ID: 1138423169

View in Genome Browser
Species Human (GRCh38)
Location 16:56912986-56913008
Sequence GTGAGCAAGGCGAGGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 500}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138423163_1138423169 -7 Left 1138423163 16:56912970-56912992 CCACAGGGCATCGGGGGTGAGCA 0: 1
1: 0
2: 0
3: 10
4: 115
Right 1138423169 16:56912986-56913008 GTGAGCAAGGCGAGGGTGGGAGG 0: 1
1: 0
2: 4
3: 36
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138423169 Original CRISPR GTGAGCAAGGCGAGGGTGGG AGG Intronic
900284381 1:1891990-1892012 GTGAAGAAGCCGAGGGTGAGGGG - Intergenic
900358965 1:2278846-2278868 GTGAGCCAGGTGGTGGTGGGGGG + Intronic
900556390 1:3283024-3283046 GTGAGACAGGCGAGGCTGTGAGG + Intronic
900975220 1:6012340-6012362 GTGATGAAGGCGGAGGTGGGTGG + Intronic
900975257 1:6012483-6012505 GTGATGAAGGCGGAGGTGGGTGG + Intronic
901673083 1:10867234-10867256 GTGAGGGAGGCGCGGGCGGGCGG + Intergenic
901826414 1:11864676-11864698 CTAAGCAAGGGGAGGGAGGGAGG - Intergenic
904272099 1:29356812-29356834 GTGCGCAGGGCGAGGGTGGGCGG + Intergenic
904501455 1:30915123-30915145 GAGAGAAAGGGGAGGATGGGAGG + Intergenic
904962791 1:34347842-34347864 GTGGGCAAGGCCATGGGGGGGGG + Intergenic
905312842 1:37062448-37062470 ATGAACCAGGCCAGGGTGGGTGG - Intergenic
905662573 1:39738787-39738809 TGGACCAACGCGAGGGTGGGCGG + Intronic
905794034 1:40805427-40805449 ATGAGCAAGGGGAGAGTGGTGGG - Intronic
906609132 1:47190061-47190083 AGGAGGAAGGCGAGGGAGGGAGG + Intronic
906642526 1:47450006-47450028 GTGAGCGAAGCCAGGGTGGAGGG + Intergenic
908821044 1:68086908-68086930 GTGAGAAAGGGTAGGGTGGCAGG - Intergenic
910892313 1:92030350-92030372 GTGACCGCCGCGAGGGTGGGGGG + Intronic
911013585 1:93307804-93307826 GTGAACAAGGGGAGAGTGGTAGG - Intergenic
912254140 1:108041925-108041947 GTGAGAAAATAGAGGGTGGGAGG + Intergenic
912308513 1:108595569-108595591 GGGAGGAAAGGGAGGGTGGGAGG + Intronic
912516641 1:110220474-110220496 GTGAGCAGAGGGAGGGAGGGAGG - Intronic
914912661 1:151800087-151800109 GTGAGGAAAGTGAAGGTGGGAGG + Intergenic
915169563 1:153968398-153968420 GTGAGGAAGGAGTGGGGGGGCGG + Intronic
915298788 1:154940401-154940423 GAGAGGAAGTGGAGGGTGGGGGG + Intergenic
915413908 1:155725325-155725347 GTGTGGAAGGAGTGGGTGGGGGG - Intronic
916436600 1:164783366-164783388 GTCAGTAAGGTGGGGGTGGGGGG + Intronic
916480843 1:165213026-165213048 GTGAGCAAGGCAAGGCTGGTGGG - Intronic
916757508 1:167787003-167787025 GAGAGCAAGGGAAGGTTGGGTGG - Intronic
917105303 1:171485736-171485758 GTAAGGAAAGCGAGGGTGTGGGG + Intronic
917598365 1:176552328-176552350 GGGAGCAAGGCGAGGGGGAGGGG - Intronic
917716698 1:177745589-177745611 GTGAGGAAAGGGAGGGTGGCTGG - Intergenic
