ID: 1138418044

View in Genome Browser
Species Human (GRCh38)
Location 16:56882514-56882536
Sequence TGGGTGCCTCCTCCTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 213}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138418044_1138418066 22 Left 1138418044 16:56882514-56882536 CCCACCTCAGGAGGAGGCACCCA 0: 1
1: 0
2: 0
3: 45
4: 213
Right 1138418066 16:56882559-56882581 TGGGGTGGGAGTGGGAGGCATGG 0: 1
1: 4
2: 31
3: 331
4: 2686
1138418044_1138418069 29 Left 1138418044 16:56882514-56882536 CCCACCTCAGGAGGAGGCACCCA 0: 1
1: 0
2: 0
3: 45
4: 213
Right 1138418069 16:56882566-56882588 GGAGTGGGAGGCATGGGTGGAGG 0: 1
1: 0
2: 5
3: 106
4: 1139
1138418044_1138418059 3 Left 1138418044 16:56882514-56882536 CCCACCTCAGGAGGAGGCACCCA 0: 1
1: 0
2: 0
3: 45
4: 213
Right 1138418059 16:56882540-56882562 GGCAGGAGGAACTGGGGCATGGG 0: 1
1: 1
2: 7
3: 62
4: 543
1138418044_1138418064 14 Left 1138418044 16:56882514-56882536 CCCACCTCAGGAGGAGGCACCCA 0: 1
1: 0
2: 0
3: 45
4: 213
Right 1138418064 16:56882551-56882573 CTGGGGCATGGGGTGGGAGTGGG 0: 2
1: 1
2: 12
3: 197
4: 1521
1138418044_1138418060 4 Left 1138418044 16:56882514-56882536 CCCACCTCAGGAGGAGGCACCCA 0: 1
1: 0
2: 0
3: 45
4: 213
Right 1138418060 16:56882541-56882563 GCAGGAGGAACTGGGGCATGGGG 0: 1
1: 0
2: 10
3: 50
4: 584
1138418044_1138418063 13 Left 1138418044 16:56882514-56882536 CCCACCTCAGGAGGAGGCACCCA 0: 1
1: 0
2: 0
3: 45
4: 213
Right 1138418063 16:56882550-56882572 ACTGGGGCATGGGGTGGGAGTGG 0: 1
1: 2
2: 14
3: 141
4: 1295
1138418044_1138418061 7 Left 1138418044 16:56882514-56882536 CCCACCTCAGGAGGAGGCACCCA 0: 1
1: 0
2: 0
3: 45
4: 213
Right 1138418061 16:56882544-56882566 GGAGGAACTGGGGCATGGGGTGG 0: 1
1: 1
2: 14
3: 124
4: 1020
1138418044_1138418055 -4 Left 1138418044 16:56882514-56882536 CCCACCTCAGGAGGAGGCACCCA 0: 1
1: 0
2: 0
3: 45
4: 213
Right 1138418055 16:56882533-56882555 CCCAGGGGGCAGGAGGAACTGGG 0: 1
1: 0
2: 2
3: 51
4: 471
1138418044_1138418053 -5 Left 1138418044 16:56882514-56882536 CCCACCTCAGGAGGAGGCACCCA 0: 1
1: 0
2: 0
3: 45
4: 213
Right 1138418053 16:56882532-56882554 ACCCAGGGGGCAGGAGGAACTGG 0: 1
1: 0
2: 3
3: 71
4: 496
1138418044_1138418067 23 Left 1138418044 16:56882514-56882536 CCCACCTCAGGAGGAGGCACCCA 0: 1
1: 0
2: 0
3: 45
4: 213
Right 1138418067 16:56882560-56882582 GGGGTGGGAGTGGGAGGCATGGG 0: 1
1: 2
2: 15
3: 161
4: 1299
1138418044_1138418058 2 Left 1138418044 16:56882514-56882536 CCCACCTCAGGAGGAGGCACCCA 0: 1
1: 0
2: 0
3: 45
4: 213
Right 1138418058 16:56882539-56882561 GGGCAGGAGGAACTGGGGCATGG 0: 1
1: 2
2: 17
3: 128
4: 971
1138418044_1138418068 26 Left 1138418044 16:56882514-56882536 CCCACCTCAGGAGGAGGCACCCA 0: 1
1: 0
2: 0
3: 45
4: 213
Right 1138418068 16:56882563-56882585 GTGGGAGTGGGAGGCATGGGTGG 0: 1
