ID: 1138419969

View in Genome Browser
Species Human (GRCh38)
Location 16:56892718-56892740
Sequence GGGCAGTCCCAGAGCCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 258}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138419969_1138419984 26 Left 1138419969 16:56892718-56892740 CCCAGAGGGCTCTGGGACTGCCC 0: 1
1: 0
2: 2
3: 36
4: 258
Right 1138419984 16:56892767-56892789 GGGAGAGAGAAGCTGAAAGCAGG 0: 1
1: 0
2: 4
3: 71
4: 679
1138419969_1138419985 27 Left 1138419969 16:56892718-56892740 CCCAGAGGGCTCTGGGACTGCCC 0: 1
1: 0
2: 2
3: 36
4: 258
Right 1138419985 16:56892768-56892790 GGAGAGAGAAGCTGAAAGCAGGG 0: 1
1: 0
2: 5
3: 72
4: 756
1138419969_1138419980 6 Left 1138419969 16:56892718-56892740 CCCAGAGGGCTCTGGGACTGCCC 0: 1
1: 0
2: 2
3: 36
4: 258
Right 1138419980 16:56892747-56892769 CCAGTACTCACCAGAATCCCGGG 0: 1
1: 0
2: 0
3: 13
4: 171
1138419969_1138419978 5 Left 1138419969 16:56892718-56892740 CCCAGAGGGCTCTGGGACTGCCC 0: 1
1: 0
2: 2
3: 36
4: 258
Right 1138419978 16:56892746-56892768 CCCAGTACTCACCAGAATCCCGG 0: 1
1: 0
2: 1
3: 11
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138419969 Original CRISPR GGGCAGTCCCAGAGCCCTCT GGG (reversed) Intronic
900102712 1:968871-968893 GGGCAGCCACAGAGACCCCTCGG + Intronic
900237127 1:1598228-1598250 GGGCAGTGCCATAACCCTCCTGG + Exonic
900640148 1:3684633-3684655 GGGCTGGCCCAGAGCCATGTGGG + Intronic
902621346 1:17652736-17652758 GGTCAGTCTCAGAGCCCACCTGG + Intronic
904112067 1:28133862-28133884 GGCCACTCCCAGATCCCTCTTGG + Intergenic
904334017 1:29785341-29785363 GGGCTGGCCCGGTGCCCTCTGGG + Intergenic
904437441 1:30507901-30507923 GGGCAGTGCCTGTGGCCTCTTGG - Intergenic
904907026 1:33905256-33905278 GGAGAGTCCCAGGACCCTCTGGG + Intronic
905825027 1:41020750-41020772 GGACACTCCCTGAGTCCTCTGGG - Exonic
906849846 1:49236422-49236444 GGGAAGTCTCAGATCCTTCTGGG + Intronic
908052937 1:60252151-60252173 AGTCAGTCCCAGAGCAGTCTAGG - Intergenic
908356630 1:63329507-63329529 GGTAAGTCCCAGAACCTTCTGGG - Intergenic
909901593 1:81143608-81143630 GGGCAGTTGCAGACCACTCTAGG + Intergenic
912568226 1:110604296-110604318 TGGCAGGCCCTGAGCTCTCTGGG + Exonic
914961590 1:152214029-152214051 GGCCAGATCCAGAGCCCTGTCGG + Exonic
914961713 1:152214737-152214759 GGCCAGATCCAGAGCCCTGTTGG + Exonic
914961838 1:152215439-152215461 GGCCAGATCCAGAGCCCTGTCGG + Exonic
914961962 1:152216147-152216169 GGCCAGATCCAGAGCCCTGTTGG + Exonic
914962085 1:152216849-152216871 GGCCAGATCCAGAGCCCTGTCGG + Exonic
914962335 1:152218259-152218281 GGCCAGATCCAGAGCCCTGTCGG + Exonic
914962577 1:152219657-152219679 GGCCAGATCCAGAGCCCTGTTGG + Exonic
915328635 1:155094427-155094449 GAGCAGTCCCTGAGCCTTCTAGG + Intergenic
915468985 1:156114616-156114638 GGGCAGTCCCAGATCCATTGGGG - Intronic