919693071 1:200544735-200544757 GTGAGGAAGGGGAGGGAGGGAGG + Intergenic
919728043 1:200896340-200896362 GGGAGGATGGCTAGGGTGGGTGG + Intronic
920434382 1:205938700-205938722 GAGAGGAAGGAGAGGGTTGGAGG - Intronic
920930510 1:210383469-210383491 GGGAGCAGGGCCAGGGTGGGAGG + Intronic
921167334 1:212516541-212516563 GTGAGCCAGGTGAGGACGGGTGG + Intergenic
922037878 1:221866948-221866970 GTGAGCAAGGAGAGTTTTGGAGG - Intergenic
922598594 1:226833040-226833062 AAGAGCAAGGTGAGGCTGGGTGG + Intergenic
922722624 1:227906460-227906482 GGGAGGAGGGAGAGGGTGGGAGG - Intergenic
923219536 1:231880741-231880763 GAGAGCAAGGCAAGGTGGGGGGG + Intronic
923499654 1:234554250-234554272 GTCAGCAAGGCAAGGATGCGAGG - Intergenic
924013519 1:239693699-239693721 GGGGGCAAGGTGAGGGTGGTAGG + Intronic
924768967 1:247062601-247062623 GTGAGCAGGGTGAGGGTTGGAGG - Intronic
1064960472 10:20958318-20958340 GGGGGCAAGGAGAGGGTGGATGG + Intronic
1065504325 10:26414301-26414323 ATGAAGAAGGAGAGGGTGGGAGG + Intergenic
1069981462 10:72255543-72255565 GTGAGCAGTGCCAGGGAGGGAGG - Intergenic
1070112529 10:73498881-73498903 ATGAACAATGGGAGGGTGGGAGG + Exonic
1070342509 10:75510791-75510813 ATGAGCAAGCCCAGGGAGGGTGG + Intronic
1070814682 10:79315266-79315288 GGGAGCCAGGCCAGGGTGTGAGG + Exonic
1070922126 10:80194628-80194650 GTGAGGTAGACGAGGCTGGGAGG - Intronic
1070924334 10:80208122-80208144 GTGAGAAAGCCGAGGCTCGGAGG - Intergenic
1072872215 10:99132588-99132610 GAGAGCAAGACGAAGGAGGGTGG + Intronic
1073094118 10:100969592-100969614 GTGAGCAAGGCGAGGAGTGCGGG + Intronic
1073104955 10:101027257-101027279 GTGAGGGAGGGGAGGGTGGAGGG - Intronic
1074109129 10:110410199-110410221 GTGAGGTAGGGGTGGGTGGGAGG + Intergenic
1074824737 10:117206613-117206635 GGGAGCAAGGGGAGGCCGGGAGG - Intronic
1074958495 10:118416474-118416496 GTGAACTAGTCCAGGGTGGGAGG - Intergenic
1075469241 10:122675833-122675855 GGGAGCACTGAGAGGGTGGGAGG - Intergenic
1075654916 10:124154932-124154954 GTGAGCATGGGGTGAGTGGGGGG - Intergenic
1076296716 10:129391533-129391555 GTGAGAACGGGCAGGGTGGGTGG + Intergenic
1076530523 10:131141592-131141614 GGGAGCAAGGGAAGGGAGGGAGG - Intronic
1076820140 10:132934254-132934276 GTGGGCACGGGGTGGGTGGGGGG - Intronic
1076872300 10:133200023-133200045 GTGAGCAAGGCAATGTGGGGTGG - Intronic
1076888257 10:133272326-133272348 GAGAGCAGGGCTGGGGTGGGAGG - Intronic