1: 0
2: 5
3: 131
4: 1093
1138418044_1138418062 8 Left 1138418044 16:56882514-56882536 CCCACCTCAGGAGGAGGCACCCA 0: 1
1: 0
2: 0
3: 45
4: 213
Right 1138418062 16:56882545-56882567 GAGGAACTGGGGCATGGGGTGGG 0: 1
1: 0
2: 25
3: 72
4: 647
1138418044_1138418057 -3 Left 1138418044 16:56882514-56882536 CCCACCTCAGGAGGAGGCACCCA 0: 1
1: 0
2: 0
3: 45
4: 213
Right 1138418057 16:56882534-56882556 CCAGGGGGCAGGAGGAACTGGGG 0: 1
1: 0
2: 2
3: 73
4: 724
1138418044_1138418065 17 Left 1138418044 16:56882514-56882536 CCCACCTCAGGAGGAGGCACCCA 0: 1
1: 0
2: 0
3: 45
4: 213
Right 1138418065 16:56882554-56882576 GGGCATGGGGTGGGAGTGGGAGG 0: 1
1: 2
2: 23
3: 314
4: 2268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138418044 Original CRISPR TGGGTGCCTCCTCCTGAGGT GGG (reversed) Intronic
900131870 1:1090683-1090705 CGGGTGCCGCCTCCTGGGGGTGG - Intronic
900363677 1:2301785-2301807 TTGCTGCCTCCTCTTGAGGTTGG + Intronic
902734919 1:18394180-18394202 TTGGTGCCTTATCCTGAGGCTGG - Intergenic
904273820 1:29367482-29367504 TGGGTCCATCCTCCTGAGGGTGG - Intergenic
904364145 1:29999803-29999825 TGGGTCCATCCTCCTGAGGGTGG - Intergenic
904396262 1:30224506-30224528 TGGGGGCCTCCTTCTGAGCTGGG + Intergenic
904490868 1:30858279-30858301 TGGGTGTCTCTTGCTGAGGGAGG - Intergenic
904771507 1:32883886-32883908 TGGGTGCCTCAGTCTGAGGTGGG + Intergenic
905764966 1:40592752-40592774 TGGGTGGGTCTTCCTGAGGGTGG - Intergenic
906124169 1:43416468-43416490 TGGGTGCCTCCCTGTGAGTTTGG + Intronic
907328395 1:53655822-53655844 GTGGTGCCTCAACCTGAGGTTGG - Intronic
908836977 1:68238105-68238127 TGGGTTCCTCCACCAGAGGTGGG + Intergenic
910617440 1:89215233-89215255 TGGCTGCTTCCTGCTGAGGAGGG - Intergenic
915546629 1:156602600-156602622 TGGGTCCCAGCTACTGAGGTGGG + Intergenic
917210558 1:172627740-172627762 TGATTGCCTACTCCTGGGGTGGG - Intergenic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
918048084 1:180953385-180953407 TGTGTGCCTCCCCCTGGGCTGGG - Intergenic
920952221 1:210583205-210583227 TAGATTCCTCCTCCTGAGTTGGG + Intronic
923178992 1:231497984-231498006 TGGATGCATCCTCCTAATGTTGG + Intergenic
924370877 1:243348514-243348536 TGGGTCCCTCCACCTAGGGTGGG - Intronic
1063519037 10:6724303-6724325 TGTGTGCTTTCTCATGAGGTGGG - Intergenic
1064213498 10:13380762-13380784 TGGGGGCCTCATCCTGTGTTAGG - Intergenic
1069575373 10:69523596-69523618 TGGGTGCCTCGTCCAGAGCTGGG - Intergenic
1072620437 10:97075748-97075770 TGGGTCCCACCTCCTGAGTCAGG + Intronic
1073001726 10:100290692-100290714 GAGGTGACTCCTCCAGAGGTTGG - Intronic
1073570953 10:104580833-104580855 TGGATGCCTCTTCCTGGGGGTGG + Intergenic
1074274641 10:111989650-111989672 AGGTTGCCTCCTCCTGAGTCAGG - Intergenic
1075625376 10:123960443-123960465 TGGGTTCCTCTTCCTCAGGTGGG - Intergenic
