ID: 1138418426

View in Genome Browser
Species Human (GRCh38)
Location 16:56884501-56884523
Sequence CAGCCTGCTGGCCCCTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 261}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138418426_1138418435 11 Left 1138418426 16:56884501-56884523 CCCCAAGAGGGGCCAGCAGGCTG 0: 1
1: 0
2: 4
3: 31
4: 261
Right 1138418435 16:56884535-56884557 TAGGCCTCAGAGGTGGCTGAGGG 0: 1
1: 0
2: 2
3: 24
4: 197
1138418426_1138418437 15 Left 1138418426 16:56884501-56884523 CCCCAAGAGGGGCCAGCAGGCTG 0: 1
1: 0
2: 4
3: 31
4: 261
Right 1138418437 16:56884539-56884561 CCTCAGAGGTGGCTGAGGGCTGG 0: 1
1: 1
2: 7
3: 51
4: 441
1138418426_1138418434 10 Left 1138418426 16:56884501-56884523 CCCCAAGAGGGGCCAGCAGGCTG 0: 1
1: 0
2: 4
3: 31
4: 261
Right 1138418434 16:56884534-56884556 CTAGGCCTCAGAGGTGGCTGAGG 0: 1
1: 0
2: 2
3: 41
4: 306
1138418426_1138418439 27 Left 1138418426 16:56884501-56884523 CCCCAAGAGGGGCCAGCAGGCTG 0: 1
1: 0
2: 4
3: 31
4: 261
Right 1138418439 16:56884551-56884573 CTGAGGGCTGGTTGTGTGGATGG 0: 1
1: 0
2: 3
3: 33
4: 396
1138418426_1138418431 1 Left 1138418426 16:56884501-56884523 CCCCAAGAGGGGCCAGCAGGCTG 0: 1
1: 0
2: 4
3: 31
4: 261
Right 1138418431 16:56884525-56884547 TGTGCACACCTAGGCCTCAGAGG 0: 1
1: 0
2: 4
3: 10
4: 180
1138418426_1138418438 23 Left 1138418426 16:56884501-56884523 CCCCAAGAGGGGCCAGCAGGCTG 0: 1
1: 0
2: 4
3: 31
4: 261
Right 1138418438 16:56884547-56884569 GTGGCTGAGGGCTGGTTGTGTGG 0: 1
1: 0
2: 0
3: 41
4: 419
1138418426_1138418430 -8 Left 1138418426 16:56884501-56884523 CCCCAAGAGGGGCCAGCAGGCTG 0: 1
1: 0
2: 4
3: 31
4: 261
Right 1138418430 16:56884516-56884538 GCAGGCTGCTGTGCACACCTAGG 0: 1
1: 0
2: 2
3: 19
4: 278
1138418426_1138418432 4 Left 1138418426 16:56884501-56884523 CCCCAAGAGGGGCCAGCAGGCTG 0: 1
1: 0
2: 4
3: 31
4: 261
Right 1138418432 16:56884528-56884550 GCACACCTAGGCCTCAGAGGTGG 0: 1
1: 0
2: 1
3: 17
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138418426 Original CRISPR CAGCCTGCTGGCCCCTCTTG GGG (reversed) Intronic
902377995 1:16039212-16039234 CTGCCTGCTGGCTTCTCTTGAGG + Intergenic
902383084 1:16061708-16061730 CTGCCTGCTGGCTTCTCTTGAGG + Intronic
902384667 1:16069521-16069543 CAGCCTCCTGGCCCCACCTTGGG - Intronic
902804812 1:18854434-18854456 CAGCCTGTGGGCCCCACTCGCGG + Exonic
903217553 1:21851770-21851792 CAGCCTGGTGGCCCCACTCACGG + Exonic
903405115 1:23089359-23089381 GAGACTGCTGGCCCCTCCTCAGG - Intronic
903648430 1:24908821-24908843 AAGCCTGCAGTCCCCTCCTGGGG - Intronic
904253451 1:29240060-29240082 CAGCCTGCTGTCTCCTCTCTGGG + Intronic
904611780 1:31729760-31729782 CTGCCTGCCGGCCACTGTTGAGG - Intronic
905237841 1:36562333-36562355 GAGCCTGCTTGCCCCGCCTGGGG + Intergenic
906195886 1:43930642-43930664 CTGCCTGATGGGCCCTCTAGTGG - Exonic
906243551 1:44257462-44257484 CAGGGTGCTGGTCCATCTTGTGG + Intronic