916986858 1:170201116-170201138 GGGCAGTCCTGGGGCACTCTTGG + Intergenic
917452714 1:175160536-175160558 GGGCAGTCCCAGGGACCACGTGG - Exonic
919802058 1:201359994-201360016 GCCCAGCCCCAGACCCCTCTGGG + Intronic
920103064 1:203529961-203529983 TGGAAGTCACAGAGCCCACTTGG - Intergenic
922764655 1:228150668-228150690 GGGGAGGCCCACACCCCTCTGGG + Intronic
923144200 1:231186488-231186510 GGTCCTTCCCAGAGCCCTCAGGG - Intronic
1063679688 10:8175077-8175099 AGGCAGTCCCAGAGAGCTCCTGG - Intergenic
1067052140 10:43027801-43027823 GGGCAGTCCCCCAGACCTATCGG + Intergenic
1067267756 10:44761265-44761287 GAGCACTTCCAGAGCCCTGTGGG - Intergenic
1067944483 10:50681621-50681643 GGGCAGTCGGAGAGGCCACTTGG + Intergenic
1069832754 10:71291154-71291176 GGGTACCACCAGAGCCCTCTGGG - Intronic
1070322902 10:75367829-75367851 TGGCAGTCCCCGAACCCTGTAGG - Intergenic
1070609672 10:77924998-77925020 GGGCAGTTTCTCAGCCCTCTCGG + Intronic
1070826538 10:79393634-79393656 GGGCAGTCACAGAGCCCTGGGGG - Intronic
1070865984 10:79708492-79708514 GGGCAGTCGGAGAGGCCACTTGG + Intronic
1070879778 10:79846623-79846645 GGGCAGTCGGAGAGGCCACTTGG + Intronic
1071528019 10:86369213-86369235 AGGCAGGCCCAGAGACCACTGGG + Intergenic
1071632883 10:87230713-87230735 GGGCAGTCGGAGAGGCCACTTGG + Intronic
1071646332 10:87362931-87362953 GGGCAGTCGGAGAGGCCACTTGG + Intronic
1071707640 10:88016570-88016592 TGGAACTCTCAGAGCCCTCTTGG + Intergenic
1072317775 10:94220552-94220574 GGGCAGTCACAGATTCTTCTTGG + Intronic
1075589421 10:123680517-123680539 GGGCAGCTCCAGGGCCCCCTGGG + Intronic
1076206748 10:128609992-128610014 GGGGACTGCCTGAGCCCTCTGGG + Intergenic
1076924508 10:133475685-133475707 AGGCAGTCCCAAAGACCTCCTGG - Intergenic
1077107691 11:849161-849183 GGACAGACCCAGAGCGCTCCAGG - Intronic
1077199428 11:1298026-1298048 GGGCTGTGCCAGGGCCCTGTGGG - Intronic
1078194223 11:9121598-9121620 GGGCAGGCCCAGAGTTCCCTGGG + Intronic
1079289377 11:19173469-19173491 GAGGTGACCCAGAGCCCTCTGGG + Intronic
1081847681 11:46252510-46252532 GGGCAGTCCCAGAGGACCTTTGG + Intergenic
1082266158 11:50120760-50120782 GGGCAATCCCAGTGCTTTCTTGG - Intergenic
1082289931 11:50357812-50357834 GGGCAATCCCAGTGCTTTCTTGG + Intergenic
1083231722 11:61325692-61325714 CTGCAGTCCCAGAGCCCTTTGGG - Exonic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1083744252 11:64726458-64726480 GGGCAGTCCGAGGGCCCTGCTGG - Intergenic
1084000275 11:66292176-66292198 GGGAAGTCCCAGAGCCCCTACGG + Intronic
1084349388 11:68584317-68584339 GGACAATACCAGAGCGCTCTGGG - Intronic
1084504518 11:69556928-69556950 GGGCAGGCCTAGCCCCCTCTAGG - Intergenic
1089833631 11:121350770-121350792 GGGCAGTTCAGGTGCCCTCTGGG - Intergenic
1090230571 11:125100191-125100213 GGGCAGTCCCAGAGAGCTCATGG - Intronic