1077016388 11:400770-400792 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016395 11:400785-400807 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016415 11:400830-400852 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016434 11:400876-400898 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016441 11:400891-400913 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016455 11:400922-400944 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016475 11:400968-400990 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016507 11:401046-401068 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016746 11:401664-401686 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016783 11:401743-401765 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077016790 11:401758-401780 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077017224 11:402700-402722 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077017279 11:402816-402838 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077017286 11:402831-402853 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077017313 11:402893-402915 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077017339 11:402947-402969 GTGAGCGGGGCGGGGGTGAGCGG - Intronic
1077194473 11:1272371-1272393 GTGTGCAGGGCGGGGGCGGGGGG - Intergenic
1077360285 11:2137778-2137800 GAGAGGAAGACGGGGGTGGGCGG - Intronic
1077466374 11:2735543-2735565 GTGAGGAGGGAGAGGGTGGTGGG - Intronic
1077724693 11:4662274-4662296 GAGAGGAAGGAGAGGGAGGGAGG - Intergenic
1079233920 11:18673938-18673960 TTGAGCAACGCAAGGGTGAGGGG - Intergenic
1079364761 11:19799565-19799587 GGGGGCAGGGGGAGGGTGGGTGG + Intronic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1080941777 11:36926731-36926753 CTGAGCTAGGCCAGGGTGGACGG + Intergenic
1080972823 11:37300028-37300050 GGGAGCAGTGCGATGGTGGGAGG - Intergenic
1081728972 11:45355264-45355286 CTGAGAAAGGAGAGGGAGGGGGG + Intergenic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1083271110 11:61573060-61573082 GTGGGCATGGAGAGGGGGGGTGG + Intronic
1083581367 11:63827433-63827455 GGGAGCAGGGGGAGGGTGGGAGG - Exonic
1083741101 11:64712215-64712237 GTGTGGAAGGCCAGTGTGGGCGG - Intronic
1084149689 11:67282373-67282395 GTGGGGAGGGAGAGGGTGGGGGG - Intronic
1084793247 11:71488385-71488407 CTGCGGGAGGCGAGGGTGGGTGG + Intronic
1086167522 11:83797014-83797036 GTTAGCAAGGTGAGGATGGGTGG + Intronic
1086306425 11:85485564-85485586 GTGAGTAAGGAGAGGGAAGGGGG + Intronic
1086426472 11:86688723-86688745 GTGAACAAGGAGAGGGAGAGAGG + Intergenic
1089262593 11:117232778-117232800 GTGTGCGGGGCGAGCGTGGGTGG + Intronic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089560285 11:119340188-119340210 GAGAGAAAGGCGAGGGCGGGAGG - Exonic
1089678646 11:120107362-120107384 GGGAGCCAGGTGAGGGAGGGAGG - Intergenic
1089748488 11:120633713-120633735 CTGAGCAGGGAGAGGCTGGGAGG + Intronic
1089769719 11:120794278-120794300 GAGAGCCAGGCGATGGTTGGAGG + Intronic
