ID: 1138420025

View in Genome Browser
Species Human (GRCh38)
Location 16:56892939-56892961
Sequence TGGGGTCCACTGCAGGAGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 294}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138420025_1138420043 29 Left 1138420025 16:56892939-56892961 CCCACCTCCTGCAGTGGACCCCA 0: 1
1: 0
2: 4
3: 37
4: 294
Right 1138420043 16:56892991-56893013 ACCATCTTCCAGTCGGAGCAGGG 0: 1
1: 0
2: 1
3: 7
4: 82
1138420025_1138420031 -8 Left 1138420025 16:56892939-56892961 CCCACCTCCTGCAGTGGACCCCA 0: 1
1: 0
2: 4
3: 37
4: 294
Right 1138420031 16:56892954-56892976 GGACCCCAAGGCCCTGGTGAAGG 0: 1
1: 0
2: 4
3: 32
4: 287
1138420025_1138420039 22 Left 1138420025 16:56892939-56892961 CCCACCTCCTGCAGTGGACCCCA 0: 1
1: 0
2: 4
3: 37
4: 294
Right 1138420039 16:56892984-56893006 GGCCACCACCATCTTCCAGTCGG 0: 1
1: 0
2: 1
3: 20
4: 182
1138420025_1138420042 28 Left 1138420025 16:56892939-56892961 CCCACCTCCTGCAGTGGACCCCA 0: 1
1: 0
2: 4
3: 37
4: 294
Right 1138420042 16:56892990-56893012 CACCATCTTCCAGTCGGAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 87
1138420025_1138420036 1 Left 1138420025 16:56892939-56892961 CCCACCTCCTGCAGTGGACCCCA 0: 1
1: 0
2: 4
3: 37
4: 294
Right 1138420036 16:56892963-56892985 GGCCCTGGTGAAGGAGGAGCAGG 0: 1
1: 0
2: 4
3: 90
4: 791
1138420025_1138420033 -5 Left 1138420025 16:56892939-56892961 CCCACCTCCTGCAGTGGACCCCA 0: 1
1: 0
2: 4
3: 37
4: 294
Right 1138420033 16:56892957-56892979 CCCCAAGGCCCTGGTGAAGGAGG 0: 1
1: 0
2: 5
3: 53
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138420025 Original CRISPR TGGGGTCCACTGCAGGAGGT GGG (reversed) Exonic
900117837 1:1036034-1036056 TGGGGTCCTTTCCAGCAGGTGGG + Intronic
900318841 1:2072610-2072632 TGGGGGCCCGTGTAGGAGGTGGG + Intronic
900592362 1:3465719-3465741 TGGGGGCCCCAGCAGGAGGCCGG - Intronic
900651540 1:3732436-3732458 GGGGGTCCACTCCAGGGGGCAGG + Intronic
900671962 1:3859789-3859811 GGGTGGCCCCTGCAGGAGGTGGG + Intronic
901301033 1:8200314-8200336 AGGGGTCCCCGGCAGGAGCTTGG + Intergenic
901642971 1:10702384-10702406 TGGTGGCCACTTCAGGAGGCAGG - Intronic
902782700 1:18714994-18715016 TGGGGTCCCCTGCAGGAGGAAGG + Intronic
902835618 1:19044994-19045016 TGGGGTCCCCTGCAGGGAGCAGG - Intergenic
904263549 1:29304870-29304892 TGGGGTCCAGGGCAGTGGGTGGG + Intronic
906004570 1:42457336-42457358 GGGGGCCCACTGCAGGTGATGGG + Exonic
907049186 1:51318220-51318242 TGGATTCCAGTGCAGGAGGGTGG + Intronic
912929123 1:113940611-113940633 TATGCTCCACTGCAGGAGCTGGG - Exonic
916250700 1:162735023-162735045 TGGACTCAACTGCAGGAGGTAGG + Intronic
916429140 1:164710919-164710941 TGGGGTCAACAACAGCAGGTGGG - Intronic
917943636 1:179947710-179947732 TGGGGTCCACTCAAGCTGGTAGG + Intergenic
921668774 1:217903606-217903628 GTGGGTCTAGTGCAGGAGGTTGG - Intergenic
1067847719 10:49736865-49736887 TGCAGTGCTCTGCAGGAGGTGGG - Intronic
1068635774 10:59346688-59346710 TGAGGTCCATTACAGGAAGTTGG + Intronic
1069808110 10:71138560-71138582 CGGGGACCACAGCAGGAGGGCGG - Intergenic
1069888198 10:71637077-71637099 AGGGGACCTCGGCAGGAGGTAGG - Intronic
1070058220 10:72955267-72955289 TGGGTTCCACAGCAGAAGCTGGG - Intergenic
