGGCAGAGTGGGGGCTTGG + Intergenic
1148877529 17:50699481-50699503 CTCCAGAGACATTGGTGGCTTGG + Exonic
1150309719 17:64118093-64118115 CACCAGAAAAAGAGGCGGCTGGG + Intronic
1151328584 17:73393699-73393721 CACCAGCCAGAATCGGGGCTGGG + Exonic
1151517136 17:74603904-74603926 CAGCAGACACAGCTGGGCCTGGG + Intergenic
1151788651 17:76289640-76289662 TAAAAGACAAAGTGGGGGCTGGG + Intronic
1152678830 17:81655387-81655409 CTCCAGACACAGAGAGGGCCTGG - Intronic
1153009445 18:524769-524791 CATAAGACCCAGTGAGGGCTGGG + Intergenic
1154307244 18:13239684-13239706 CACCAGTCACAGTGTGGACTGGG + Intronic
1155441247 18:25864907-25864929 CATCAGAAACACTGGGGGCTGGG - Intergenic
1156482787 18:37446550-37446572 AACCCTACACACTGGGGGCTGGG - Intronic
1157606687 18:48930346-48930368 CGCCAGAGGGAGTGGGGGCTTGG - Intronic
1159039618 18:63311511-63311533 CACTTGACACAGTGGGTTCTCGG + Intronic
1160028036 18:75235027-75235049 CACCAGGAACCCTGGGGGCTGGG - Intronic
1160710323 19:548455-548477 CAACGGGCACAGTGGGGGCCGGG + Intronic
1160778208 19:866386-866408 CACCAGAACCACGGGGGGCTGGG + Intergenic
1165286496 19:34846972-34846994 CACGAGAGAGAGTGGGGGCGAGG - Intergenic
1165770133 19:38375111-38375133 GAACAGCCAAAGTGGGGGCTCGG + Intronic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166213721 19:41322875-41322897 CCCCAGAAACAGTGGGGGTGGGG - Exonic
1167390244 19:49190194-49190216 CAGCAGAGACTGTGGGGGGTGGG - Exonic
925063215 2:909727-909749 CACCAGACGCAGTGCAGGCGAGG - Intergenic
925063225 2:909769-909791 CACCAGACCCAGTGCAGGCGAGG - Intergenic
925063234 2:909811-909833 CACCAGACCCAGTGCAGGCGAGG - Intergenic
925063244 2:909853-909875 CACCAGACCCAGTGCAGGCGAGG - Intergenic
925063253 2:909895-909917 CACCAGACCCAGTGCAGGCGAGG - Intergenic
925063281 2:910021-910043 CACCAGACGCAGTGCAGGCGAGG - Intergenic
925063291 2:910063-910085 CACCAGACCCAGTGCAGGCGAGG - Intergenic
925063301 2:910105-910127 CACCAGACCCAGTGCAGGCGAGG - Intergenic
925063320 2:910189-910211 CACCAGACGCAGTGCAGGCGAGG - Intergenic
925063330 2:910231-910253 CACCAGACCCAGTGCAGGCGAGG - Intergenic
925154926 2:1641441-1641463 AAAAAGACACATTGGGGGCTGGG - Intronic
925317651 2:2938120-2938142 CATCAGACACAAAAGGGGCTGGG - Intergenic
926229033 2:10989032-10989054 CAGCAGACACTGTGGTGGCAGGG + Intergenic
926777149 2:16433887-16433909 CCCTAGTCACTGTGGGGGCTAGG + Intergenic
928084529 2:28337466-28337488 TGCCTGACACAGTGTGGGCTCGG + Intronic
928272358 2:29867888-29867910 CTACAGACACAGTTGGGGATGGG + Intronic
929915760 2:46134233-46134255 CATCAGACACTGTGGGAACTTGG + Intronic
929971022 2:46576825-46576847 CAGAAGAGACAGTGGAGGCTGGG + Intronic
935242529 2:101190867-101190889 CAGCTGGCTCAGTGGGGGCTGGG - Intronic
936087012 2:109476254-109476276 CTCCAGACACAGTGGGGTTGTGG + Intronic