1091974019 12:4810539-4810561 TGGCCGGCCCAGAGCTCTCTGGG - Exonic
1092924165 12:13258597-13258619 GGGGAGTCCCAGAGCCTGCTGGG + Intergenic
1093139341 12:15489623-15489645 GGTCAGTCTCATAGCCATCTTGG + Intronic
1094870433 12:34596501-34596523 GGGAAGCCCCAGAGTCCCCTAGG - Intergenic
1097012201 12:55961239-55961261 GGGCATTCCCTGAGCTCACTGGG + Intronic
1098886793 12:75968760-75968782 GGGTACTCCCAGAGGACTCTGGG + Intergenic
1102686952 12:114732356-114732378 GGGCAGAGCCAGAGGCCTCATGG + Intergenic
1103676683 12:122661352-122661374 GGGCAGTCCCAGCAACCTCAGGG - Intergenic
1107967104 13:45607050-45607072 GTGCTTCCCCAGAGCCCTCTGGG - Intronic
1108979492 13:56492351-56492373 CTGCAGTGCCAGAGCCCTCATGG - Intergenic
1111657881 13:91175253-91175275 GGGCAGTCCCAGCGTCCCCTCGG - Intergenic
1114563990 14:23614682-23614704 AGGCAGTCCCAGATGCCCCTAGG + Intergenic
1114665685 14:24376098-24376120 GGGCTGTCCCAGAGCGCACCAGG - Exonic
1115728270 14:36240471-36240493 GGACTGTCCCAGAGCAGTCTTGG + Intergenic
1118373459 14:65157119-65157141 TGGGAGTGCCAGAGCCCTCTGGG - Intergenic
1119428655 14:74551745-74551767 CAGCTGTCCCAGAGCACTCTGGG + Intronic
1119736323 14:76984998-76985020 TGGGAGTCCCAGAGCCCAGTGGG + Intergenic
1122606563 14:102950515-102950537 GAGCAGTCCAAGAGGCCTCTGGG - Exonic
1126467677 15:48975880-48975902 GGGCAGGCGCAGCGCCCCCTCGG + Intergenic
1127632520 15:60840317-60840339 GGCCTGTGTCAGAGCCCTCTGGG - Intronic
1127918433 15:63474263-63474285 GGGCATTCCCAGGCCTCTCTGGG + Intergenic
1128334999 15:66780121-66780143 GGGCAGCTCCAGAGCCCTTAAGG + Intronic
1128527114 15:68420119-68420141 GGGCACTCCCAGCTCCTTCTTGG + Intronic
1129165586 15:73775393-73775415 GGGCAGTCCCTGAGGGCTGTGGG + Intergenic
1129301985 15:74630759-74630781 GACCAGTCCCAGTGCCCCCTGGG + Exonic
1131227543 15:90637804-90637826 CCCCAGTCCCAGAGCCCTGTGGG + Intronic
1132630323 16:914209-914231 GGGCAGTCCCTGACCCCTCCTGG + Intronic
1132864236 16:2085745-2085767 GGGCAGCCTCAGCGCCCTATAGG + Intronic
1133092377 16:3414216-3414238 GGGCAGCCACGGAGCCCTCTGGG + Intronic
1133130635 16:3674305-3674327 TGGCAGTCCCACGGCCCTCAGGG - Intronic
1133295039 16:4747544-4747566 AGGCAGGCCCAGAGCCCTGGGGG + Exonic
1136580872 16:31150079-31150101 GGGCAGTGACAGAGCCCTGCAGG - Exonic
1137364609 16:47849788-47849810 GAGCAGTTCCACAGCCCTCTAGG - Intergenic
1138419969 16:56892718-56892740 GGGCAGTCCCAGAGCCCTCTGGG - Intronic
1141614474 16:85202663-85202685 GGGCTCTCCCAGAACCCTGTGGG - Intergenic
1141860524 16:86713244-86713266 GGGAAGCCCCAGACCCCCCTGGG - Intergenic
1142176675 16:88648385-88648407 TGGGGGTCCCAGAGCCCACTGGG - Intronic
1142509287 17:384514-384536 GGGCATTCCCAGAGGACTCCTGG + Intronic
1143710121 17:8728590-8728612 GGGCAGTCTGAGGGCCCTCTAGG + Intergenic