1070825661 10:79388980-79389002 TGGGGCCAGCTGCAGGCGGTAGG - Intronic
1070949321 10:80418460-80418482 AGGGGTGCACTGCATGAGGTGGG - Intronic
1071336398 10:84604012-84604034 TGGTGTCCACTGGAGGAAGACGG + Intergenic
1071440499 10:85688247-85688269 TGGTGTCTACTGCAGCAGCTTGG + Intronic
1072321134 10:94251264-94251286 TGGGATCCACAGCAGGATGCAGG + Intronic
1073449153 10:103599289-103599311 TGGGGGGCAGTGCAGGTGGTGGG + Exonic
1073469961 10:103716259-103716281 TGGGGTTCCCCGCAGGAGGCAGG + Intronic
1074735246 10:116424586-116424608 TGGGCTGCACAGCAGGAGGTGGG + Intergenic
1076122189 10:127945075-127945097 TGAGGTCCAATGAAGGAGATAGG - Intronic
1076340951 10:129744539-129744561 TGGGGTTCACAGCAGGGGGAAGG - Intronic
1076688726 10:132209869-132209891 TGGCCTCAGCTGCAGGAGGTGGG - Intronic
1078082914 11:8217166-8217188 GGGGAGCCACTGCTGGAGGTGGG + Intergenic
1079882462 11:25944370-25944392 TGGGATCCACTGCTGCAGTTTGG + Intergenic
1081066196 11:38542886-38542908 TGGGGACTACTACAGGGGGTGGG - Intergenic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1082785803 11:57315776-57315798 TGGGCTCCCATGCAGGAAGTAGG - Intronic
1083150640 11:60789872-60789894 TGGGCACCACCACAGGAGGTAGG + Intronic
1083668443 11:64287640-64287662 TGGGGTTTCCTGCAGGAGGTGGG + Intronic
1083821730 11:65175415-65175437 TGGGCTCCATTGGAGGTGGTGGG + Intergenic
1083997020 11:66277823-66277845 TGGGGGGCGCTGAAGGAGGTTGG - Intergenic
1084044614 11:66561443-66561465 TGGGAACCCCTGCAGGAAGTGGG + Exonic
1084285384 11:68127897-68127919 AGGGGTCCCCTGCAGAAGGGAGG - Intergenic
1084381815 11:68817647-68817669 TGGGGTCAAGGGCAGGAGGCTGG + Intronic
1084583373 11:70038643-70038665 TGGGGGCCACTGCAATAGGGTGG - Intergenic
1085392789 11:76190997-76191019 TGGGGTCCCCAGGAGGAGATGGG + Intronic
1089536218 11:119162082-119162104 TGGGATCCCCAGGAGGAGGTTGG - Exonic
1091577723 12:1754595-1754617 GGGGGTCCATTGCTGGAGGGAGG + Intronic
1091999263 12:5019158-5019180 TGGGGTCACATGCAGGAGCTGGG + Intergenic
1093231016 12:16541985-16542007 TGGGGGCCACTGCAGCAGGGCGG - Intronic
1094141713 12:27188408-27188430 TGGGGAGCACTGCAGGACATTGG - Intergenic
1095654157 12:44649525-44649547 TGGGGACCACTGCAGGATGTGGG - Intronic
1095688530 12:45062680-45062702 TGGGCTCCACTGGACAAGGTTGG + Intergenic
1096246288 12:49989478-49989500 TGGGCTCCACTGGACAAGGTTGG + Exonic
1097257990 12:57694986-57695008 TGGAGTCCACTGAATGAGGCAGG + Intronic
1098268462 12:68746818-68746840 CCGGGGCCAGTGCAGGAGGTGGG - Intronic
1100222944 12:92525611-92525633 TGTGATCCAGTGCAGGAGTTTGG - Intergenic
1100925765 12:99546604-99546626 TGGTGTCCACTGCAGAATTTAGG + Intronic
1101398999 12:104372276-104372298 TGGGCCCCACAGCAGGAAGTGGG - Intergenic
1102731957 12:115119286-115119308 TGGGGGTCACTGAAGGAGATAGG + Intergenic
1104841253 12:131827220-131827242 TGGGATCACCTGTAGGAGGTGGG - Intergenic
1105847799 13:24308268-24308290 GGGTGTCCCCAGCAGGAGGTCGG + Intronic
1107159466 13:37209274-37209296 TAGGTCCCACTGCAGCAGGTAGG - Intergenic
1107792120 13:44013257-44013279 TGGGGTACTAGGCAGGAGGTAGG - Intergenic
1107960140 13:45550080-45550102 TGGGGTCCCCTGGAAAAGGTAGG + Intronic
1108369985 13:49759785-49759807 TGGGCTGCACAGTAGGAGGTAGG - Intronic