937370611 2:121294945-121294967 CACTAGCCAAGGTGGGGGCTAGG + Intergenic
937517694 2:122673979-122674001 CACGAAGCACAGTGGGGACTGGG - Intergenic
938305643 2:130252494-130252516 CACCAGGTGCAGTCGGGGCTTGG - Intergenic
938406717 2:131036919-131036941 CACCAGCCACAGTGGGGAGCTGG - Intronic
938680730 2:133687309-133687331 CACAAGACAGAGTGGAGGATTGG - Intergenic
939858515 2:147390014-147390036 TAACAGACACTGTGGGGGCTGGG - Intergenic
941062934 2:160868692-160868714 AACCAGAGACAGAGTGGGCTTGG + Intergenic
942399005 2:175581328-175581350 CACCAGACACAGATGGAGCCAGG + Intergenic
943623378 2:190174175-190174197 CACCAGACACGGTGGGGGAAGGG - Intronic
944022878 2:195126388-195126410 CCACAGACCCAGTGGGAGCTAGG - Intergenic
944922421 2:204429294-204429316 AATCTGACACAGTGGAGGCTGGG + Intergenic
948219348 2:236257321-236257343 CACCAGAGAGCGTGGGGGCAGGG - Intronic
948231548 2:236352451-236352473 CACCACAGACACTGGGGGATAGG + Intronic
1169249694 20:4050910-4050932 TAAGAGACACAGTGGGGCCTAGG + Intergenic
1170035432 20:11984597-11984619 CAAAAAACACAGTGGAGGCTGGG - Intergenic
1172457987 20:35092707-35092729 CGGCAGCCACAGTGGCGGCTTGG - Exonic
1173521150 20:43701291-43701313 TACCAGACACTGTCGGTGCTGGG + Intronic
1173754160 20:45500207-45500229 AACCACTCCCAGTGGGGGCTTGG - Intergenic
1174174180 20:48634640-48634662 CACCTCTCACAGTGGGGGATGGG + Intronic
1174185353 20:48702493-48702515 CACCTGGCACAAGGGGGGCTGGG - Intronic
1175183131 20:57162393-57162415 CACCAACCCCAGTGTGGGCTGGG + Intergenic
1175703687 20:61159698-61159720 AACCAGAAACAGTGGCGGGTAGG - Intergenic
1175767151 20:61599491-61599513 CTCCAGCCACAGTGGGGTCAGGG - Intronic
1175893149 20:62324110-62324132 CAGCTGACACAGGGGGCGCTGGG + Exonic
1175956722 20:62614443-62614465 CACCAGACCCAGTGAGCCCTGGG + Intergenic
1176021321 20:62963739-62963761 CACCAGGCACTGTGGGTCCTTGG + Intronic
1177853213 21:26373417-26373439 CACCAGGGCCTGTGGGGGCTGGG - Intergenic
1179622499 21:42626512-42626534 ACCCAGACACACTGGGGGCTAGG - Intergenic
1181053039 22:20246647-20246669 CCCCAGGAACAGTGGGGGCCAGG - Intronic
1182519815 22:30878940-30878962 CACCAGATAGAGTGGGCACTGGG + Intronic
1183264048 22:36815041-36815063 CACGAGAGGGAGTGGGGGCTGGG - Intronic
1184730203 22:46367530-46367552 CCCCAGACACAGTGGGGAGGAGG + Intronic
1184780934 22:46649088-46649110 CACCAGACAGAATGGGAGCAAGG - Intronic
1184877394 22:47284239-47284261 CCCCAGACACTGTGGGGACAGGG - Intergenic
1185300132 22:50075214-50075236 CGCCAGACTCAGGGAGGGCTGGG + Intronic
949414173 3:3799028-3799050 AACCAGACACAGTTCGGCCTGGG - Intronic
950037056 3:9893841-9893863 CACAAGGCACAGTGTGGGCAGGG - Exonic
951097025 3:18644385-18644407 CCCCAGAGACAGTGGGGTCCTGG - Intergenic
951738453 3:25893963-25893985 CACAATACACAGTGGGGATTAGG + Intergenic
952796470 3:37243436-37243458 CACCAGGGACAGCGGGGGCCGGG - Exonic