1143943163 17:10564444-10564466 GGTCACTGCCAGATCCCTCTTGG - Intergenic
1144703142 17:17351478-17351500 GCGCAGTCCCTGGGCCCTCTGGG - Intergenic
1144888362 17:18478882-18478904 GGTCACCCCCAGAGCCCTCATGG + Intronic
1145143844 17:20465420-20465442 GGTCACCCCCAGAGCCCTCATGG - Intronic
1146406347 17:32542013-32542035 GGACAGTCTCAGAGCCCTTGGGG - Intronic
1147259124 17:39198142-39198164 CGGCAGCCCCAGAGCCATGTTGG - Intergenic
1147560841 17:41507941-41507963 AGTGAATCCCAGAGCCCTCTGGG + Intergenic
1148079036 17:44957435-44957457 GATCAGTCCCAGTGGCCTCTGGG + Intergenic
1148216183 17:45835115-45835137 GGGCAGCCCCAGGGCCCAGTGGG - Exonic
1151184843 17:72356382-72356404 GGGCAGTACTGGAGCCCTATGGG - Intergenic
1151540051 17:74760200-74760222 CGGCACTCCCACAGCCCTGTGGG - Intronic
1151969189 17:77449178-77449200 GAGCAGCCCCAGAGCCTTCTCGG - Intronic
1152230719 17:79112809-79112831 GGGAAGCCCCAGTGGCCTCTGGG + Intronic
1153004692 18:487504-487526 GGGCAGTCACACAGCTCTTTGGG - Intronic
1153945495 18:10013880-10013902 TGGGCGTCCCAGAGCCCTTTTGG + Intergenic
1156293565 18:35770815-35770837 GGCCAGTCCCAGAGGACACTGGG + Intergenic
1156878477 18:42045676-42045698 GAGCAGTCCTAGAGCCTTCCTGG + Intronic
1157403210 18:47403194-47403216 GGGGTGTCCCTGAGCCCTCTTGG - Intergenic
1157579867 18:48767385-48767407 GAGCATTCCCAGAGCCCACGTGG - Intronic
1157582587 18:48782174-48782196 GTGAAGTCCAAGAGCTCTCTGGG + Intronic
1157611084 18:48956071-48956093 AGGCAGCCCCACAGTCCTCTGGG - Intergenic
1157621408 18:49019197-49019219 GGGCCGCCCCAGAGCGCCCTTGG + Intergenic
1158552014 18:58444339-58444361 GGCCAGTCCCTCAGCCCTGTGGG + Intergenic
1160583661 18:79901259-79901281 GGGGAATCCCAGAGCCCTCCAGG + Intergenic
1160894197 19:1395131-1395153 GGGCTGTCACAGGGACCTCTCGG - Intronic
1160975814 19:1791927-1791949 GGAGAGTCCCAGGGCCCCCTTGG + Intronic
1161106162 19:2445131-2445153 GGGCCCTCCCAGACCCCACTGGG + Intronic
1162095890 19:8309734-8309756 GGGCGGTCTCAGCACCCTCTTGG + Intronic
1162967869 19:14164507-14164529 GGGCAGTCCCAGGTCCAGCTCGG + Intronic
1163035360 19:14566339-14566361 GGGCCGTCCCAGAGCACTGTGGG + Intronic
1163075326 19:14885919-14885941 GGTAAGTCCCAGAGCCCAGTGGG - Intergenic
1163287778 19:16359210-16359232 GGGCAGTCAGACAGCCCTCTTGG + Intronic
1163550645 19:17964799-17964821 GGGCAGTCCCCGATCCCTCAGGG + Intronic
1163651177 19:18518905-18518927 GGTCAACACCAGAGCCCTCTGGG + Intronic
1165603401 19:37078212-37078234 GGGCACTCCCAGAAACCTCCGGG + Intronic
1166330731 19:42076578-42076600 GGGGAGCCGCGGAGCCCTCTTGG - Intronic
1167251144 19:48398945-48398967 GGACAGTCCCCGCCCCCTCTAGG - Intronic
1167268963 19:48497702-48497724 GGGCCGTCCCCGTGCCCACTGGG + Exonic
1167623134 19:50569598-50569620 GGGCAGATGCAGAGGCCTCTGGG + Intergenic