1110297911 13:73890618-73890640 TGGGGCCTAGTGCAGGAGGCTGG - Intronic
1112022489 13:95383776-95383798 TGGGCTGCACAGCAGGAGGTGGG + Intergenic
1114631962 14:24164853-24164875 TGGGGTGCATTCCAGGAGATGGG - Exonic
1114714490 14:24810362-24810384 TGGGCTCCTCTGCAAGAGGCTGG + Exonic
1114769055 14:25408172-25408194 TTGGGGCCACTGCAGGATGTTGG + Intergenic
1114781004 14:25538043-25538065 TAGAGGCCACTGCAGGAAGTGGG + Intergenic
1116392717 14:44412988-44413010 TGGGGCCCACTGCTGTAGGATGG - Intergenic
1118989794 14:70787551-70787573 TGGGGCCCATTGCAGCAGGTGGG - Intronic
1119121599 14:72084332-72084354 TGGGCTGCATAGCAGGAGGTGGG - Intronic
1119840045 14:77785542-77785564 TGGGGCCCAGTGCAGGAGGCTGG + Intergenic
1120377852 14:83732320-83732342 TGGGGTCTACTTGAGGAGGGAGG + Intergenic
1120497304 14:85253238-85253260 TGGGGTATACTGCAGGAGGAAGG - Intergenic
1120789207 14:88563438-88563460 TTGGATCCGCTGCGGGAGGTGGG + Intronic
1121564252 14:94896712-94896734 TGAGGCCCACTGCAGGAGAGTGG - Intergenic
1122782461 14:104149490-104149512 TGGGGGCCAGTGCTGGAGGGGGG - Intronic
1122968057 14:105140687-105140709 TTGGGGCCACGGCAGGAGGTGGG + Intergenic
1123495109 15:20816515-20816537 TGGGGTCCCCTGCATTGGGTGGG + Intergenic
1123551601 15:21385608-21385630 TGGGGTCCCCTGCATTGGGTGGG + Intergenic
1123679158 15:22745244-22745266 TGGGCTGCACAGCAGGAGGTGGG + Intergenic
1124331377 15:28819694-28819716 TGGGCTGCACAGCAGGAGGTGGG + Intergenic
1127369356 15:58322924-58322946 TGGGGACCACTGGAGGTGGGAGG - Intronic
1128612162 15:69083034-69083056 TGAGGTGCAAGGCAGGAGGTGGG - Intergenic
1130935870 15:88469933-88469955 TGGGGAAGACTGCAGGAGTTTGG + Intronic
1131838792 15:96415528-96415550 TGGGGCCCAAGGCTGGAGGTGGG + Intergenic
1202959943 15_KI270727v1_random:112850-112872 TGGGGTCCCCTGCATTGGGTGGG + Intergenic
1132924412 16:2421089-2421111 TGGGCTCCACTGCCTGAGGTTGG - Intergenic
1133357327 16:5146198-5146220 TGAGGTGCACTGCATGAGGGGGG + Intergenic
1133421886 16:5653294-5653316 TGGGCTTCAGTGCAGAAGGTGGG + Intergenic
1133710909 16:8400359-8400381 TGGGGTCCACTTGAGGGGGGAGG + Intergenic
1134904468 16:17968338-17968360 TGTGGTCCAATTCAGGAGCTTGG + Intergenic
1137325503 16:47431258-47431280 TGGGCCACACAGCAGGAGGTGGG + Intronic
1137619766 16:49868531-49868553 TGTGGGCCACTGCGGGAGCTTGG - Intergenic
1138420025 16:56892939-56892961 TGGGGTCCACTGCAGGAGGTGGG - Exonic
1138708478 16:58942021-58942043 TGGGCTGCACAGCAGGAGGAGGG + Intergenic
1138864760 16:60803226-60803248 TGGGTTCCACTGCTGGAACTTGG + Intergenic
1139018482 16:62719135-62719157 TGTGGACCACTAGAGGAGGTAGG + Intergenic
1139451915 16:67034700-67034722 TGGGGTACACTGGAGGTGGAAGG + Intronic
1140938741 16:79701067-79701089 TGGGGACCACTAGAGGAGGGAGG - Intergenic
1141225140 16:82107855-82107877 TGGGGTCCAGTGGAGGAGAGGGG - Intergenic
1141431165 16:83970760-83970782 TGGGGGCCACCGCAGAAGCTGGG + Intronic
1142120918 16:88386354-88386376 TGGGGTCCCGGGCAGGAGGCGGG - Intergenic
1142358689 16:89616121-89616143 TGGGGTGCGCAGCAGGAGGCTGG + Intronic
1143542413 17:7577489-7577511 TGGGGCCCAGTGCAGGAGGCGGG + Intronic
1146822548 17:35996045-35996067 TGGGGACTACTACAGGAGGGAGG + Intronic