1077192222 11:1260278-1260300 TGGGTGCGGCCTCCTGGGGAGGG - Intronic
1077606558 11:3616436-3616458 TGGGGGCCCCTTCCTCAGGTGGG - Intergenic
1078236791 11:9492338-9492360 TGGGTGGATCCACCTGAGGACGG - Intronic
1078858315 11:15224692-15224714 TCTATGCCTCCTCCTGAGGTGGG + Intronic
1079329551 11:19522297-19522319 TGGGCTCCTCCTCCAGTGGTGGG - Intronic
1082113655 11:48305010-48305032 TGTGTGCTTCCTCTTGATGTTGG + Intergenic
1082774367 11:57234422-57234444 TGGGGGCGTCCTACTGAGCTGGG - Exonic
1087430027 11:98041694-98041716 TGGGTGGGTCTTCCTGAGGGTGG + Intergenic
1089598358 11:119597315-119597337 TGGTTGCCTCTGCCTGGGGTGGG + Intergenic
1090654025 11:128828848-128828870 TCGGTGGCTCCTCCTCAGGGAGG + Intergenic
1092074247 12:5659944-5659966 TGGGTTGCTCCTAATGAGGTGGG + Intronic
1096509516 12:52119946-52119968 TGAGTGCCGCCTCCCGAGCTAGG - Intergenic
1096922861 12:55107683-55107705 TGGGTGGGTCTTCCTGAGGGTGG - Intergenic
1099004695 12:77222231-77222253 TGAGTGCCTACTCGTGAGCTTGG - Intergenic
1099437563 12:82661888-82661910 TGGAAACTTCCTCCTGAGGTGGG + Intergenic
1101172092 12:102108172-102108194 TGGGTGTGTCTTCCTGAGGGTGG - Intronic
1102923973 12:116812843-116812865 TGGTTTCCTCCTCCTAAGATAGG - Intronic
1102992709 12:117326683-117326705 TGGATGCAGCCTCCTGAGCTGGG + Intronic
1104040514 12:125127203-125127225 TTGGTTCCTCGGCCTGAGGTGGG + Intronic
1104369158 12:128207742-128207764 TGGGCACCTCCTGCTGAGGCAGG - Intergenic
1108454548 13:50599678-50599700 TGGGCTCATCCTCCTGAGGCTGG + Intronic
1109426121 13:62167989-62168011 TGGGTGGCTCCAGCTGTGGTGGG - Intergenic
1109950096 13:69490106-69490128 TGGGGGTCTCTTCCTGAGGAAGG - Intergenic
1112391401 13:98988178-98988200 AGGGTGCCTCCTTCAGAGCTGGG + Intronic
1112393176 13:99003598-99003620 AGGGTGCCACCTGCTGAGGTGGG - Intronic
1113066610 13:106379148-106379170 TGCCTGCCTACTCCTGAGTTGGG + Intergenic
1113957853 13:114108683-114108705 TGGGTCCCTGCTCCTGAGTTAGG - Intronic
1114193746 14:20459949-20459971 TGGGTGTGTTATCCTGAGGTCGG - Intronic
1114528828 14:23382550-23382572 TGGCTTGCTCCTCCTGTGGTGGG + Exonic
1115342162 14:32304469-32304491 GGGGAGCCTCCTCCTCAGGGTGG - Intergenic
1116266141 14:42692857-42692879 TCGGTGACTCTTCCTGAGGATGG + Intergenic
1119126233 14:72129852-72129874 GTGGTGCCTCATCATGAGGTGGG - Intronic
1121334067 14:93066243-93066265 TTGGTGTGTCCTCCTGAGGCTGG - Intronic
1121926601 14:97932730-97932752 TGGGTGGGTCTTCCTGAGGGTGG + Intronic
1122061665 14:99140229-99140251 TGGGGGTCACCTCCTAAGGTGGG + Intergenic
1122328393 14:100896625-100896647 GGGGTGCCTCCTCTGGATGTGGG + Intergenic
1202839060 14_GL000009v2_random:103487-103509 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1202908427 14_GL000194v1_random:93578-93600 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1202884817 14_KI270722v1_random:95746-95768 TTGTTGCCTTCTCCTGAGTTTGG + Intergenic