906477598 1:46180466-46180488 CCGCCTGCTGGCCCCACCCGTGG - Intronic
911457676 1:98147495-98147517 CAGCCTGCTGGCCTGCTTTGTGG + Intergenic
913538267 1:119795045-119795067 CAGGCTGCTGGCCTGTCCTGCGG + Intronic
914446959 1:147758472-147758494 CAGCTTTCTGGCCCCTCTGTGGG - Exonic
915271432 1:154756446-154756468 CAGCCTCCTGCCCCCTTCTGCGG + Intronic
915333922 1:155129716-155129738 CAGCATGCTGCCCCCGCCTGAGG - Intronic
915589479 1:156862462-156862484 TACCCTGCTGGACCCACTTGGGG - Intronic
916368490 1:164061510-164061532 CAGTCTACTGGTCTCTCTTGGGG + Intergenic
916489503 1:165289017-165289039 CAGACTTCTGGCCCCTGCTGGGG + Intronic
917444117 1:175092295-175092317 CAGCCTGCTGGAGCCTCCAGAGG + Intronic
917972545 1:180218180-180218202 CAGCCAGCTGGGCCCTCCTCTGG - Intergenic
919207588 1:194437312-194437334 CTGTCTGCTGGCCTCTCTTGGGG + Intergenic
919708082 1:200698074-200698096 CTGGCAGCTGGACCCTCTTGTGG + Intergenic
919790719 1:201289092-201289114 CAGCCTCCTGCCCCCTCTGCTGG - Intronic
919863309 1:201758008-201758030 CAGTATGGTGGCCCCACTTGTGG + Intronic
920201367 1:204261706-204261728 CAGCCTACTTGCCCCACCTGGGG + Intronic
924424773 1:243941075-243941097 CTGCCTGCTGGTTCCTCGTGTGG - Intergenic
1064122623 10:12633056-12633078 CAGCCTGCTGGGGCCTCACGGGG - Intronic
1065877867 10:30012724-30012746 CAGCCTGCTGCCCGCCCTTCAGG + Intergenic
1067581238 10:47447404-47447426 CAGCCAGCAGCCCACTCTTGGGG - Intergenic
1067914808 10:50385944-50385966 CTGCTTGCTAGACCCTCTTGTGG + Intronic
1070312577 10:75284352-75284374 CCGCCTGCTGCTCCCTCTTCTGG - Intergenic
1071341925 10:84657500-84657522 CTACCTGTTGGCCCCTTTTGTGG + Intergenic
1072304026 10:94089230-94089252 CAGCCTGCTTCCCTCTCCTGGGG - Intronic
1072691221 10:97573318-97573340 CAGCCTGCTGGCCACCCTTGGGG + Intronic
1073863154 10:107770531-107770553 CAGTCTGCTGGCCTCTCCTGGGG + Intergenic
1075083795 10:119400805-119400827 AAGGCTGCTGGCCCAGCTTGGGG - Intronic
1075795175 10:125115091-125115113 CCTCCTGCTGCCTCCTCTTGAGG + Intronic
1076484485 10:130807332-130807354 CAGGCTGCTGCCACCTTTTGGGG + Intergenic
1076589721 10:131574742-131574764 CAGCCTGCGGGCCCCTGTGATGG + Intergenic
1077240179 11:1506701-1506723 CATGCTGCTGTCCCCTCTTGGGG - Intergenic
1077269349 11:1667765-1667787 AGGCCTGCTGGCCCCTGTGGTGG + Intergenic
1078084941 11:8228320-8228342 CAGCCTCCTTGCCTCACTTGGGG - Intronic
1079127191 11:17725497-17725519 CAGCCAGTTGTCCCCCCTTGAGG - Intergenic
1082812141 11:57484777-57484799 CTGCCTCCTGGTACCTCTTGGGG - Exonic
1083698882 11:64461148-64461170 CAGCTTCCTGGCCCCTCCAGAGG - Intergenic
1084440743 11:69171518-69171540 CAGCCTGTTGGCTCATCCTGTGG - Intergenic
1084604893 11:70166669-70166691 ATGCCTGCTGGGCCCTCCTGTGG + Intronic
1084943257 11:72625567-72625589 CAGCCTGGTGTCCCCTCCTCAGG - Intronic
1086015889 11:82167090-82167112 CTGCTTGCTGGACCCTTTTGTGG + Intergenic