1147792222 17:43021117-43021139 GGGGGTCCTCTGCAGGAGGAAGG + Intronic
1148123267 17:45224466-45224488 TGGGGACCACTGATGGCGGTGGG - Intronic
1148201086 17:45750460-45750482 TGGGGCTCACGGCAGAAGGTAGG - Intergenic
1150225961 17:63524537-63524559 TGAGGTCCTTTGCAGGAGCTAGG + Intronic
1150495846 17:65607269-65607291 TGGGGTGCTCTGCAGGTGCTAGG + Intronic
1151338040 17:73451842-73451864 TGGGGTGCAGTGCTGCAGGTTGG - Intronic
1152703590 17:81831926-81831948 TTGGGTCCCCTGGAGGAGGAAGG - Intronic
1152930644 17:83107903-83107925 TGAGGGCCAGCGCAGGAGGTGGG + Intergenic
1152930668 17:83107974-83107996 TGAGGGCAAGTGCAGGAGGTGGG + Intergenic
1152930712 17:83108116-83108138 TGAGGGCAAGTGCAGGAGGTGGG + Intergenic
1158211603 18:55056481-55056503 TGAGGTCCTCTGCAGGATGCTGG - Intergenic
1159628588 18:70723184-70723206 TGGGACCCACTGCAGCAGCTGGG + Intergenic
1160418907 18:78731038-78731060 TGGGTACCAGTGCAGGGGGTGGG - Intergenic
1160426009 18:78779818-78779840 TGGGGTCTGCCGCAGGGGGTGGG - Intergenic
1160524504 18:79526964-79526986 GGGCGGCCACAGCAGGAGGTGGG + Intronic
1160785882 19:900138-900160 CGGGGTCCTCTGCAGGAGTGGGG + Exonic
1160873796 19:1288162-1288184 TGGGCCCCACTGCAGGGTGTCGG - Intronic
1161321404 19:3643353-3643375 TGGCGTGCAGGGCAGGAGGTCGG + Exonic
1162611530 19:11758662-11758684 TGGGGCGCAGTTCAGGAGGTCGG - Intergenic
1162725559 19:12688149-12688171 TCGGGGCCAGTGCAGGAGGCGGG + Intronic
1163498558 19:17661819-17661841 TGGGGCGCACAGCAGGAGGTGGG + Intronic
1165173121 19:33906951-33906973 TGGGGGCCAGAGCAGGAGGGAGG + Intergenic
1165203440 19:34163934-34163956 TGGGTTACAGTGCAGGAGGCTGG + Intergenic
1165374303 19:35430921-35430943 TGGATTCAACTGCAGGAGGACGG + Intergenic
1166209564 19:41297492-41297514 TGGGGTCCTCTGTTGGAGGTGGG + Intronic
1166445996 19:42857404-42857426 TGGGTTCCGCTGAGGGAGGTTGG + Intronic
1166453377 19:42919556-42919578 TGGGTTCCGCTGAGGGAGGTTGG + Intronic
1166455863 19:42938865-42938887 TGGGTTCCGCTGAGGGAGGTTGG + Intronic
1166471796 19:43084344-43084366 TGGGTTCCGCTGAGGGAGGTTGG + Intronic
1166485413 19:43207292-43207314 TGGGTTCCGCTGAGGGAGGTTGG + Intronic
1166492564 19:43271212-43271234 TGGGTTCCGCTGAGGGAGGTTGG + Intergenic
1166706227 19:44909341-44909363 TAGGGTCCACCCCAGGAGGACGG - Exonic
1166998744 19:46732571-46732593 TGTGCTCCTCTGCAGGGGGTGGG - Intronic
1168140798 19:54385481-54385503 TGTGGTGCAAAGCAGGAGGTCGG - Intergenic
1168157543 19:54484584-54484606 TGTGGTGCAAAGCAGGAGGTCGG + Intergenic
1168327321 19:55544986-55545008 TGGGGTCCACTGAGAGTGGTGGG + Intronic
925345356 2:3168399-3168421 AGGGCTGAACTGCAGGAGGTGGG + Intergenic
925391790 2:3500296-3500318 TGGGGTTCACTGGAGGCGATTGG - Intronic
926107831 2:10163378-10163400 TGGTGCCCCCTGCAGGTGGTGGG - Intronic
926241572 2:11092937-11092959 CGGGCTCCACTGCACGAGGAGGG - Intergenic
927203544 2:20593039-20593061 TGGGGTAGACAGCGGGAGGTTGG - Intronic
927929343 2:27034143-27034165 TAGGTTCCACAGCAGGGGGTGGG - Exonic
928178765 2:29053083-29053105 TGGGCTCCCCTGCAAGAGCTGGG - Exonic
928865491 2:35912919-35912941 TGAGTTCCAATGCAGCAGGTGGG + Intergenic
932731243 2:74223405-74223427 TGGGGTCCACTGAAGGGGAATGG + Intronic