1167721469 19:51182948-51182970 AGGCTGTCCCAGACCCCTGTGGG + Intergenic
1167763507 19:51463822-51463844 AGGCTGTCCCAGACCCCTGTGGG - Intergenic
1168301799 19:55408947-55408969 GTGCGGTCGCAGTGCCCTCTCGG + Intergenic
925086940 2:1115929-1115951 GGGCAGGCCCTGGGCCATCTCGG - Intronic
927422548 2:22948429-22948451 GGGCAGGCTCAGCGCCCTCAAGG + Intergenic
928307105 2:30179234-30179256 TGGCAGTCCCAGAGCCACGTGGG + Intergenic
928538042 2:32258813-32258835 GAGCAGTCTCAGAGGCTTCTGGG - Intronic
930751703 2:54940761-54940783 GTGCAGTCCCAGGGCCAACTGGG - Intronic
931907776 2:66861300-66861322 GGGCAGAGACAGAGCCCTTTGGG + Intergenic
932047739 2:68366440-68366462 GGGCAATCACCGAGCCTTCTGGG - Intronic
936092821 2:109511979-109512001 TGGGAGTCCCAGAGTCCTCTGGG - Intergenic
936191005 2:110336211-110336233 GGGCAGCCCCAGGGGCCTTTCGG - Intergenic
936977659 2:118235582-118235604 GGGCAGTGTGTGAGCCCTCTAGG - Intergenic
937268826 2:120634118-120634140 TGGCACTCCCAAAGCCCCCTCGG + Intergenic
938412312 2:131075201-131075223 GGGCAGTTCCAGACCTTTCTTGG - Intronic
942246677 2:174014217-174014239 TGGCAGTCCCACAGGCCCCTGGG - Intergenic
942779486 2:179624276-179624298 GGGGAGTTCCAGACCCTTCTGGG - Intronic
944395381 2:199260652-199260674 GGGCAGTGGCAGAGCCATCCGGG + Intergenic
944400374 2:199319422-199319444 GGGTAGTGCCAGAGCCTGCTGGG - Intronic
946185770 2:217979645-217979667 GTGGAGTCCCAGAGCCCTGGGGG - Intronic
946460107 2:219861363-219861385 GGGGTCTCCCAGAGTCCTCTGGG + Intergenic
947484868 2:230538756-230538778 CTGCAGGCCCAGAGCCCTCCAGG + Intronic
947769872 2:232662195-232662217 GGACAGAGTCAGAGCCCTCTTGG + Intronic
948670295 2:239564225-239564247 GTGGAGACCCAGAGTCCTCTGGG - Intergenic
948727874 2:239945840-239945862 TTGCAGTCCCGGAGCCCTGTGGG - Intronic
948844185 2:240675370-240675392 GGGCACAGCCAGAGCCCTGTGGG - Intergenic
948849675 2:240699509-240699531 GGGCACAGCCAGAGCCCTGTGGG + Intergenic
948857827 2:240738434-240738456 GGAAAGTCCCATGGCCCTCTTGG + Intronic
949032340 2:241803009-241803031 GAGGAGACCCAGAGGCCTCTAGG - Intronic
1169000395 20:2163927-2163949 GGCCACTCCCAGAGCTCTCCAGG - Intronic
1169138614 20:3213490-3213512 GGACCGGCCCAGAGTCCTCTAGG + Intronic
1169309099 20:4519964-4519986 GGGCTGTCCCAGAGCCATGTTGG + Intergenic
1170609632 20:17902102-17902124 GGGCAGGGCCACAGCCCCCTTGG - Intergenic
1171168829 20:22997497-22997519 GGGCTGCCCAAGAGCCATCTGGG + Intergenic
1172760210 20:37316150-37316172 GGGCAGTCCCACATCCGTGTGGG + Intronic
1174401009 20:50275959-50275981 GAGTTGTCCCAGAGGCCTCTAGG + Intergenic
1175248539 20:57595671-57595693 GGTCAGTGGCGGAGCCCTCTGGG + Intergenic
1175844500 20:62051445-62051467 GGGCAGTCCCAGGGCCCTGTGGG - Intronic
1175995483 20:62810397-62810419 GGGCAGTTCCAATCCCCTCTGGG - Intronic