1088727866 11:112655531-112655553 CAGACTGCTGACCCCTAGTGAGG - Intergenic
1088820060 11:113449070-113449092 TTACCTGCTGGCCCCTCCTGTGG + Intronic
1088820940 11:113457041-113457063 CAGCCTGGTGGCTCCTATGGTGG - Intronic
1089086135 11:115818464-115818486 CAGCTTGCTGGCTTCTCCTGTGG - Intergenic
1089659616 11:119977569-119977591 CAGCCTGCTGGCCACACCTCTGG - Intergenic
1089679208 11:120110055-120110077 CAGCCTCCTGGCCCTTCTTGAGG - Intergenic
1094783386 12:33818511-33818533 CTGTCTGCTGGCCCCTCCTGGGG - Intergenic
1097282426 12:57853011-57853033 CCGCCTGCTGGCCCCTTTGGGGG + Intergenic
1097394942 12:59061832-59061854 CAGCCTGCTTGCCACCCTGGAGG + Intergenic
1098018237 12:66129020-66129042 AAGCCTGCTGGCCTCCTTTGGGG + Exonic
1098559109 12:71852176-71852198 CAGGCTGCTGGGCCCTTTTGAGG - Intronic
1102371648 12:112386821-112386843 AAGCCTGCTGCTCCCTCTTGGGG - Intergenic
1103590901 12:121991538-121991560 CAGACTGCTGGTCCCACCTGGGG - Intronic
1104093710 12:125537404-125537426 CCACCTGCTGGCACCTCTTCTGG + Intronic
1104859022 12:131915225-131915247 CAGCCTGCAGGCGCACCTTGAGG - Exonic
1104966352 12:132510256-132510278 CACCCTGCCGGCCTCTCCTGGGG + Intronic
1106104023 13:26718292-26718314 CCTCCTCCTGGACCCTCTTGGGG - Intergenic
1107672360 13:42759220-42759242 CAGCCTGCTGGCCTGCCCTGTGG - Intergenic
1107815490 13:44240828-44240850 CAGGCTGCTGGTACCCCTTGTGG - Intergenic
1111178821 13:84635654-84635676 CTGTCTGCTGGCCTCTCTTGGGG + Intergenic
1113271959 13:108684196-108684218 CAGCCTGCACACCCCTCCTGTGG - Intronic
1113774370 13:112934394-112934416 CACCCTGCTGGCCCCTTCTCTGG - Intronic
1113921560 13:113916007-113916029 CAGCATCCTGGCCTCTCATGGGG + Intergenic
1118467079 14:66040753-66040775 CAGCCTGCTTGTCTCTCTTAAGG + Intergenic
1118986644 14:70761260-70761282 CATCCTCCTGGCCTCTCCTGTGG + Intronic
1119649696 14:76374939-76374961 CAGGCGGCTGGCCCCTCCTGGGG + Intronic
1121830362 14:97046230-97046252 CAGCCTGCTGGCCTGCCCTGTGG + Intergenic
1122144940 14:99683694-99683716 CAGCCCGCGGGCCCCGCTGGCGG + Intergenic
1122695678 14:103550998-103551020 CAGCCTGGAGGGCCCTCCTGGGG + Intergenic
1123042477 14:105496062-105496084 CAGCCTGCTCTCCCCTTTTAGGG + Intronic
1123216537 14:106813606-106813628 CAGCCTTCAGGCCCTTCCTGGGG - Intergenic
1125560038 15:40623300-40623322 CAGCCAGCTAACCCCTCTGGAGG + Exonic
1125755948 15:42065189-42065211 CAGCCTGTGGGCCCTTCCTGGGG - Intergenic
1127048184 15:55050116-55050138 CAGCCAGCTGGCCACAGTTGAGG + Intergenic
1127098245 15:55535234-55535256 TGGTCTGCTGGCCCCTCCTGGGG + Intergenic
1128105191 15:65039100-65039122 CAGCCTGCTGTCTCCCCATGCGG - Intergenic
1128147478 15:65340040-65340062 CAGCCTGGTCGCACCTCTGGTGG - Intronic
1129389706 15:75214457-75214479 CAGCCTGCTGCCCCAGCTGGTGG + Intergenic
1130527491 15:84719828-84719850 GAGCCTGCTGGCCCCCCTGAAGG + Intergenic
1131364229 15:91824237-91824259 CAGCCTTCTGGGGCCTCTGGTGG - Intergenic