933276973 2:80294378-80294400 TGGAGTCAATGGCAGGAGGTGGG + Intronic
933900213 2:86844290-86844312 TGGGGTCGAGGGCAGCAGGTGGG + Intronic
934569896 2:95362746-95362768 TGGGCTGCACAGCAGGAGGTGGG - Intronic
934920677 2:98342779-98342801 TGGGCGCCATAGCAGGAGGTGGG - Intronic
936463072 2:112725824-112725846 TGGGGTCAGGTGCAGGAGGAAGG - Intronic
937858310 2:126688713-126688735 AGGGGTCCACAGCAGGAAGCAGG - Intronic
937872909 2:126798687-126798709 TGGGGACCCCTGCAGGAGCAGGG - Intergenic
938777046 2:134551058-134551080 TGGGGTCCAGGGCTGGGGGTGGG + Intronic
938953625 2:136279284-136279306 TGGGGTTCACTGCAGGAAAGGGG - Intergenic
939258618 2:139778054-139778076 TGGTGTGCAGTGAAGGAGGTGGG + Intergenic
940120851 2:150264080-150264102 TTGGCTTCACTGGAGGAGGTAGG + Intergenic
941526012 2:166608231-166608253 TGCTGTACACTGCAGGAGATAGG - Intergenic
942531068 2:176911057-176911079 GGGGGACCCCTCCAGGAGGTGGG - Intergenic
942613048 2:177761998-177762020 TAGGGTCAACAGCAGGAGGCGGG + Intronic
943773056 2:191739796-191739818 TGGAGGCTACTGCAGGAGATGGG + Intergenic
944681053 2:202077086-202077108 TGGGGTCACCTGGAGGAGCTGGG - Intronic
945946995 2:216004017-216004039 TGGGGACCACTGCAGGACTTTGG - Intronic
946389663 2:219407949-219407971 TGGAGTCCACTGCACAAGGGAGG - Intergenic
947618365 2:231573413-231573435 TGGGGGCGACTGCAGGACCTGGG - Intergenic
948403661 2:237702039-237702061 TGGGCTCCACAGCAGGCTGTGGG + Intronic
948554394 2:238797434-238797456 TGGGGTCCACAGGAGGAGGACGG + Intergenic
948611918 2:239175378-239175400 TGGGCTCCTCTGCACGAGGACGG - Intronic
1169620844 20:7504901-7504923 TGGAGCCCAGTGCAGGAGGCTGG + Intergenic
1170092851 20:12610723-12610745 AGAGGGACACTGCAGGAGGTAGG + Intergenic
1173349243 20:42229962-42229984 TGGGGTTCACTGCATGTGTTAGG + Intronic
1173554256 20:43954418-43954440 CAGAGTCCACTGCAGGAGGCAGG - Intronic
1173819452 20:46011129-46011151 TTGGAACCACTGCAGGAGGAGGG - Exonic
1175196977 20:57250994-57251016 TGGGGTCCAGAGCAGGCAGTGGG - Intronic
1175329112 20:58150532-58150554 TGGGGGCCACTGGGGGAGGCTGG + Intergenic
1176443518 21:6799295-6799317 TGGGGTCCCCTGCATTGGGTGGG - Intergenic
1176821687 21:13664338-13664360 TGGGGTCCCCTGCATTGGGTGGG - Intergenic
1177538709 21:22463795-22463817 TGGGTGGCACAGCAGGAGGTGGG - Intergenic
1178297350 21:31421408-31421430 TGGGCCACACAGCAGGAGGTGGG + Intronic
1179577402 21:42316732-42316754 GCCAGTCCACTGCAGGAGGTTGG - Intergenic
1180148377 21:45934720-45934742 TGCTGTCCCCTGCAGGAGGCCGG + Intronic
1180710016 22:17833123-17833145 TGGGGTACACTGCAGCAGGAGGG - Intronic
1181021876 22:20107864-20107886 TGGCTTACACTGCAGGATGTTGG - Intronic
1181107374 22:20583099-20583121 TGGGGTTCACTGCAGGACACAGG - Exonic
1181428870 22:22864696-22864718 TGAACTCCACTGTAGGAGGTGGG - Intronic
1181786868 22:25233481-25233503 GGGGCTGCACAGCAGGAGGTGGG + Intergenic
1181818918 22:25460438-25460460 GGGGCTCCACAGCAGGAGGTGGG + Intergenic
1183344011 22:37296862-37296884 TGTGTTCCACTGCTGGAAGTTGG - Intronic
1183409291 22:37645512-37645534 TGGGGTCCCCTGGGGCAGGTGGG + Intronic
1183934215 22:41252946-41252968 TGGAGACGTCTGCAGGAGGTGGG + Exonic
1184438166 22:44492934-44492956 TAGGGTAGACTCCAGGAGGTGGG - Exonic