1091657191 12:2354236-2354258 GAGAGCCAGGTGAGGGTGCGAGG - Intronic
1091846536 12:3660338-3660360 GTGAGACAGGCGAGGCTGGTTGG + Intronic
1091883744 12:4001150-4001172 GAGTGAAAGGAGAGGGTGGGTGG - Intergenic
1092171580 12:6376656-6376678 GTGAGCAAGGAGAGAGAGGAGGG + Intronic
1094185726 12:27640586-27640608 GTGGGCAACCCGGGGGTGGGGGG - Intronic
1096058357 12:48674680-48674702 GTGCACAAGGCCAAGGTGGGTGG + Intronic
1096081593 12:48836867-48836889 GTGATCAAGGCTAGGGTGGCTGG - Intronic
1096109490 12:49020574-49020596 GTCAGCGCGGGGAGGGTGGGGGG - Exonic
1096975132 12:55695487-55695509 GAGAGCAGGGTGGGGGTGGGAGG - Intronic
1098342934 12:69470488-69470510 GGGAGCAGGGCGCGGGTCGGCGG - Exonic
1100039780 12:90301371-90301393 TTGAGAAAGTGGAGGGTGGGAGG - Intergenic
1100913621 12:99392828-99392850 GTGAGGGAGGGTAGGGTGGGAGG - Intronic
1101443283 12:104719423-104719445 GTGGGCAAGGGGAGCGTGGGTGG - Intronic
1101604120 12:106234942-106234964 GAGAGCAAGGGGAGGGCAGGTGG - Intergenic
1102492373 12:113297066-113297088 GTGAGCAGAGCCAGGGAGGGTGG - Exonic
1102753880 12:115320991-115321013 GTGGGGAAGGCAAAGGTGGGAGG + Intergenic
1103329120 12:120141609-120141631 CTGAGCAAGGCCAGTGTGGCTGG - Intronic
1103953893 12:124566446-124566468 AGGAGCAAGCCGAGGGCGGGAGG - Intronic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1105215215 13:18280257-18280279 GAGAGAAGGGTGAGGGTGGGAGG - Intergenic
1105885548 13:24638267-24638289 GAGAGAAAGGCGAGGCTGGCGGG - Intergenic
1108115445 13:47122465-47122487 GTGGGCAAGCCTAAGGTGGGAGG + Intergenic
1109161918 13:58986033-58986055 GTGATGAAGGGCAGGGTGGGTGG - Intergenic
1113104434 13:106757803-106757825 GGGAGGGAGGTGAGGGTGGGTGG + Intergenic
1113681454 13:112247780-112247802 CTGACCCAGGCGAGGGTTGGGGG - Intergenic
1114656619 14:24319553-24319575 GTCAGGAAGGAGAGGGTTGGTGG + Intronic
1114669454 14:24401113-24401135 TTGAGCAAGGAGGGGGTGGCGGG - Intronic
1114866030 14:26597225-26597247 GGGAGGACGGCGAGGGAGGGAGG + Intronic
1115199836 14:30841091-30841113 GTGAGCAACGGGAAGGTTGGTGG - Intergenic
1117559582 14:56923067-56923089 GTGTGCAATGCCAGGCTGGGAGG + Intergenic
1119172900 14:72547993-72548015 GTGAGCAGGGGGAGGGAGGCAGG - Intronic
1119488826 14:75012215-75012237 GCCAGCAAGGCAGGGGTGGGAGG - Exonic
1120127017 14:80756379-80756401 GTGAGTAAGACATGGGTGGGAGG - Intronic
1121490569 14:94356090-94356112 GGGAGACAGGGGAGGGTGGGTGG - Intergenic
1121571844 14:94952109-94952131 CTGAGCAAGGCCAGGGCGGAGGG + Intergenic
1121688589 14:95858104-95858126 GAGAGCAGGGAGAAGGTGGGTGG + Intergenic
1121744116 14:96274583-96274605 GTGAGCAAAGGGAGGCTTGGAGG + Intergenic
1122129159 14:99595109-99595131 GTGAGCAAGGCCAGGGCCGGTGG - Intronic