1176896343 21:14383184-14383206 CGGCAGTCCCGCAGCCCCCTGGG + Exonic
1179037610 21:37773047-37773069 GGGCAGTTCCAGGGCCTTCAGGG + Intronic
1180073150 21:45448780-45448802 GGGCAGTCCCAGAGCCGTCAGGG + Intronic
1181600874 22:23951291-23951313 GAGCAGAGCCAGAGCCCCCTGGG + Intergenic
1181607639 22:23990035-23990057 GAGCAGAGCCAGAGCCCCCTGGG - Intergenic
1181756659 22:25029091-25029113 GGGCAGCCCCAGAGCCCTGGTGG + Exonic
1182094117 22:27614632-27614654 GGGCCCTCCTAGAGCCCGCTGGG - Intergenic
1184788100 22:46681553-46681575 GGGCAGGCCTGGTGCCCTCTAGG + Intergenic
1185102819 22:48850619-48850641 AGGGGGTCCCAGAGCCCCCTTGG + Intronic
1185416445 22:50712900-50712922 GCTCACTCCCAGGGCCCTCTGGG - Intergenic
949394693 3:3602462-3602484 GAGCAAGCCCAGAGCCCTCCTGG + Intergenic
950333764 3:12177831-12177853 GGGCAGTCCCTGAGTCTTCTGGG - Intronic
951743993 3:25956502-25956524 GGGCAGGCCAACAGCCATCTTGG - Intergenic
953730529 3:45443625-45443647 GGGCACTCCCAGCCTCCTCTGGG + Intronic
954705188 3:52476503-52476525 CGGCAGTCACAGGGCCTTCTAGG - Exonic
954747214 3:52794097-52794119 GGGATGTCCCATAGTCCTCTAGG + Intergenic
955043391 3:55337615-55337637 GGACCATCCCAGGGCCCTCTTGG - Intergenic
956721924 3:72125578-72125600 GTGCTGTCCCAGATACCTCTGGG + Intergenic
956908170 3:73788616-73788638 GGGCAATCCCAGTGCTTTCTTGG - Intergenic
958774081 3:98460433-98460455 TGACTGGCCCAGAGCCCTCTGGG - Intergenic
960256541 3:115516808-115516830 GGCCAGGCCCAGGGCCCTGTTGG - Intergenic
960681281 3:120249878-120249900 AGGGACTCCAAGAGCCCTCTTGG - Intronic
960994823 3:123333715-123333737 GAGCAGGCCCAGTGCCCTCGAGG - Intronic
961305933 3:125959153-125959175 GGGCACTCCCAGGTCCCTCCTGG + Intergenic
962625446 3:137221246-137221268 GGGAGGTCCCAGAGGACTCTGGG + Intergenic
962835381 3:139184796-139184818 GGGCAGCCTCAGAGCCATCGGGG - Intronic
963073913 3:141328929-141328951 GAGCATTCCCTGAGCCCTCCAGG + Intronic
963248266 3:143082813-143082835 GGGCGCTTCCAGAGCCCTCCCGG + Intergenic
965449164 3:168816197-168816219 GGGCACTGCCAGAGCCCCCCAGG + Intergenic
966141957 3:176767148-176767170 GGGGAGCTCCAGAGCCCACTTGG - Intergenic
966318052 3:178670903-178670925 GTACATTCCCAGAGGCCTCTAGG - Intronic
966786440 3:183627094-183627116 GGCCAGTCTCAGAGCACTCTGGG + Intergenic
967511952 3:190322539-190322561 GGGCGCTCCCGGCGCCCTCTCGG - Intronic
968067409 3:195766388-195766410 GGGCCCCCCGAGAGCCCTCTTGG + Intronic
968271555 3:197407257-197407279 AGGAGCTCCCAGAGCCCTCTGGG - Intergenic
968628352 4:1637947-1637969 AGGGGGTCCCAGGGCCCTCTGGG - Intronic
970309973 4:14771913-14771935 GGGCAGAGCCAGTGCCCTCAGGG + Intergenic
974779157 4:66528979-66529001 GGGCAGAGGCAGAGCCCTCATGG + Intergenic
977536364 4:98260608-98260630 GGGCCTTTCCAGAGCCCTCCGGG + Intergenic
977923497 4:102671958-102671980 GGGCAGACCCAGAGCACTGTGGG + Intronic