1131863144 15:96676081-96676103 CAGCCTCATGGCTCTTCTTGTGG - Intergenic
1132472983 16:117179-117201 CAGCGGGCTGGCCCCTCCTGGGG - Intronic
1132957498 16:2603304-2603326 CAGCCGGCTGGTCCCACTTCCGG - Intergenic
1134062601 16:11208159-11208181 AATCCTGGAGGCCCCTCTTGGGG + Intergenic
1136479740 16:30534065-30534087 CAGCCTCCTGGCCGCAGTTGAGG + Intronic
1136872867 16:33824473-33824495 CAGCCTTCAGGCCCTTCCTGGGG + Intergenic
1137676381 16:50305703-50305725 CTGCCTGCTGCCACCTCCTGAGG + Intronic
1138418426 16:56884501-56884523 CAGCCTGCTGGCCCCTCTTGGGG - Intronic
1139106753 16:63835555-63835577 CTGTCTGCTGGCCTCTCCTGGGG + Intergenic
1140557943 16:75943139-75943161 CAGGCTGCTAGCCTGTCTTGTGG + Intergenic
1141421188 16:83917648-83917670 CAACCTGCCCGCCCTTCTTGCGG + Exonic
1141826263 16:86482497-86482519 CAGCCTGCTGGCCTGCCCTGTGG + Intergenic
1142023857 16:87801842-87801864 CACCCTGCAGGCTCCTCCTGTGG - Intergenic
1142182560 16:88678362-88678384 CAGACTCCTGGCTCCTCTGGGGG + Exonic
1142382081 16:89738642-89738664 CAGCCTGCTGTCTGCTCTGGAGG + Exonic
1203099304 16_KI270728v1_random:1291581-1291603 CAGCCTTCAGGCCCTTCCTGGGG - Intergenic
1142888494 17:2928259-2928281 CAGCCTGCTGGCTCTCCATGCGG + Intronic
1143725186 17:8839662-8839684 CAGCCTGCACGCTCCTCTGGAGG + Exonic
1144624665 17:16838641-16838663 CAGCATCCTGGGCCCACTTGGGG + Intergenic
1144881765 17:18434080-18434102 CAGCATCCTGGGCCCACTTGGGG - Intergenic
1145150468 17:20510306-20510328 CAGCATCCTGGGCCCACTTGGGG + Intergenic
1146162398 17:30566960-30566982 CAGCATCCTGGGCCCACTTGGGG + Intergenic
1146233091 17:31131019-31131041 CAGTCTGCTGGTCTCTCATGGGG - Intronic
1147425674 17:40344937-40344959 CTGCCTCCAGCCCCCTCTTGGGG + Intronic
1147626767 17:41905462-41905484 CAGCCTGCTGGGCTGTCCTGGGG + Intronic
1149439643 17:56663717-56663739 CAGCCTGCTGCCTCCTCAGGTGG + Intergenic
1150811994 17:68363940-68363962 CAGCCCACTGGCCTCTCTGGTGG - Intronic
1151508732 17:74545550-74545572 CCGCCTGCTGTCCCCTGGTGAGG + Intronic
1151564891 17:74892576-74892598 CAGCCACCTGGCCACTCATGGGG - Exonic
1151903730 17:77034542-77034564 CCCCCAGCTGGCCCCTCTTCCGG + Intergenic
1152240809 17:79160029-79160051 CTGCCTGTTGGCCCTTCCTGGGG - Intronic
1152865848 17:82722491-82722513 CAGCCTGCGGGCACCTCTCAGGG - Intronic
1158863189 18:61613094-61613116 CAGCCATCTGGCCCTTCTTCAGG + Intergenic
1159908357 18:74119128-74119150 CTGCAGGCTGGCCCTTCTTGTGG - Intronic
1160458999 18:79023271-79023293 CAGGCTGCTGGCTCCTCTGCAGG - Intergenic
1160776593 19:859445-859467 CAGCCTGCTGGCCCTGGTGGGGG - Intergenic
1160810350 19:1010490-1010512 CAGCCCGCTGGGCCCTGCTGGGG - Exonic
1161059840 19:2209449-2209471 CTGCTGGCTGCCCCCTCTTGAGG + Intronic
1161794870 19:6380840-6380862 CAGCCTCCTGACCTCTGTTGGGG - Intronic
1162014911 19:7840155-7840177 GACCCTTCTGGCCCCTCATGCGG - Intronic
1163193518 19:15697165-15697187 CAGCCTGCAGGGGGCTCTTGGGG + Exonic