952874427 3:37931448-37931470 GAGAAGACACAGAGGGGGCTGGG - Intronic
952970458 3:38647664-38647686 CACCAGAGACAGCTGGGGATGGG - Intronic
953217746 3:40937087-40937109 CACCAGACACAGTCAAGGGTAGG - Intergenic
953295785 3:41714733-41714755 GAAGAGACACTGTGGGGGCTGGG + Intronic
953439777 3:42907380-42907402 CACCAGCCACAGAGGCAGCTAGG - Intronic
954364526 3:50139019-50139041 CACCCCACAGAGTTGGGGCTGGG - Intergenic
955533466 3:59899112-59899134 CACAAGACAAAGTGGGACCTTGG + Intronic
955899024 3:63732431-63732453 AACCATACACAGTGGTGGCAAGG + Intergenic
957325168 3:78682111-78682133 CACCAGATACAATGTTGGCTAGG - Intronic
957325204 3:78683095-78683117 CACCAGATACAATGTTGGCTAGG + Intronic
960450367 3:117799305-117799327 CACCAGCCCCACTGGTGGCTGGG - Intergenic
961656931 3:128447982-128448004 CACTACACACAGTGTGGGCAGGG + Intergenic
962040302 3:131700348-131700370 CTCCAGGCAAAGTGGGGGATGGG + Intronic
964432967 3:156624686-156624708 CAACCACCACAGTGGGGGCTTGG - Intergenic
966862440 3:184237957-184237979 CACTTGACACAGTAGGAGCTGGG + Intronic
966971975 3:185052495-185052517 GAGCAGACACTGTGGGGGCCAGG + Exonic
967273247 3:187748214-187748236 AACCAGCCAGAGTGGGGGCTGGG + Intergenic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
968417645 4:453971-453993 CTCCAGACAAAGTGGCGGGTGGG - Intronic
968552358 4:1230119-1230141 CACCAGACGCAGTGTGGACGGGG + Intronic
968972423 4:3803052-3803074 CACCACACCCATAGGGGGCTGGG - Intergenic
969392554 4:6901236-6901258 CTCCAGCCACAGAGGGGCCTTGG + Intergenic
969638075 4:8380884-8380906 CCCTAGACAGGGTGGGGGCTGGG + Intronic
969670462 4:8587349-8587371 CAGCAGACACACTGAGGGCCTGG + Exonic
978337628 4:107686802-107686824 CACTAGCCAGAGTTGGGGCTCGG - Intronic
980932883 4:139198394-139198416 CCCCAGACAAGATGGGGGCTTGG - Intergenic
984946897 4:184975850-184975872 CACAAGACACAGAGGATGCTGGG - Intergenic
985570798 5:643731-643753 CACCAGACACCCTGGGGCCAGGG + Intronic
985714318 5:1446785-1446807 CACCAGACACAGAGTCGGCCAGG - Intergenic
986428482 5:7657925-7657947 CATCAGCCTCAGTGGGAGCTGGG - Intronic
987484104 5:18502056-18502078 TAAAAGACACAGTGGGGGCCAGG - Intergenic
988470448 5:31532436-31532458 CACCACCCACACTGGGAGCTTGG - Exonic
990117690 5:52409572-52409594 CACCAGAGAAAGTGGAGGCTGGG - Intergenic
990350211 5:54908577-54908599 GACAATACACAGTGGTGGCTTGG - Intergenic
993386544 5:87268537-87268559 CACCCGACACACTGCGGGATAGG - Exonic
995614396 5:113944615-113944637 CCCCAGTCACAGTGAGGGCAAGG - Intergenic
995749545 5:115439810-115439832 CAGCAGAAACATTGTGGGCTAGG - Intergenic
997200419 5:132006635-132006657 CACCTGACAGATTGGGAGCTTGG - Intronic
997368575 5:133341557-133341579 CACCAGACAGAGAGGGGGAAGGG - Intronic
997726092 5:136120877-136120899 CAGCACACAAAGTGAGGGCTGGG - Intergenic
997833477 5:137173046-137173068 CACCATACACAATGGGAGATTGG - Intronic