978431328 4:108635891-108635913 GGGCAGTTCAAGATCCATCTGGG - Intergenic
980301730 4:131004509-131004531 GAGTAGTCCCATAGCCCTTTAGG - Intergenic
981048400 4:140286907-140286929 GGGTAGTCAGGGAGCCCTCTGGG - Intronic
988501455 5:31787125-31787147 GGGCAGTCACAGTGACCTCATGG + Intronic
990003869 5:50923241-50923263 GTGCAGACGCAGAGGCCTCTTGG - Intergenic
990428566 5:55712423-55712445 TGGCCGTCGCAGAGCCCTCTGGG - Exonic
991604384 5:68385626-68385648 GAGCAGTCCCACAGTCCTGTCGG + Intergenic
997337048 5:133115748-133115770 GAGCACTCCCAGAGCCCACTGGG - Intergenic
997530196 5:134577197-134577219 GGGCTGTCCCAGGGGCCTCTGGG - Intronic
998394373 5:141809046-141809068 GAGTAGTTTCAGAGCCCTCTTGG - Intergenic
1003685353 6:8297007-8297029 GGGCCCTCCCAGAGCCATTTGGG - Intergenic
1004160390 6:13207637-13207659 GGGAAATCCCAGTGCCTTCTTGG - Intronic
1005306472 6:24518817-24518839 GGGCAATCCTAGAGCCACCTTGG + Intronic
1006255476 6:32829222-32829244 GGGCAGCCCCAGTTCCCTCCTGG - Intronic
1006405447 6:33842353-33842375 GGGCAGTGCCAATGCCCTCTGGG - Intergenic
1007703791 6:43779398-43779420 CGGCAGACACACAGCCCTCTTGG + Intronic
1010345052 6:74801038-74801060 GTGCAGGGCCAGAGCCCTCATGG + Intergenic
1010807710 6:80258579-80258601 GGGGAGCCTCAGAGCCATCTGGG - Intronic
1011248341 6:85343546-85343568 GGGCATTGCCACAGCTCTCTTGG - Intergenic
1011881615 6:92034753-92034775 GAGCAGGCCCAAATCCCTCTGGG + Intergenic
1013175746 6:107675247-107675269 TGGCAGTCACAGGGCCCTCTAGG - Intergenic
1015578804 6:134701652-134701674 GGGAACCCCCAGAGCCCACTTGG + Intergenic
1017889441 6:158626520-158626542 GGGGACTCCCAGAGCCCACCTGG - Intronic
1019303511 7:321631-321653 GGGCGATCCCAGAGCTCTGTGGG - Intergenic
1019427899 7:986002-986024 AGGCAGGCCCAGAGCCCACCTGG + Intronic
1019634637 7:2069039-2069061 TGGCATTCCCAGAACCCTCCTGG + Intronic
1020127666 7:5541926-5541948 GGAGAGTCCCAGAGGCCTCCTGG + Intronic
1022035101 7:26526575-26526597 GGGCTGTCCCAGCACCCACTGGG - Intergenic
1022535415 7:31095563-31095585 GGGCTGTGCCAGAGTCCCCTGGG + Intronic
1031571414 7:123364441-123364463 GGGGAGTCGCACAGCCTTCTGGG - Intergenic
1032274890 7:130445646-130445668 GGTCAGTTCAAGAGCCCCCTTGG - Intergenic
1033223492 7:139543849-139543871 GGGCACTCCCATAGCCCCCTGGG - Intronic
1033731861 7:144188001-144188023 GGGCAGGCCCAGAGCTCTGGGGG + Exonic
1033742710 7:144286584-144286606 GGGCAGGCCCAGAGCTCTGGGGG + Intergenic
1033751192 7:144363030-144363052 GGGCAGGCCCAGAGCTCTGGGGG - Exonic
1033875410 7:145811146-145811168 AGGCACTCCAAGAGCCCACTTGG - Intergenic
1034438474 7:151074926-151074948 GGGCAATCCCAGGGACCTCAGGG + Intronic
1035635488 8:1140574-1140596 GGTCAGGGCCAGAGCCCTATGGG - Intergenic
1036508355 8:9377266-9377288 GGGCAGATACAGAGCCCACTTGG - Intergenic