1123906791 15:24929553-24929575 TGGGTGTCCCCTCATGAGGGTGG + Intronic
1124468785 15:29964754-29964776 TGGTTACCTCTACCTGAGGTAGG - Intronic
1126336515 15:47591149-47591171 TTGCTGCATCCTCATGAGGTGGG + Intronic
1128768436 15:70265112-70265134 TGGCTGACTCCTCCAAAGGTTGG - Intergenic
1128836443 15:70812715-70812737 TGGGAGCCTCTTCCTGGGATTGG + Intergenic
1132741244 16:1414447-1414469 CGGCGGCCTCCGCCTGAGGTCGG - Intronic
1132914491 16:2335642-2335664 AGGGTGCCTCCTCCTCAGTCAGG - Intronic
1133015296 16:2936924-2936946 TGGGGTCCGCCTCCTGAGGCTGG - Intronic
1133077282 16:3289539-3289561 TGGGCGCCTCCCCCAGAGGGTGG + Exonic
1134798341 16:17061900-17061922 TGGGTCCCTCAACCTGAAGTTGG - Intergenic
1135959161 16:26981424-26981446 CTCGTGCCTCCTGCTGAGGTGGG + Intergenic
1137052106 16:35723122-35723144 GGGGTGCCTCCTCATGAGAGAGG + Intergenic
1137812125 16:51362774-51362796 GGGGTGGCTCCTTCTGAGTTCGG - Intergenic
1138418044 16:56882514-56882536 TGGGTGCCTCCTCCTGAGGTGGG - Intronic
1139589075 16:67923260-67923282 AGGGTACCTGCTCCTGATGTTGG - Intronic
1141328870 16:83089573-83089595 TTGGTGCCTGCTCTGGAGGTGGG + Intronic
1141825842 16:86479837-86479859 AGGGAGCCTCATGCTGAGGTGGG + Intergenic
1143164855 17:4892661-4892683 AGGGTCGCTCCTCCTGAGGTCGG - Exonic
1143510149 17:7390820-7390842 TGGCTGCCTCCTCCTCAGCTGGG - Intronic
1144665191 17:17097753-17097775 TGGGTGCCTCCTGCTGCTGTTGG - Intronic
1145018348 17:19412991-19413013 TGGGGGCCTCATCCTTAGGATGG + Exonic
1146747504 17:35345556-35345578 TCTTTGGCTCCTCCTGAGGTGGG + Intergenic
1150273379 17:63881001-63881023 TGGATGCCTTCTCCCCAGGTGGG - Intronic
1151845206 17:76648911-76648933 TGTCTGCCTCCTCCTCTGGTTGG - Intergenic
1151964874 17:77426031-77426053 TGGAGGCCTCCTCCTGAGGCTGG - Intronic
1155307847 18:24496545-24496567 TGGATCCCACCTCCTGAAGTTGG + Intergenic
1157314498 18:46576427-46576449 GGGGTGGCTCATCCAGAGGTTGG - Intronic
1158963911 18:62607430-62607452 GGGCTGGCTCCTCCTGAGGGCGG + Intergenic
1160043403 18:75365692-75365714 TGGGGCCCTCCCCCGGAGGTGGG - Intergenic
1161006031 19:1937277-1937299 TGTGCTCCTCCTCCTGGGGTTGG + Intergenic
1161368154 19:3893115-3893137 TGGCTTCGTCCTGCTGAGGTGGG - Intronic
1161453104 19:4357568-4357590 GTGATGCCTCCTCCCGAGGTAGG + Exonic
1161777796 19:6273238-6273260 TGGTTGCCTCCTCATGGGCTGGG - Intronic
1162304178 19:9861503-9861525 TGGGTGGCTCCAGGTGAGGTGGG - Intronic
1163293702 19:16398220-16398242 TGGGTGCATTCTCCTGAAGTGGG - Intronic
1163392131 19:17037218-17037240 TGGGTGCATAGTCCTCAGGTGGG - Intergenic
1164442874 19:28292728-28292750 TAGGTGTTTCCTCCTGAGCTAGG - Intergenic
1164596207 19:29531916-29531938 TGGAAGCCTCCTGCTGAGGCTGG - Intronic
1165095134 19:33406054-33406076 GGGGTGCCTCGTCCAGAGGTGGG + Intronic