1163265389 19:16217632-16217654 CAGTCTGCTGGCCTCTCCTGGGG - Intronic
1164433366 19:28207601-28207623 CAGCATGTGTGCCCCTCTTGGGG - Intergenic
1164492370 19:28727200-28727222 CAGGCTGCTCGCCCGACTTGGGG + Intergenic
1164981663 19:32619139-32619161 CAGCCTGCTTGCCCATGCTGAGG - Intronic
1165427540 19:35754332-35754354 CAGCCTGCTTGCCCCTCGTAGGG + Intronic
1167280959 19:48568316-48568338 CATCCTGCTGGCCTCCTTTGCGG - Intronic
1167465177 19:49646787-49646809 CAGCCTGCTGCCCCGTCTCAGGG + Exonic
1167813083 19:51852250-51852272 CAGCGTGCTGGCCATTCTTTTGG + Intergenic
1168406914 19:56115245-56115267 CAGCCTGCACGTCCCTCTGGCGG + Intronic
925254122 2:2467830-2467852 CAGCCCACAGGCCCCTCTGGTGG + Intergenic
926006371 2:9376228-9376250 CTGCCTGCTGGGCCCTCTGGCGG - Intronic
926699446 2:15793473-15793495 CAGCCTGCTGGCACTGCTAGAGG - Intergenic
926884947 2:17588437-17588459 CAGCCTGCTTCCCCCTCATATGG + Intronic
927208930 2:20627012-20627034 CAGCCTCCTGGGCCTGCTTGGGG - Intronic
927480672 2:23451551-23451573 CAGCCTCATGGCCCCACTTGAGG + Intronic
931621978 2:64219767-64219789 CAGCAAGCTGCCCCCTCTTTTGG + Intergenic
931776955 2:65549093-65549115 CCACCTGCTGGCCCTTCTTAAGG - Intergenic
932308238 2:70719109-70719131 GATCCTGCTGGCCCCTCAAGAGG + Intronic
932708940 2:74047939-74047961 CAGCCTGCTGCCCCCTACTCAGG + Exonic
932887872 2:75563277-75563299 TAGCCTGAGAGCCCCTCTTGGGG + Intronic
932918545 2:75883463-75883485 CAACCTTTTGGCCTCTCTTGGGG - Intergenic
934612457 2:95751391-95751413 CTGCCTGCAGCCTCCTCTTGGGG + Intergenic
934841695 2:97628053-97628075 CTGCCTGCAGCCTCCTCTTGGGG - Intergenic
936014824 2:108950077-108950099 CAGCCAGCAGGCCCCTCCTGGGG - Intronic
936026968 2:109039214-109039236 CAGCCTGCTGGTCTTTCTTGTGG + Intergenic
936125864 2:109788768-109788790 CAACCTGATGGCCCCTGTGGGGG - Intergenic
936218829 2:110582700-110582722 CAACCTGATGGCCCCTGTGGGGG + Intergenic
937315615 2:120930464-120930486 CTGCATGCTGGCCTTTCTTGTGG + Intronic
938262761 2:129907050-129907072 CAGCCTGCGGGCCCCTCCTGCGG - Intergenic
938384190 2:130852920-130852942 CAGCCGGCTGCCCCATCTGGAGG + Intronic
941846795 2:170141695-170141717 CAGCCTGCTGGGGCCGCCTGAGG - Intergenic
942126242 2:172828452-172828474 GAGCCTCCTGGCCTTTCTTGAGG + Intronic
943092402 2:183390383-183390405 CAGCCTGTTGGCCTCTCCTAGGG - Intergenic
943743999 2:191441977-191441999 CAGACTGCTGGCACCGCCTGAGG + Intergenic
943906197 2:193502941-193502963 CAGCATGCTGGCAGCCCTTGCGG - Intergenic
946007000 2:216533782-216533804 CAGCCTCCTGCCCCTGCTTGGGG + Intronic
947632423 2:231662681-231662703 CAGCCGGCAGACCCTTCTTGAGG - Intergenic
947735045 2:232449962-232449984 CAGCCTCCTGGCCCCTGAGGAGG + Intergenic
948007775 2:234624448-234624470 CAGTCTTCTGGCTCCTCTAGAGG - Intergenic
1169201096 20:3710584-3710606 CAGCCTGCTGGGCACACTGGGGG + Intergenic
1170354593 20:15478344-15478366 CACCCTCCTGTCCCCTCTAGGGG + Intronic