1036552330 8:9826523-9826545 AGGCAGTTTCAGATCCCTCTGGG + Intergenic
1036646352 8:10613047-10613069 GGGCAGGGCCAGCGCCCTCACGG - Exonic
1037805902 8:22057758-22057780 GGGGAGCCCCAGAACCCTGTGGG - Intronic
1038191364 8:25324085-25324107 TGGAGGGCCCAGAGCCCTCTGGG - Intronic
1040355830 8:46617492-46617514 GGGCAGCCCCAGAGCACGCGAGG + Intergenic
1041252437 8:55947466-55947488 GTGCAGACCCTGAGCCCACTAGG + Intronic
1044077990 8:87846858-87846880 GGGCAGCCCCACAGAGCTCTGGG - Intergenic
1044362404 8:91303334-91303356 GGACAATCCCAGACCCCTCTTGG - Intronic
1045589960 8:103582472-103582494 GGGGACCCCAAGAGCCCTCTTGG - Intronic
1045736441 8:105301203-105301225 GGGCAGTGCCACAGCCCTCCAGG - Intronic
1047349673 8:124061782-124061804 GGGCAGACCCAAAGCCAGCTGGG - Intronic
1049538303 8:143193274-143193296 GGGCAGTCGAAGAGCCCTGTAGG - Intergenic
1052192716 9:25677847-25677869 GGGCAGCCCCAGGGCCCTGAGGG - Exonic
1053290894 9:36879115-36879137 GGGCAGCCCCAGGGCCCCATGGG - Intronic
1053464157 9:38292703-38292725 CTGGTGTCCCAGAGCCCTCTAGG - Intergenic
1053470587 9:38343519-38343541 GGGCATCCCCAGAGCACTCTGGG + Intergenic
1055700493 9:78939835-78939857 GGGCAGTCACAGAAACATCTGGG + Intergenic
1055785038 9:79863091-79863113 GGGCAGGCGCAGAGGCCTTTAGG - Intergenic
1055815648 9:80202073-80202095 GTGCAGTCATAGAGCTCTCTTGG + Intergenic
1056779304 9:89537673-89537695 GTGGCGTCTCAGAGCCCTCTGGG + Intergenic
1057271362 9:93653468-93653490 GGACAGTCCAGGGGCCCTCTGGG - Intronic
1057517889 9:95737292-95737314 GGGCAGCCCCAGCCTCCTCTGGG + Intergenic
1057968558 9:99530078-99530100 GGGCAGGCCCAGAGCTGCCTTGG - Intergenic
1058887379 9:109331572-109331594 GGGCAGTCCCAGAGCCAGGCTGG + Intergenic
1059453476 9:114385553-114385575 GCCCAATCACAGAGCCCTCTGGG + Intronic
1061412218 9:130427846-130427868 GGGCAGCCCCAGAGACATATGGG + Intronic
1061502336 9:131011153-131011175 CGGCAGCCCCAGACCCCACTGGG + Intronic
1061594665 9:131621138-131621160 GGGCAGTTCCAGAGCCTCATGGG + Intronic
1062219034 9:135404427-135404449 GGGCAGAGTCAGACCCCTCTGGG + Intergenic
1062364921 9:136203931-136203953 GTGCTGGCCCAGGGCCCTCTGGG - Intronic
1203776244 EBV:74757-74779 GGGCAGGCCCAGATCTATCTCGG - Intergenic
1185569107 X:1119282-1119304 GGAAAGTCCCAGAGCCCACATGG - Intergenic
1195122936 X:101775027-101775049 GGGGACACCAAGAGCCCTCTTGG + Intergenic
1197268396 X:124400309-124400331 GGGAAAGGCCAGAGCCCTCTTGG + Intronic
1197726111 X:129777572-129777594 GGGCAGCCCCAGAGGGTTCTGGG - Intergenic
1199897374 X:152137698-152137720 GAGGAGTCCCAGAGCCCTGAGGG - Intronic
1199973585 X:152878060-152878082 GGCCCTGCCCAGAGCCCTCTTGG + Intergenic
1200119204 X:153782514-153782536 GAGCAGGCACAGAGGCCTCTCGG - Intronic
1200582191 Y:4963774-4963796 GGGAACTCCCAAAGCCCGCTTGG + Intergenic