1122130484 14:99602350-99602372 GTGACCAGGGTGTGGGTGGGAGG - Intronic
1122662762 14:103309093-103309115 CTGGGCAAAGCGAGGGTGGCTGG + Intergenic
1122809564 14:104281336-104281358 GTGAGCAGGGGGAGGGCGGCAGG - Intergenic
1122882269 14:104695470-104695492 GTGTGCAGGGCCTGGGTGGGTGG - Intronic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122971447 14:105153881-105153903 CTGGGCCAGGCGAGGGTGAGTGG + Intronic
1123058607 14:105584245-105584267 GTGAGGAAGGTGATGGTGGTGGG + Intergenic
1123082938 14:105704479-105704501 GTGAGGAAGGTGATGGTGGTGGG + Intergenic
1123133673 14:106008121-106008143 GTGTGCAATGAGAGGGTGTGGGG + Intergenic
1124106167 15:26740137-26740159 GTGAGGATGGGGATGGTGGGGGG - Intronic
1124645739 15:31436555-31436577 ATGAGTGAGGCAAGGGTGGGTGG + Intergenic
1124957771 15:34370909-34370931 GTGAGGAAGGAGAGGAGGGGAGG - Intergenic
1125577750 15:40766886-40766908 GGGAGCAAGCCCAGGGAGGGCGG + Exonic
1127771992 15:62239820-62239842 GGGTGCAAGGCTGGGGTGGGCGG + Intergenic
1128029588 15:64468193-64468215 GAGAGGAAGGGGAGGGAGGGAGG - Intronic
1128755762 15:70182607-70182629 GAGAGAAAGGGGTGGGTGGGTGG + Intergenic
1129503324 15:76060173-76060195 GGGAGCCAGGCGAGGGTGCGTGG + Intronic
1129669078 15:77597171-77597193 CTGAGCAGGGACAGGGTGGGGGG + Intergenic
1129920085 15:79312107-79312129 GTGAGCAGGTCTAGGGTTGGGGG + Intronic
1129925241 15:79358178-79358200 GTGAGCAGAGCCAGGCTGGGAGG + Intronic
1130652478 15:85769911-85769933 GTGAGCAGAGAGTGGGTGGGAGG - Intronic
1130809795 15:87364914-87364936 GTGAGCAATGTGAGGGTTGAGGG + Intergenic
1131605838 15:93901283-93901305 CTCAGCAAAGCCAGGGTGGGTGG - Intergenic
1132070370 15:98771366-98771388 GTGAGGAAGGGGAGAGAGGGTGG - Intronic
1132671390 16:1103495-1103517 GGGAGCACGGCCAGGCTGGGAGG + Intergenic
1132981464 16:2740438-2740460 GTGAGGAAGGTGAGGCTGGAGGG - Intergenic
1133342204 16:5044175-5044197 GTAGGCAAGGCCAGGGTAGGTGG - Exonic
1134563289 16:15229153-15229175 GGGAGAAAGATGAGGGTGGGAGG - Intergenic
1134803562 16:17106733-17106755 GTGAGTAGGGGGAGGATGGGAGG + Exonic
1134923816 16:18140782-18140804 GGGAGAAAGATGAGGGTGGGAGG - Intergenic
1136348860 16:29694501-29694523 GTGAGGAAGGGGGGCGTGGGGGG - Intronic
1138270286 16:55691168-55691190 GAGAGCAAGAAGAGGGAGGGAGG + Intronic
1138423169 16:56912986-56913008 GTGAGCAAGGCGAGGGTGGGAGG + Intronic
1138600597 16:58051814-58051836 GTAAGATAGGGGAGGGTGGGAGG - Intergenic
1139370768 16:66468101-66468123 GTAATCAAGGAGAGCGTGGGTGG - Intronic
1139653431 16:68373897-68373919 GTGAGCGAGGCGAGGGGCAGAGG - Intronic
1139884357 16:70197986-70198008 GTGAGCAAGGCGGGTGTGCAGGG + Intergenic
1140068310 16:71627760-71627782 GTGAGCTAGGGGAGGGTGGGGGG + Intronic