1165105462 19:33467217-33467239 TAGGAGCCTCCTCTTGAGGGAGG + Intronic
1166685342 19:44793248-44793270 TGTGTGCCCCCTCCTGACCTCGG + Intronic
1166750028 19:45160172-45160194 TGGGGGCCTGCTCCTGAGGCAGG + Intronic
1166941986 19:46372894-46372916 TGGGCTCCTGCTCCTGAGGAAGG - Intronic
1167309615 19:48729365-48729387 CGGGTGCCTCCTGCTGCGGGAGG - Exonic
1168682338 19:58325120-58325142 TCCATGCCTCCTCCTGACGTGGG + Intergenic
1202633976 1_KI270706v1_random:27069-27091 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
1202651904 1_KI270707v1_random:12944-12966 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1202660227 1_KI270708v1_random:62774-62796 TTGTTGCCTTCTCCTGAGTTTGG + Intergenic
925929992 2:8699195-8699217 TGGGTGATTCATCCTGAGTTTGG + Intergenic
926204213 2:10823742-10823764 TGAGTGTCCCCTCCTGAAGTGGG - Intronic
930497665 2:52168937-52168959 TGGGTGGCTCCTTCTGAAATTGG + Intergenic
931239203 2:60437609-60437631 TGGGTGCCTCTCTCTGAGGGAGG - Intergenic
933793687 2:85903674-85903696 TTGGTGTCCCCTCCTGAGGTTGG + Intergenic
934756582 2:96828500-96828522 TGGGAGCCTCCTCCCCTGGTGGG - Intronic
935115796 2:100135276-100135298 TAGGTTCCACCTCCTGAGGGAGG - Intronic
937041816 2:118827706-118827728 TGGGAGCCTCCTCTTGAGAAAGG + Intergenic
938381631 2:130839434-130839456 TGGGGTCCTCCTCCTGGGCTTGG - Intronic
938841452 2:135168818-135168840 GTGCTGCCTCCTCCTGAGGGAGG + Exonic
940207763 2:151223091-151223113 TGGGTGGGTCTTCCTGAGGGTGG - Intergenic
941592121 2:167432797-167432819 TGGGTACCTCCTGCTCAGTTTGG - Intergenic
941996961 2:171610363-171610385 TGTGTGCCTCCTCCTCAGAGAGG + Intergenic
947594110 2:231400029-231400051 TAGGTGACTCCCGCTGAGGTAGG - Exonic
947845768 2:233242440-233242462 TGGGTGGCTTCTCCTGATTTGGG + Intronic
948456851 2:238108536-238108558 TGTGTGCATTCTCCTGAGATGGG - Intronic
948602193 2:239113728-239113750 TGGGGGCCTCTTCCTGTGGTCGG - Intronic
1169717689 20:8639020-8639042 TGGGTGCCACTGCCTGGGGTGGG + Intronic
1172426038 20:34856757-34856779 TGGGAGGCTTCTCCTGAGGGGGG + Intronic
1174684137 20:52437456-52437478 TGGGTCCCTCAACGTGAGGTAGG - Intergenic
1175128507 20:56770841-56770863 CAGGTGCCTCCTCCTAAGTTAGG + Intergenic
1175471540 20:59233361-59233383 TGGGTCCCTCCTGGTGTGGTGGG + Intronic
1176627786 21:9108241-9108263 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1176646189 21:9352850-9352872 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
1177332794 21:19683757-19683779 TGGGTGCCTCCTCCTTCCTTTGG + Intergenic
1178493233 21:33067587-33067609 TGGGTGCCCCTTCCTGTGGGTGG + Intergenic
1179442336 21:41404007-41404029 CGGGTGCCTGCTCATGGGGTGGG + Intronic
1179884890 21:44309672-44309694 TGGTGGCCTCCTGCTCAGGTGGG + Intronic
1180327710 22:11446365-11446387 TTGTTGCCTTCTCCTGAGTTTGG + Intergenic