999090932 5:148935337-148935359 AAGCAGACACAGTCAGGGCTGGG + Intronic
999578280 5:153005321-153005343 CAACAAACACAGTGGGGGTAGGG + Intergenic
1000412626 5:160949418-160949440 CAGCAGATACTCTGGGGGCTGGG + Intergenic
1001175769 5:169467726-169467748 CACCCATCACACTGGGGGCTTGG + Intergenic
1001470720 5:172010574-172010596 CCCCACACACAAAGGGGGCTGGG + Intergenic
1002083074 5:176748938-176748960 CAACACACCCAGCGGGGGCTGGG + Intergenic
1005259473 6:24042695-24042717 CTGCAGCCACTGTGGGGGCTGGG + Intergenic
1005287698 6:24346463-24346485 CACCATACACAGTCCGGGCGTGG + Intronic
1010221067 6:73449698-73449720 CTCAAGACACAGTCTGGGCTGGG + Intronic
1010514704 6:76759412-76759434 CCCCACCCACAGTGGGGCCTGGG - Intergenic
1011575177 6:88789698-88789720 CACCAAACACAGTTGGGCCAAGG + Intronic
1013592427 6:111630657-111630679 TACCTGACAGAGTGGGGGCTGGG - Intergenic
1016118867 6:140323166-140323188 CACCAAATTCAGTGGAGGCTAGG - Intergenic
1020022333 7:4876665-4876687 CACCAGACACAGTGGGCCCCAGG + Intronic
1020125343 7:5530183-5530205 CGCCAGGCCCGGTGGGGGCTGGG - Intronic
1021270164 7:18575024-18575046 CACCAGCTGCAGTGGGGGCGGGG - Intronic
1022638979 7:32163590-32163612 CTACAGAGTCAGTGGGGGCTTGG - Intronic
1023414952 7:39923156-39923178 CCCCAAACAAAGTGGGGGCAGGG + Intergenic
1024399224 7:48904637-48904659 CACCAGATACTGTGTGTGCTAGG - Intergenic
1024736319 7:52308760-52308782 CACCAGATGCGGTGGGGGGTGGG + Intergenic
1025254522 7:57374561-57374583 CAGCAGGGAGAGTGGGGGCTTGG + Intergenic
1026874125 7:73869954-73869976 CCCCAGGCCCAGTGGGGGATGGG + Intergenic
1029123769 7:98284160-98284182 CACCAGGCAGGGTGGAGGCTGGG + Intronic
1029521641 7:101066563-101066585 CACCAGACACCCTGGGGGTGGGG + Intergenic
1030276698 7:107728696-107728718 CACCATAAACACTGGGGGTTAGG + Intergenic
1030942277 7:115667848-115667870 CCACAGACACATTGGGGGTTGGG + Intergenic
1031704905 7:124968368-124968390 CAACAGACACTGTGGAGGCAGGG + Intergenic
1032246468 7:130217876-130217898 ATCCAGGCACAGTTGGGGCTAGG + Intergenic
1032510026 7:132465191-132465213 CACCAGGCAGTGTGGAGGCTGGG + Intronic
1033233980 7:139623780-139623802 CTCCAGAGTCAGAGGGGGCTGGG - Intronic
1034220928 7:149445682-149445704 CACCAGGCACAGTTGAGGGTGGG - Intronic
1034750271 7:153561868-153561890 CACCCCACACAGTAGGTGCTTGG - Intergenic
1035377629 7:158415920-158415942 CAGCAGACACAGGGGTGGCAGGG - Intronic
1037516633 8:19638269-19638291 CAGCAGACACAGTTGAGGCAGGG - Intronic
1039393439 8:37201961-37201983 CACCAGTCAAAGTGGGGTCATGG - Intergenic
1039566560 8:38556115-38556137 CACGGGACACAGTGTGGGCATGG + Intergenic
1040530112 8:48260277-48260299 CACCACACACAGGGGGCGCTCGG - Intergenic
1041952005 8:63514002-63514024 CTACAGAAAAAGTGGGGGCTTGG + Intergenic
1041966660 8:63686251-63686273 CACCACTCACAGTGGGGCCGTGG - Intergenic