1184646578 22:45898598-45898620 GGGTGGCCCCTGCAGGAGGTAGG - Intergenic
1185156050 22:49194150-49194172 TGGGATCCCCCGGAGGAGGTGGG - Intergenic
1185176271 22:49328746-49328768 TGAGGTGCACTGCAGGAGGGCGG + Intergenic
1185237121 22:49720539-49720561 AGGGGTCCAGCCCAGGAGGTGGG - Intergenic
950259032 3:11530615-11530637 TGGGGGTCACTGCTGGAGGGTGG - Intronic
952489683 3:33855958-33855980 TGGGCTGCACAGTAGGAGGTGGG + Intronic
952624678 3:35390402-35390424 TAGGTGCCACTGCAGGAGCTGGG + Intergenic
953403398 3:42646891-42646913 TGGGGTCCCCTGGAGCAGGCAGG + Exonic
953578288 3:44130484-44130506 TGAGCTCAACTGCAGGTGGTGGG + Intergenic
953797110 3:45994579-45994601 AGGGGTCCACTTCAGAAGGTGGG + Intronic
954249839 3:49358841-49358863 TGGGCTCCACTTAAGGAGGCTGG - Intergenic
955047834 3:55376597-55376619 TGGGCTGCACAGCAGGAGATGGG + Intergenic
955968367 3:64412284-64412306 TGGGATCTAATGCAGGAGGAAGG - Intronic
956372707 3:68581245-68581267 TGGGGTGCAGTGCAGGGGGAGGG - Intergenic
958768909 3:98402845-98402867 TTGGATCCACTGCAGTTGGTGGG - Intergenic
958964424 3:100542872-100542894 TGGGGACCACTAGAGGAGGAAGG + Intronic
959025241 3:101233370-101233392 GGAGGTCAACTGCAGCAGGTTGG - Intronic
960699188 3:120424420-120424442 TGGGGCCGACTCCAGGAGATGGG + Intronic
961365629 3:126397767-126397789 TGGGGTCAGCTGCAGGAGCTGGG + Intronic
961391578 3:126555445-126555467 TGGGCCGCACAGCAGGAGGTGGG + Intronic
961934658 3:130570573-130570595 GGGGGCCCACTGCAGGGAGTGGG - Intronic
962110748 3:132444061-132444083 TGGGCCCCACAGCAGGAGGTAGG + Intronic
964498257 3:157318500-157318522 TGGGGGGCAGAGCAGGAGGTGGG + Intronic
964805215 3:160602172-160602194 TGAGGTTCACTGAAGGAGGAGGG - Intergenic
965197835 3:165623037-165623059 TGGGGACCACTGGAGGAGGGTGG - Intergenic
968894363 4:3390087-3390109 AGGGGTCCAGTGCAGGGGCTGGG - Intronic
969707539 4:8820109-8820131 TGGGGTGGAGTGGAGGAGGTGGG + Intergenic
970647732 4:18142058-18142080 TAGGGAGCACTGAAGGAGGTTGG + Intergenic
970929810 4:21496616-21496638 TGGGGACCCCTGCTGTAGGTAGG - Intronic
972241562 4:37198818-37198840 TGGGGCCCACTGGAGGATGGAGG - Intergenic
972344768 4:38183353-38183375 TGGGGTCCACTTCAGCAGTGTGG + Intergenic
972351089 4:38236712-38236734 TAGGGAGCACTGTAGGAGGTGGG - Intergenic
973005109 4:44996014-44996036 AGGGGTCCTCTGCAGAAGGATGG - Intergenic
973711231 4:53632152-53632174 TGAGGTCCACTGCCTGAGGCTGG + Intronic
975489552 4:74973749-74973771 TGGGTTCCTCTGCAGGAACTTGG - Intronic
976707652 4:88035802-88035824 TGGTGTGCACAGCAGGAGGGTGG + Intronic
976993172 4:91395531-91395553 TGGTGTCAACTGAAGGATGTGGG + Intronic
978347229 4:107784438-107784460 TGGATTGCACAGCAGGAGGTAGG + Intergenic
979045054 4:115852217-115852239 TTGGGTCCACTGCAGCTAGTTGG - Intergenic
979093504 4:116517105-116517127 TGGGGGCTACTGCAGGAAGTGGG + Intergenic
979636612 4:122962190-122962212 TGGGCTTCACAGCAGGAGGTGGG - Intronic
980309091 4:131102466-131102488 AGGGGGCCACGGCAGGAGGGAGG + Intergenic
980878927 4:138689783-138689805 TGGGGACCCCTGCAGGAGAGAGG + Intergenic
981106894 4:140891761-140891783 TGGGCCACACAGCAGGAGGTGGG + Intronic
981674233 4:147322809-147322831 TGGGGACAACTACAGGAGGGAGG + Intergenic
983468255 4:168122833-168122855 TGGGCTCCAGTGTTGGAGGTGGG - Intronic