1140250320 16:73289320-73289342 CAGAGCAAGGGCAGGGTGGGGGG + Intergenic
1140295084 16:73702162-73702184 GTGTGAACGGGGAGGGTGGGGGG - Intergenic
1140368161 16:74397510-74397532 GTGAGCAAGGCGGGTGTGCAGGG - Intergenic
1141125260 16:81396602-81396624 GGGAGCAAGGAGAGGGGAGGTGG + Intergenic
1141155991 16:81597579-81597601 GTGAGCGAGGGGAGCGGGGGGGG + Intronic
1141411671 16:83838371-83838393 GGGAGGAAGGGGAGGGAGGGAGG + Intergenic
1142020772 16:87780863-87780885 GGGAGGAAGGCGTGGGTGGAGGG - Intergenic
1142174013 16:88636713-88636735 GTATGCAAGCAGAGGGTGGGTGG + Intergenic
1142277872 16:89132478-89132500 GTGACCATGGAGAGGGCGGGAGG - Intronic
1143178231 17:4968598-4968620 GGGAGCAAGGCGTGGGGAGGAGG + Exonic
1143461659 17:7108207-7108229 GTGAGCAAATCGAGTGTGGCAGG - Intronic
1143635201 17:8160453-8160475 GAAAGGAAGGCCAGGGTGGGAGG + Exonic
1143712517 17:8744348-8744370 GTGAGCAGGGGGAGGGTGACGGG + Intronic
1144183348 17:12772931-12772953 GAGAGAAAGAGGAGGGTGGGTGG + Intergenic
1144461329 17:15460869-15460891 GTGGGGAAGGCGGGGGAGGGAGG - Intronic
1144686914 17:17232174-17232196 GTGAGCCAGGTGACGGTGTGTGG - Intronic
1144824486 17:18098145-18098167 GTCACCAAGCCGAGGGTGAGAGG + Intronic
1145248981 17:21287161-21287183 CTGAGCAAGGCCAGGGGTGGGGG - Intronic
1146166468 17:30593645-30593667 GAGACCAAGGCGGGGGCGGGGGG + Intergenic
1146693250 17:34891036-34891058 TGGAGCAAGGGGAGGGTGGGGGG - Intergenic
1146775367 17:35609716-35609738 CTGAGGAAGGCCAAGGTGGGAGG - Intronic
1146905123 17:36613236-36613258 GTCGGCAAAGCGGGGGTGGGAGG - Intergenic
1147697568 17:42367470-42367492 GTGAGCAAGGGGAGAGTTGTAGG - Intronic
1148102139 17:45098704-45098726 GGGAGCATGGAGAGGGCGGGAGG + Intronic
1148336684 17:46846776-46846798 GTGAGGAAGAAGAGGGAGGGAGG + Intronic
1148700148 17:49582221-49582243 GTGTGCATGGCAAGAGTGGGAGG - Intronic
1149978694 17:61291921-61291943 GTGAGGAGGAAGAGGGTGGGAGG + Intronic
1150004688 17:61462510-61462532 GGGAGCAGGGAGAGGGTAGGGGG + Intronic
1150135371 17:62692462-62692484 GTGGGCAGGGCCAGGGCGGGAGG + Exonic
1151977284 17:77489967-77489989 CTGGGCAAGCCGAGGGCGGGCGG + Intronic
1151999134 17:77634302-77634324 ATGGGCAAGGCGAAGGTTGGAGG + Intergenic
1152331986 17:79678818-79678840 GTGGGCTGGCCGAGGGTGGGAGG - Intergenic
1152424295 17:80210584-80210606 CTGAGCAAAGCGCGGGTCGGTGG + Exonic
1152743820 17:82030277-82030299 GGGAGTGAGGCGAGGGTTGGGGG - Intronic
1152825758 17:82463715-82463737 GTCAGGAAGGAGAGGGTGGAGGG + Intronic
1152936851 17:83143945-83143967 GTGAGGACGTCTAGGGTGGGAGG - Intergenic
1153019565 18:614574-614596 GTGAGAAATGGGAGGGTGAGAGG - Intronic
1153563290 18:6393933-6393955 GTGAGCAAGGGGAGAGCGGAAGG - Intronic