1042810585 8:72821671-72821693 TTCCACACACTGTGGGGGCTTGG - Intronic
1044399123 8:91750000-91750022 CACTAGATACAAAGGGGGCTGGG - Intergenic
1045527185 8:102951025-102951047 AAACAGCCACAGTGGGAGCTGGG + Intronic
1047095990 8:121626481-121626503 CACAAGAGAAAATGGGGGCTGGG - Intronic
1047509775 8:125507304-125507326 CACCAAGCACAGTGTGGCCTTGG + Intergenic
1048150727 8:131891002-131891024 TCCTAGACACAGTTGGGGCTGGG - Intergenic
1048491282 8:134896102-134896124 AACCAGAGACAGTGGCGGATAGG - Intergenic
1049180444 8:141219456-141219478 CACCAAGCACAGTGGGGCCAAGG - Intronic
1049182591 8:141230640-141230662 CCCCAGACACAGCGTGCGCTCGG - Intronic
1049330178 8:142046256-142046278 CAGCAGCCACACTGGGGTCTGGG + Intergenic
1053040137 9:34863171-34863193 CTCTAGACTCACTGGGGGCTTGG + Intergenic
1053575709 9:39356276-39356298 CACCCCACACAGGGGAGGCTGGG - Intronic
1053840229 9:42184233-42184255 CACCCCACACAGGGGAGGCTGGG - Intronic
1054097279 9:60914981-60915003 CACCCCACACAGGGGAGGCTGGG - Intergenic
1054118685 9:61190610-61190632 CACCCCACACAGGGGAGGCTGGG - Intronic
1054589072 9:66991954-66991976 CACCCCACACAGGGGAGGCTGGG + Intergenic
1055608637 9:77997797-77997819 GACGAGACACAGTGGTGCCTAGG - Intronic
1055987078 9:82063066-82063088 CACCCCACACAGAGGAGGCTAGG + Intergenic
1057498986 9:95581898-95581920 CCCCAAACACAGTGGGGGTTAGG - Intergenic
1057522385 9:95770400-95770422 CACCAGACAAACTGGCAGCTTGG - Intergenic
1058578801 9:106432251-106432273 AACCAGACACTGTGTGTGCTAGG - Intergenic
1059406337 9:114100026-114100048 CCCCAGACACACTGTGAGCTGGG - Intergenic
1060267369 9:122120198-122120220 CACCAAGCCCAGTGGGAGCTGGG - Intergenic
1060550113 9:124481048-124481070 CACCAGGCACTGTTGGGGTTTGG - Intergenic
1060912933 9:127365137-127365159 CACAATGCACATTGGGGGCTGGG - Intronic
1061857343 9:133449521-133449543 TCCCAGAGACAGTGGGGGCAGGG - Intronic
1062139457 9:134947828-134947850 CACCAGGCAGTGTGGGGGCAAGG - Intergenic
1062279688 9:135746459-135746481 CCCCAGACACCGTGGGGTCGAGG - Intronic
1062320560 9:135988768-135988790 TACCAAACACTCTGGGGGCTTGG - Intergenic
1062674412 9:137732046-137732068 CACCACCCACAGTACGGGCTGGG + Intronic
1189620879 X:42835911-42835933 CCCTAGACACAGAGGTGGCTGGG + Intergenic
1190766845 X:53482145-53482167 CACCACACACTGTGGGAGCCAGG + Intergenic
1190773428 X:53533819-53533841 TGCTAGACACAGTGGGGGCTGGG - Intronic
1191255430 X:58277605-58277627 CACCTGACCCAGTGGGGTCATGG - Intergenic
1195068578 X:101258787-101258809 CTCCAGCCACTGTGGGGCCTGGG + Intronic
1198574318 X:137993374-137993396 CACCAGAAACAGTCAGGGTTGGG - Intergenic
1199849687 X:151716477-151716499 CAACAGAGACTGTGGTGGCTTGG - Intronic
1200053574 X:153447014-153447036 CACCTCTCACAGTGGTGGCTGGG + Intronic
1200804493 Y:7418945-7418967 AACCACACACAGAGGGAGCTGGG - Intergenic