1171298500 20:24039483-24039505 TTGCCTGCTGGCCCCTGGTGAGG + Intergenic
1172011773 20:31849855-31849877 CAGCCTGCTGGCTGCACGTGTGG - Intronic
1172614672 20:36275323-36275345 CTCCCTGCTGGCCCCTGGTGGGG - Intergenic
1172864620 20:38086308-38086330 GAGCCTGCTTGCCTCTCTTCAGG + Intronic
1173225517 20:41160258-41160280 CACCCTCCTGGCCCCACTTAAGG - Intronic
1173734010 20:45347176-45347198 CTGCCTGCAGGCTCTTCTTGAGG - Intronic
1173790507 20:45824819-45824841 CAGCCTGCTGGTCCGTCTGCAGG + Exonic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1174530951 20:51213614-51213636 CAGCCTGCCTGCTTCTCTTGGGG - Intergenic
1179722431 21:43323341-43323363 CAGCCCGCTGGCCCTGTTTGCGG + Intergenic
1179893385 21:44349063-44349085 CACCGTGCTGGCCACTCTGGAGG + Intergenic
1180185815 21:46138712-46138734 CAGCCTGCTCAGCCCTGTTGGGG - Intronic
1181006853 22:20017533-20017555 CACCCTGCAGGCCCCCCATGGGG + Intronic
1181052137 22:20242982-20243004 CAGCCTGCAGGCCCTGCTGGGGG + Exonic
1181182688 22:21078745-21078767 CAGCCTGCTGTCCTCCCTTGGGG + Intergenic
1182485058 22:30634582-30634604 CAGCCCGCTGCGCCCTCTGGTGG - Intergenic
1183385912 22:37514526-37514548 CAGGCTGCTGGTCCTGCTTGAGG - Intronic
1183391412 22:37547273-37547295 AAGCCTGCTTGCCACCCTTGTGG - Intergenic
1183586794 22:38757483-38757505 CAGCCTGCTTCCCCCTCTCCGGG + Intronic
1183742759 22:39677865-39677887 CAGTCTGCAGGCCCCTCCTAGGG + Intronic
1184001436 22:41677039-41677061 AAGCCTGCTGGCCTCCTTTGGGG + Intronic
1184656193 22:45943407-45943429 GAGCCTGCTGTCCCCACCTGGGG - Intronic
1184781957 22:46654117-46654139 CAGCCTCCTGGCCCCTCTTTCGG - Intronic
1184900241 22:47442203-47442225 GAGCCTCCTGGCCCCTTATGGGG + Intergenic
1184924865 22:47629926-47629948 CCGCCTTCTGGCCACTGTTGGGG - Intergenic
1185058859 22:48595153-48595175 CAGCCTGCATGCCCCAATTGGGG + Intronic
1185201147 22:49506239-49506261 CAGCATGGTGGCCCCCCTTTGGG - Intronic
1185275859 22:49950005-49950027 CAGCATGCTGGACCCGCCTGGGG - Intergenic
953278386 3:41527227-41527249 CAAGCTGCTGAACCCTCTTGAGG - Intronic
953742595 3:45550283-45550305 CAGACAGCTGGCTCCTATTGTGG - Intergenic
954394719 3:50287448-50287470 CAGCCTCCTGGCTCCTCCTGTGG + Exonic
954407052 3:50351007-50351029 CAGCATGCTGGCAGCACTTGGGG + Exonic
954435445 3:50493520-50493542 CAGCCTGGTGGCCTCGCTTTTGG - Intronic
954619213 3:51986179-51986201 CAGCCTGCTGGCCCTGCCTGTGG + Intronic
954700200 3:52446875-52446897 CAGCCTGCCAGCCCATCCTGGGG + Intergenic
961633649 3:128319266-128319288 AAGCCTGCTGTCCCCTGGTGAGG - Intronic
962278628 3:134033777-134033799 CAGCCTGGTGGCCACTCCTCAGG - Intronic
963290895 3:143486302-143486324 CACCCTGCAGGACTCTCTTGAGG - Intronic
963341142 3:144035273-144035295 CAGCCAGCAGGCCCAACTTGAGG - Intronic
966289195 3:178334849-178334871 TTACCTGCTGGCCTCTCTTGGGG - Intergenic
968502850 4:959224-959246 CAGCCTGCTGCAGCCTCCTGGGG - Exonic