985706859 5:1406412-1406434 TGGCCTCCTCTGCAGGAGGCTGG - Intronic
985926379 5:3022848-3022870 TGTGGGCCACAGCAGGAGGCCGG + Intergenic
986295289 5:6432369-6432391 TGGGGAGCCCTGCAGGAGGGAGG + Intergenic
987872100 5:23632926-23632948 TGGTGTCCAGTGTTGGAGGTGGG + Intergenic
990667342 5:58088115-58088137 TGGTTTCCACTGCAGGAAGTGGG + Intergenic
990671119 5:58130971-58130993 TGGCTTCCACTGCAGGGAGTAGG - Intergenic
995100989 5:108305310-108305332 TGGGGCCCACTGGAGGTGGGTGG + Intronic
995512226 5:112921475-112921497 CGGGGCCCCCTGCGGGAGGTAGG - Intronic
998129868 5:139646320-139646342 TGGGGTCCATGGCAGAGGGTGGG - Intergenic
998460323 5:142305178-142305200 TGGGGTGCAGTGGAGGGGGTAGG - Intergenic
999056380 5:148582464-148582486 TGGGGACCACTAGAGGAGGGAGG - Intronic
999348232 5:150843387-150843409 TGGTTTCCTCTGCATGAGGTTGG - Intergenic
1003002790 6:2351622-2351644 TGGTGACCACTGGAGGAGGCAGG + Intergenic
1003164315 6:3663125-3663147 AAGGATCCACTGCAGGTGGTTGG - Intergenic
1003332073 6:5137454-5137476 TGGGGCCAACTCCAGGAGCTTGG - Intronic
1004336769 6:14771230-14771252 TAGGTTCCACTGCAGCATGTGGG - Intergenic
1004594864 6:17089887-17089909 TGGGGGCAAGGGCAGGAGGTGGG - Intergenic
1004879804 6:19996275-19996297 GTGGGTCCCCTGCAGGAGGCTGG + Intergenic
1006923885 6:37643729-37643751 TGGGGTCCACAGGAGGCGATGGG - Intronic
1007348084 6:41248144-41248166 TGGGTTCCACTGGAGGATCTGGG + Intergenic
1007444310 6:41894052-41894074 TGGGGTAGACTGCAGGGGGGTGG - Exonic
1007845119 6:44747979-44748001 TGGGGTCCACAGAAGCAGGCAGG - Intergenic
1008362776 6:50641444-50641466 TTGTGTCCACTGCTGTAGGTGGG - Intergenic
1009445130 6:63733442-63733464 TGGGGTCTACTAGAGGGGGTAGG - Intronic
1009640588 6:66330828-66330850 TGGGGCCTACTGGAGGAGGAGGG - Intergenic
1015425781 6:133065356-133065378 TGGGGTCCAGTGCTAGAAGTGGG - Intergenic
1015480969 6:133709022-133709044 TGGGGTCCACTTGAGGATGGAGG - Intergenic
1018901132 6:168052337-168052359 TGGGGGCCTCTGCAGGAGGTGGG - Intergenic
1019143200 6:169961198-169961220 TGGGTTCCCCTGGAGGATGTGGG + Intergenic
1019566024 7:1679462-1679484 TGGGGTCCCCTGCAGGTTGCTGG + Intergenic
1023024482 7:36038402-36038424 CTGGGTCCACTGCTGGAGGCAGG - Intergenic
1024207065 7:47172936-47172958 TGGCCTCCACTCCAGGGGGTAGG + Intergenic
1024207097 7:47173148-47173170 TGGCCTCCACTCCAGGGGGTAGG + Intergenic
1024207128 7:47173360-47173382 TGGCCTCCACTTCAGGGGGTAGG + Intergenic
1024353884 7:48395007-48395029 TGGGGTTGACTGCAGTGGGTGGG + Intronic
1024477840 7:49832694-49832716 TGGGGCCTAGTGCAGGAGGCTGG + Intronic
1026834289 7:73627759-73627781 TGGGGTGCTGTGGAGGAGGTTGG + Intergenic
1029159454 7:98541273-98541295 GGGAGTCCACTGCGGGAGGGAGG + Intergenic
1030788613 7:113695039-113695061 TGGGGTCCCTGGCAGCAGGTGGG + Intergenic
1032496746 7:132368498-132368520 TGGGGACCAGAGGAGGAGGTGGG + Intronic
1033032023 7:137836528-137836550 TGGGGTCCAGTGAAGAAGCTAGG - Intronic
1037333232 8:17765257-17765279 AGGGCTGCACAGCAGGAGGTAGG - Intronic
1037564750 8:20108287-20108309 TGGGGTCCAGGGCAGGAAGAGGG + Intergenic
1037690374 8:21176836-21176858 TGGGCTGCACAGCAGGAGGTGGG - Intergenic
1037690385 8:21176884-21176906 TGGGCTCCACAGCAGGAGGTGGG - Intergenic