1153661311 18:7328636-7328658 GTGAGGAAGGATAGGGTAGGAGG + Intergenic
1155074355 18:22341874-22341896 ATGAGCCAGATGAGGGTGGGAGG + Intergenic
1157393519 18:47323036-47323058 TTGAGAGAGGGGAGGGTGGGTGG - Intergenic
1159178375 18:64868455-64868477 GTGAGCCTGGTAAGGGTGGGCGG - Intergenic
1160562807 18:79770387-79770409 GTGAGCCAGAAGAGGATGGGGGG + Intergenic
1160724236 19:610589-610611 GGAAGCAAGGCGGGGGTGGCGGG - Intronic
1160810227 19:1010111-1010133 GTCAGCAAGGAGAGGGGGTGGGG - Exonic
1160905864 19:1451530-1451552 GTGCCCAAGGGCAGGGTGGGAGG - Exonic
1161284815 19:3463652-3463674 GTGAGCCGGGCGAGGTGGGGGGG - Intronic
1161345449 19:3766872-3766894 GTGAGGAGGGCGAGAGAGGGAGG + Intronic
1161734117 19:5979913-5979935 GGGAACAAGGGGAGGGAGGGAGG - Intergenic
1161750862 19:6095603-6095625 GTAAACAAGGGGAGGGTGTGTGG + Intronic
1161992198 19:7690356-7690378 GGCAGCATGGCGAGGGTGGGGGG - Intronic
1162127640 19:8507933-8507955 GGGGGCAAGGAGAAGGTGGGAGG + Intergenic
1162327049 19:10005773-10005795 GTGAGCATGGGGAGAGTGGGCGG - Intronic
1162393212 19:10402274-10402296 GTGAGCACTGAGAGGGTGGTGGG + Intronic
1162530160 19:11231292-11231314 GTCAGCTAGGGAAGGGTGGGTGG - Intronic
1163091985 19:15026637-15026659 GACAGCAAGGTGAGGGTGGCAGG - Intergenic
1163348783 19:16762177-16762199 GTGAGCAATGCCAGGCAGGGTGG - Intronic
1163454126 19:17396026-17396048 ATGGGAAAGGCGGGGGTGGGGGG - Intergenic
1163632244 19:18423447-18423469 GGGAGGACGGCGAGGGTTGGAGG + Intronic
1163643268 19:18473859-18473881 AGGAGCAAGGCCTGGGTGGGAGG - Intronic
1164826283 19:31287136-31287158 ATGGGCAAGTCGTGGGTGGGAGG + Intronic
1164901536 19:31930245-31930267 GTAAGTCAGGGGAGGGTGGGGGG + Intergenic
1165793564 19:38506188-38506210 TTGAGCCAGGGGAGGGTGGAGGG + Intronic
1165860740 19:38907924-38907946 GTGAACACAGCGGGGGTGGGTGG + Intronic
1165882566 19:39053974-39053996 GTGAGCAAGGAGGCTGTGGGAGG - Intergenic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166698098 19:44865661-44865683 GTGAGCAGGGTAAGGGCGGGAGG + Intronic
1166782475 19:45349680-45349702 GTGAGCAACGTGAGGGTGGGGGG + Intronic
1166930760 19:46299802-46299824 GTGAGGAAGCAGACGGTGGGGGG + Intronic
1166981674 19:46635184-46635206 GTGACCAGGGCTAGGGTGGGGGG - Intergenic
1167276521 19:48543445-48543467 ATGAGCAAGATGAGGGTGGGAGG + Intergenic
1167339388 19:48905886-48905908 GTGAGCAGGGGCAGGGCGGGAGG + Intronic
1167381748 19:49142314-49142336 GTGGGCAAGGCCAGAGTGGCAGG - Intronic
1167660286 19:50792172-50792194 GTGAGCAGGGCGGCGGTGGGGGG + Intronic
1167707850 19:51092204-51092226 CTTAGCAGGGCGAGGGAGGGAGG - Intergenic
1168274447 19:55269398-55269420 GTGAATGCGGCGAGGGTGGGTGG - Intronic
1168295131 19:55374484-55374506 GGGATCAAGGAGGGGGTGGGGGG - Intergenic