968646561 4:1744072-1744094 CAGGCTGCTGCCCCCTCTGGGGG - Intronic
968665796 4:1821779-1821801 CAACCTGCTGTCACCTCCTGTGG - Intronic
968939252 4:3629594-3629616 CTGCCTGCTGGTCTGTCTTGGGG - Intergenic
969351946 4:6603251-6603273 CACCCAGCTGACCCTTCTTGGGG + Intronic
969897273 4:10317169-10317191 CAGCCTGATGGCACCTCCTCAGG + Intergenic
972312152 4:37891379-37891401 CACCCTGCTGGCTCCTCTCGGGG + Intronic
974749695 4:66121103-66121125 CAGCCTGCTGGCCTTCCTTGTGG + Intergenic
978596138 4:110379420-110379442 CAGTCTGCTGGCCTCTCCTGAGG + Intronic
979206679 4:118046504-118046526 CAGCCTGCCAGCCCCTCTCAGGG + Intronic
986326426 5:6678595-6678617 CAGCCTGCTGGGAGCTCTTAGGG + Intergenic
987301384 5:16600599-16600621 CAGCATGCTGACCTCTCCTGTGG - Intronic
989216244 5:38907572-38907594 CTGTCTGCTGGCCACTCCTGAGG + Intronic
992818955 5:80474984-80475006 CAGTTTGCTGACCCCTGTTGTGG - Intronic
996373364 5:122775710-122775732 CGGACTGCTGGTTCCTCTTGAGG + Intronic
997359518 5:133285823-133285845 TAGCCTGCAGGCCCATCCTGAGG - Intronic
998605933 5:143634561-143634583 CAGCCTGCTTGCCTCTAGTGAGG - Intergenic
999019968 5:148154347-148154369 TAGTCTGCTGGCCTCTCTTGGGG + Intergenic
1002271577 5:178075893-178075915 CAGCCTGGTGGCCTCTGATGCGG + Intergenic
1002603178 5:180366516-180366538 CACCCTGCAGCCGCCTCTTGTGG - Intergenic
1003685945 6:8302285-8302307 CAGCCTGCCGGCCCACCTTATGG + Intergenic
1003834617 6:10057658-10057680 CTGGCTCCTGGCCTCTCTTGAGG - Intronic
1004160177 6:13205939-13205961 CACCCTGCTGGCCACTCTTCTGG - Exonic
1004568824 6:16825166-16825188 AAGACTGGAGGCCCCTCTTGGGG + Intergenic
1005418578 6:25626772-25626794 CAGCCTCCTGGGCCCTCTCTTGG - Intergenic
1006991260 6:38216896-38216918 CAGACTGCTGGTCCACCTTGGGG + Intronic
1007353678 6:41294432-41294454 CTGTCTGCTGGCCTCTCCTGGGG + Intergenic
1007665923 6:43512917-43512939 CTGCTTTCTGGCCCCTCATGGGG + Intronic
1008020806 6:46575389-46575411 CAGTCTGCTGGCCTCTCTCAGGG + Intronic
1008716532 6:54295813-54295835 CTGTCTGCTGGCCCCTCCTGGGG - Intergenic
1009734882 6:67663349-67663371 CAGTCTGCTGGCCTCTCCCGGGG - Intergenic
1010290463 6:74130753-74130775 CAGGCTGCCAGCCCCACTTGGGG + Intergenic
1013774615 6:113665811-113665833 CTGTCTGCTGGCCCCTAGTGGGG - Intergenic
1020030509 7:4929452-4929474 CAGCTTCCTGGCCCACCTTGAGG - Intronic
1021337741 7:19424617-19424639 CATCTTGTTGGCCCATCTTGAGG - Intergenic
1023843005 7:44107256-44107278 CATCCTGCTGGCATCTCATGGGG - Intronic
1025241745 7:57282379-57282401 CAGGCTGCTGGCCTGTCCTGTGG + Intergenic
1026166518 7:67914933-67914955 CAGGCTGCTGGCCTGTCCTGTGG + Intergenic
1026712234 7:72752221-72752243 CAGCCTGCAGCCCCCTCAAGTGG - Intronic
1026975259 7:74493971-74493993 CAAACAGCTGCCCCCTCTTGGGG + Intronic
1027627530 7:80564155-80564177 TAGTCTGCTGGCCTCTCTTGGGG - Intronic
1031330020 7:120452911-120452933 CTGTCTGCTGGCCTCTCCTGGGG + Intronic
1035031275 7:155862723-155862745 CAGCTCGCTGGCGCCTCTGGTGG + Intergenic