1180366726 22:11946147-11946169 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1180379356 22:12125059-12125081 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
1180418127 22:12787828-12787850 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1180675200 22:17581743-17581765 TGGGTGGCTCCTCCCCAGCTCGG + Intronic
1181955832 22:26587285-26587307 TGTGTGCCAGCTCCTGGGGTGGG + Intronic
1184515447 22:44959190-44959212 TGCGAGCCTCGTCCTGAGATGGG - Intronic
1184682535 22:46079925-46079947 TGGCTGCCTCCTGCTGAGCCTGG + Intronic
1184857596 22:47154913-47154935 AGGGTGCCTCCTCTAGAAGTGGG + Intronic
1185328929 22:50242967-50242989 TGGCTGCATTGTCCTGAGGTGGG - Intronic
1185357338 22:50381486-50381508 GGGATGCCTCATGCTGAGGTGGG - Intronic
950214235 3:11146923-11146945 TGGGTGGCCCCTCCTCAGATAGG + Intronic
951161028 3:19422705-19422727 TAGGTGCCTCATCCTGAGCTAGG + Intronic
951528978 3:23681377-23681399 TGGGTGGGTCTTCCTGAGGGTGG - Intergenic
952582065 3:34846137-34846159 AGGGGACCTCCTCCTGAGGTTGG + Intergenic
952851425 3:37732819-37732841 TGGGGGCCTGCTGCTGAGGAAGG - Intronic
953916511 3:46924078-46924100 TGGGAGCATACACCTGAGGTGGG - Intronic
954456436 3:50602240-50602262 TGGGCTCCTCCACCAGAGGTGGG - Intergenic
954807998 3:53231416-53231438 AGGGTGCGTCCTCCTGTGGAGGG + Exonic
955821619 3:62901956-62901978 TGGGTGGGTCTTCCTGAGGATGG - Intergenic
957093997 3:75760516-75760538 TTGTTGCCTCCTCCTGAGTTTGG - Intronic
960898052 3:122526940-122526962 TGCATCCCTCCTCCTGAGGGTGG - Intergenic
960989720 3:123302531-123302553 TAGGTGGGTTCTCCTGAGGTGGG + Intronic
961214442 3:125148581-125148603 AGAGTGCCGCCTCCTGAGGCTGG - Intronic
964386242 3:156151063-156151085 AAGGTGCCTGCACCTGAGGTGGG - Intronic
965674958 3:171184852-171184874 TGGGTGTCTCCTCCAGCGTTTGG - Intronic
967407915 3:189138030-189138052 TGTGTCCCTCCTCTTGAGGCAGG - Intronic
968118551 3:196108358-196108380 AGGGGGCCTCCTACTGAGGAGGG - Intergenic
1202740695 3_GL000221v1_random:52206-52228 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
969088458 4:4674033-4674055 CGGGTGGATCCACCTGAGGTCGG - Intergenic
969524670 4:7698087-7698109 GCGGTGCCCCCTCCTGGGGTGGG - Intronic
972624971 4:40788134-40788156 AGGTTGCCTCTTCCTGAGATGGG + Intronic
972898480 4:43653936-43653958 TGTGGGCCTCACCCTGAGGTAGG - Intergenic
973363662 4:49189461-49189483 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
973397418 4:49607280-49607302 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
973603087 4:52561160-52561182 GGAGTGCTTCCTCCTGGGGTGGG - Intergenic
975585923 4:75949151-75949173 TGGGTGTCTCCTCCTGTGTCTGG - Intronic
975621940 4:76305334-76305356 TGGTTGCCACTTCCTGAGATGGG + Intronic
976754679 4:88485267-88485289 TGGTGGCCTCCTGCTGAGGTGGG - Intronic