1037780580 8:21865728-21865750 TGAGGCCCAGTGCAGGAGGCAGG + Intergenic
1038249207 8:25887231-25887253 TGGGGTTGGCAGCAGGAGGTGGG - Intronic
1039194771 8:35018848-35018870 TGGGGTCCACTGGGGGATGAAGG - Intergenic
1039469306 8:37803572-37803594 TGGGGGCCCCTGGAGGAGGGAGG - Intronic
1040574194 8:48636552-48636574 TGGGGCCCAGTGGAGGAGTTTGG + Intergenic
1041382225 8:57261675-57261697 TGGGGGCTACTGGAGGAGGTGGG + Intergenic
1044662263 8:94603090-94603112 TGGGGTGCAGTGCATGAGCTGGG + Intergenic
1047301613 8:123618319-123618341 TGGGCGGCACAGCAGGAGGTGGG + Intergenic
1047418672 8:124687301-124687323 CCTGGACCACTGCAGGAGGTTGG + Intronic
1047524258 8:125618998-125619020 TGGGGACTATTGCAGGGGGTGGG + Intergenic
1048293844 8:133200094-133200116 AGGGATCCAGTGCAGGAGGAGGG + Intronic
1048917660 8:139200196-139200218 TGGGAAACATTGCAGGAGGTGGG + Intergenic
1049550218 8:143254080-143254102 TGGGTCACACAGCAGGAGGTGGG - Intronic
1053352934 9:37425142-37425164 AGGGGTTCACAGCAGGAGGGAGG - Intronic
1055405395 9:75968615-75968637 TGAAGTCCACTGCAAGAGCTTGG + Intronic
1057186992 9:93062559-93062581 TGGGGTCCTCTGCAGGGGTGAGG + Intronic
1057251573 9:93507594-93507616 TGGGGCCAGATGCAGGAGGTGGG + Intronic
1057304323 9:93903558-93903580 TGGAGCCCACAGCAGGAGCTGGG + Intergenic
1060135597 9:121150372-121150394 TGGGGGCCCCAGCAGGAGGTGGG - Exonic
1060791236 9:126486945-126486967 TGGGGTCCAGGGCGGGTGGTGGG + Intronic
1061386544 9:130293997-130294019 TGGGGTCCAGTGTAGCAGGCAGG + Intronic
1061547838 9:131315071-131315093 TGTGGCCCACAGCTGGAGGTGGG - Intergenic
1061997199 9:134192574-134192596 TGGGGGACACAGCGGGAGGTGGG + Intergenic
1062078773 9:134607528-134607550 TGGGGTTCGATTCAGGAGGTGGG - Intergenic
1203525682 Un_GL000213v1:85232-85254 TGGGGTCCCCTGCATTGGGTGGG + Intergenic
1186572834 X:10734375-10734397 TGGGGTCCACTTGAGGGGGAAGG + Intronic
1187341529 X:18425661-18425683 TGGGGTCCCCTGCTAGAAGTGGG + Intronic
1187826874 X:23340368-23340390 TGGGCTCCTCTACAGCAGGTGGG - Intronic
1188625251 X:32276429-32276451 TGGGCTGCACTGCTTGAGGTGGG - Intronic
1188982641 X:36740647-36740669 TGGGGTCTACTTCAGGATGGAGG - Intergenic
1191922513 X:66271499-66271521 TTGGGTCCACTGCAGCTTGTTGG - Intergenic
1191967043 X:66770204-66770226 TGGGGAGCTGTGCAGGAGGTGGG - Intergenic
1192154080 X:68730595-68730617 TGAGGCCCACTGGAGGAGTTAGG - Intergenic
1193278504 X:79620460-79620482 TGGGCTGCAGAGCAGGAGGTAGG + Intergenic
1193786259 X:85762897-85762919 TGGGGACCACTAAAGGAGGGAGG - Intergenic
1194077586 X:89415919-89415941 TGGGGTCTACTTGAGGAGGTAGG + Intergenic
1195558074 X:106250153-106250175 TGGGGCCCATTGCAGGAGGCTGG - Intergenic
1196601686 X:117607899-117607921 TGGGGTACACTGAAGTAGGATGG + Intergenic
1197621326 X:128752976-128752998 TGGGGTCTACTTGAGGAGGGAGG - Intergenic
1198087183 X:133292736-133292758 CTGTGCCCACTGCAGGAGGTGGG + Intergenic
1198195313 X:134354792-134354814 TGGGGTCTACTTGAGGAGGGAGG - Intergenic
1199459016 X:148062140-148062162 TGGGGTCCTGAGGAGGAGGTGGG - Intergenic
1199894693 X:152118408-152118430 TGGGGTCCACTACCAGGGGTGGG + Intergenic
1200430235 Y:3071463-3071485 TGGGGTCTACTTGAGGAGGTAGG + Intergenic