1038879031 8:31587263-31587285 TACCCTGCTGGCCACTTTTGTGG - Intergenic
1039075411 8:33686507-33686529 CAGCCTGCTGACCTCTTCTGAGG - Intergenic
1040470278 8:47730797-47730819 GGGGCTGCTGGCCCCTCCTGAGG - Intronic
1041427470 8:57738773-57738795 CTGTCTGCTGGCCTCTCCTGGGG - Intergenic
1042039658 8:64578267-64578289 CAGCCAGCTTGCCCTTTTTGTGG - Intergenic
1042976783 8:74478533-74478555 CAGTCTGCTGGCATCTCCTGGGG - Intronic
1048727250 8:137400557-137400579 CTGTCTGCTGGCCTCTCCTGGGG + Intergenic
1049218040 8:141416748-141416770 CAGCCTGCTTGCCCACCTGGAGG + Intronic
1049477974 8:142805703-142805725 CTGCCTCCTGGCCCCTTTTCAGG + Intergenic
1049586871 8:143436388-143436410 CTTCCTGCTGGCCACTCCTGGGG + Intergenic
1050071396 9:1818365-1818387 CAGCCTGTTGGGTCCACTTGGGG - Intergenic
1051814308 9:21087440-21087462 TAGCTTGCTGGCCTCTCTGGGGG - Intergenic
1053542995 9:38993923-38993945 CAGTCTGCTCGCCCCTCCTGGGG - Intergenic
1053647643 9:40132402-40132424 CAGTGTGATGCCCCCTCTTGAGG - Intergenic
1053758088 9:41331441-41331463 CAGTGTGATGCCCCCTCTTGAGG + Intergenic
1053807438 9:41817440-41817462 CAGTCTGCTCACCCCTCCTGGGG - Intergenic
1054328620 9:63730356-63730378 CAGTGTGATGCCCCCTCTTGAGG - Intergenic
1054451502 9:65405727-65405749 CTGCCTGCTGGTCTGTCTTGGGG + Intergenic
1054536936 9:66243768-66243790 CAGTGTGATGCCCCCTCTTGAGG + Intergenic
1054623154 9:67369987-67370009 CAGTCTGCTCACCCCTCCTGGGG + Intergenic
1057411694 9:94822022-94822044 CAGCCTACTGACCCCGCTCGTGG + Intronic
1057422050 9:94920459-94920481 CAGCCTGCTGGAACCTGCTGTGG + Intronic
1057979856 9:99650085-99650107 CAGTCTACTGGCCTCTCCTGGGG + Intergenic
1060298196 9:122357209-122357231 CAGTCTGGTGGTCCCTCTTCTGG + Intergenic
1061162166 9:128901826-128901848 CACCCGGCTGGCTCCTGTTGGGG + Intronic
1061791959 9:133063708-133063730 CAACCTCCAGGCCCCTCGTGGGG + Intronic
1061826002 9:133258539-133258561 AAGCCTGCTGGGCCTCCTTGTGG + Intronic
1061902105 9:133678215-133678237 GAGCCTGCTGGCCACTGTGGTGG - Intronic
1062733212 9:138120663-138120685 CAGCCTGTAGGCCCCTCTCCCGG - Exonic
1187126853 X:16462203-16462225 TGGCCTGCTGGCCCATGTTGGGG - Intergenic
1187269701 X:17768669-17768691 CAGCCTGGTGGGCCCTGTGGAGG + Intergenic
1189040497 X:37537723-37537745 CAGTCTGCTGGCCTCTTGTGGGG - Intronic
1191685449 X:63885005-63885027 CTGTCTGCTGGGCACTCTTGGGG + Intergenic
1193084399 X:77436451-77436473 CAGCCAGCTGGCCCCAGTTATGG + Intergenic
1193703371 X:84790943-84790965 TGGTCTGCTGGCCTCTCTTGGGG + Intergenic
1195289137 X:103414561-103414583 CAGTCTGTTGGCCTCTCCTGGGG - Intergenic
1195544597 X:106100734-106100756 TGGCCTACTGGCCTCTCTTGGGG - Intergenic
1195586066 X:106566734-106566756 CGGACTGCTGGCCTCTGTTGGGG + Intergenic
1196574477 X:117302279-117302301 CTGTCTGCTGGCCTCTCCTGGGG - Intergenic
1199136994 X:144265685-144265707 CAGTCTGCTGGCCCATCCTGGGG + Intergenic