978657184 4:111078226-111078248 TTGGTGCCTCTTCCTGATTTGGG - Intergenic
981705573 4:147655767-147655789 TGGTATCCTCCTGCTGAGGTAGG - Intronic
982062648 4:151620280-151620302 AGGGTGCCTCTTCCTGTGGGTGG - Intronic
984906906 4:184636840-184636862 TGGGTGCCTCCTAAGGAGGTAGG + Intronic
985207067 4:187550160-187550182 TGGCTGCTTCCTGCTGAGGAGGG + Intergenic
1202760976 4_GL000008v2_random:110542-110564 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
986747422 5:10757134-10757156 CAGGTGCCTCCTCCCAAGGTGGG - Intronic
989205097 5:38802269-38802291 AGGGGGGCTCCTCATGAGGTAGG + Intergenic
991450217 5:66743468-66743490 TGCGTGCCTCCCACAGAGGTGGG + Intronic
995140271 5:108728034-108728056 TGGGAGCCTCCTTCTGACGGCGG - Intergenic
998039694 5:138944474-138944496 TGGGTCCCTGCTCCTGGGCTGGG - Intergenic
1002375310 5:178784648-178784670 TTGGTTCCTCAGCCTGAGGTGGG - Intergenic
1002589632 5:180281175-180281197 TGGGACCCACCTCCTGAGGCAGG - Intronic
1003981239 6:11392216-11392238 TGTGTTCCTCCTCTTTAGGTTGG + Intergenic
1005687272 6:28267026-28267048 TGGGTGCTGCCTGCTGAGGACGG - Exonic
1006024350 6:31137980-31138002 GGTCTGGCTCCTCCTGAGGTCGG + Exonic
1006448088 6:34091047-34091069 TGGGGGCCTCCACCTGGGCTGGG - Intronic
1007308373 6:40924966-40924988 ACGCTGGCTCCTCCTGAGGTTGG - Intergenic
1007397186 6:41584710-41584732 GTGGTGCCTCCTCCTGGGTTGGG + Intronic
1010185495 6:73139086-73139108 TGCCTGCCTCCTCCTCAGGCTGG + Intronic
1016224266 6:141715522-141715544 TGGGTGAGTCTTCCTGAGGGTGG + Intergenic
1017124378 6:151051876-151051898 TGGCTGCGCCCTCCTGAGGGAGG + Intronic
1018028839 6:159826311-159826333 GGGGTGCCTCCTGCTCATGTGGG + Intergenic
1018649967 6:165985519-165985541 CCTGTGCCTCCTCCTGAAGTTGG - Intronic
1019407012 7:889194-889216 TGGCTGCCTCCCACTGGGGTAGG + Intronic
1020577107 7:9947247-9947269 TGGGTTCCTCCAGCTAAGGTGGG - Intergenic
1021653733 7:22854657-22854679 TCGGCGCCTCCGCCTGCGGTTGG - Intergenic
1023626686 7:42121750-42121772 TGGGTGCCTACTGCTTAGGTGGG - Intronic
1026210944 7:68304616-68304638 TGGAAGCATCCTCCTGTGGTAGG + Intergenic
1026764588 7:73152493-73152515 GTGGTGCCTTCTCCTGAGGCAGG - Intergenic
1027041058 7:74962261-74962283 GTGGTGCCTTCTCCTGAGGCAGG - Intergenic
1027082579 7:75240112-75240134 GTGGTGCCTTCTCCTGAGGCAGG + Intergenic
1027692738 7:81368920-81368942 TGGGTGGGTCTTCCTGAGGATGG - Intergenic
1032208171 7:129887669-129887691 TGGCTCACACCTCCTGAGGTCGG + Intronic
1032538575 7:132684921-132684943 TGTGTGCCTTCTCCTGGGGAAGG + Intronic
1033428456 7:141266525-141266547 TTTGTTACTCCTCCTGAGGTAGG - Intronic
1034684563 7:152958885-152958907 TGGGTGGCCCCTCCCCAGGTCGG - Intergenic
1035010691 7:155713154-155713176 TGGTTGCCATCACCTGAGGTGGG + Intronic
1036105181 8:5830457-5830479 GGGGTGCCTCCTCATGAGAGAGG + Intergenic
1036586782 8:10131760-10131782 TCGCTGCCTCTTCCTGAGCTGGG + Intronic
1037168731 8:15863722-15863744 TTGGTACCTGCTCCTCAGGTTGG - Intergenic
1037908007 8:22726821-22726843 TGGGGGCATCCTCCTGGGGCAGG + Intronic
1040485516 8:47867807-47867829 TGCATGCTTCCTCCTGAGATTGG - Intronic
1040550953 8:48437220-48437242 TGGGGGCCTTCTCCTGGGCTTGG + Intergenic
1042211958 8:66389871-66389893 TGCCTGCCTCCAACTGAGGTTGG - Intergenic
1045322629 8:101093438-101093460 TGGGTTCCTCCTCCAGGGGGTGG - Intergenic
1047186601 8:122638934-122638956 TGGGTGCTCCCCTCTGAGGTTGG + Intergenic
1047375787 8:124294833-124294855 TGGGTGGGTCTTCCTGAGGGTGG - Intergenic
1049038965 8:140098293-140098315 TGGGTGTCTTCCCCTGTGGTAGG - Intronic
1052785324 9:32822875-32822897 TGGGTGGGTCTTCCTGAGGGTGG - Intergenic
1055484766 9:76746315-76746337 TGCCTGCCTTCTCCCGAGGTTGG - Intronic
1056056729 9:82832569-82832591 TGGGTCCCTCCTTATGGGGTGGG - Intergenic
1057447169 9:95124725-95124747 AGGGTGCCTCCTGCTGACCTGGG + Intronic
1058698906 9:107584919-107584941 TGGGTGCTTTCTCATGTGGTAGG + Intergenic
1058876328 9:109248194-109248216 TCGGTGCCTCCCCCTGCCGTGGG - Intronic
1059428927 9:114238435-114238457 TGGGGGGCTCCAACTGAGGTTGG - Intronic
1062047029 9:134429090-134429112 TGTGTGCCTCCTCCCCAGGCTGG + Exonic
1203750632 Un_GL000218v1:75920-75942 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1203483360 Un_GL000224v1:28428-28450 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
1203709337 Un_KI270742v1:82143-82165 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1203541746 Un_KI270743v1:95426-95448 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
1185751059 X:2609638-2609660 TGGGCGCCTCCTCCGGACCTGGG - Intergenic
1185990448 X:4889404-4889426 TGGGTGGGTCTTCCTGAGGGTGG - Intergenic
1187460948 X:19486183-19486205 TGGGTGACTCCTTCTGATCTGGG - Intronic
1188442134 X:30223180-30223202 TGTGTGGCTCCTACTGATGTGGG - Intergenic
1189574261 X:42334312-42334334 TGGGTGCCTTCTTCCAAGGTTGG - Intergenic
1190071825 X:47285954-47285976 TGGCTACTTCCTGCTGAGGTGGG + Intergenic
1190934882 X:54989809-54989831 TGGAGGCCTCCTGCTGTGGTAGG + Intronic
1192149576 X:68703807-68703829 TGGGTGCCCTCCCCTGAGCTTGG + Intronic
1192344367 X:70289250-70289272 TGGATTCCTCCTCATGAGGTGGG - Exonic
1195656409 X:107335561-107335583 TGGGTGACTCCTCTTTTGGTTGG - Intergenic
1197598363 X:128495186-128495208 TGGGTGGATCTTCCTGAGGGTGG - Intergenic
1199537014 X:148914151-148914173 TGGGGGACTCCTGCTGAGATAGG - Intronic
1200089684 X:153628655-153628677 TGGGTGACTGGTCCAGAGGTGGG + Intergenic
1200153762 X:153964426-153964448 TTGCTGCCTTCTTCTGAGGTGGG + Intronic
1201164289 Y:11193597-11193619 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1201686014 Y:16703121-16703143 TGGGTGGCCCTTCCTGAGGGTGG + Intergenic