1168377599 19:55893527-55893549 GTGGGTAAGGCTAGGGTGGTGGG - Intronic
1202637199 1_KI270706v1_random:52803-52825 GAGTGAAAGGTGAGGGTGGGGGG - Intergenic
925025730 2:605902-605924 GTGAGCAAGTGGAGGGTGGGCGG - Intergenic
925671369 2:6312998-6313020 ATGAGCAAGGAGATGGTGTGGGG - Intergenic
926118704 2:10229309-10229331 GTGAACAGGGGGAGGGTGGGGGG + Intergenic
926635160 2:15170523-15170545 GTGAGCAGGGAAAGGTTGGGAGG + Intronic
926663984 2:15499608-15499630 ATGAGCAGGTGGAGGGTGGGAGG + Intronic
926685115 2:15692099-15692121 TTGGGTAATGCGAGGGTGGGTGG + Intronic
927751350 2:25673372-25673394 GTGAGCAAGGTGGGGGTCTGCGG - Exonic
928022593 2:27715963-27715985 GTGGGCAGGGGGAGGGAGGGGGG - Intergenic
928437017 2:31261335-31261357 GTGGGCAAGGTGAGGTTGTGGGG - Intronic
929044057 2:37773506-37773528 GGGAGCAAGAGGAGGCTGGGAGG + Intergenic
929070013 2:38020505-38020527 GTGTGCAGGGAGAGGGTGAGAGG + Intronic
929823837 2:45294880-45294902 GAGAGGAAGCCTAGGGTGGGAGG - Intergenic
931884377 2:66599769-66599791 AAGAGCAAGGAGAGGGTGGAAGG - Intergenic
932308924 2:70724473-70724495 GGGAGCAGTGTGAGGGTGGGCGG - Intronic
935135342 2:100295625-100295647 GTGAACAAGGAGGTGGTGGGTGG + Intronic
935316851 2:101843270-101843292 GTGAACAAAGGGAGGGTGGAAGG + Intronic
935738992 2:106130244-106130266 GAGACCATGGCGAGGGAGGGAGG + Intronic
936460783 2:112712617-112712639 GGGAGCAAGGCCAGATTGGGAGG - Intergenic
936572260 2:113627015-113627037 GTGAGCACGTCAGGGGTGGGGGG - Intergenic
936985644 2:118309502-118309524 GAGAGGCAGGCGAGGGAGGGAGG + Intergenic
937988421 2:127649001-127649023 GGGAGGAAGGGGAGGGAGGGAGG + Intronic
938952395 2:136267031-136267053 GTGAGCAGGAGCAGGGTGGGGGG - Intergenic
944002395 2:194855141-194855163 GGCAGCAAGGCTGGGGTGGGGGG + Intergenic
944014624 2:195020271-195020293 TTGAGGATGGTGAGGGTGGGGGG + Intergenic
944805955 2:203281398-203281420 GTAAGGAAGGCTAAGGTGGGAGG + Intronic
944973063 2:205016367-205016389 GTGAAGAAGGCCAGGGTGGCTGG - Intronic
945000327 2:205343673-205343695 GTGAGCCAGGCCAGGGTGACTGG - Intronic
945147772 2:206756511-206756533 GGGAGCAAGGCGAGGGGAGTGGG + Intronic
946358782 2:219206693-219206715 TAGAGCAAGGCGAGGCGGGGCGG + Intronic
946393565 2:219431285-219431307 GGGAGCAAGGGGAGAGTGGAAGG - Intergenic
946832769 2:223742880-223742902 GAGAGCATGGGGAGGATGGGGGG - Intergenic
947232674 2:227903647-227903669 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947232682 2:227903664-227903686 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947232690 2:227903681-227903703 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947767369 2:232646295-232646317 GAGAGCAAGGCCTGGGTGGGGGG - Intronic
947856527 2:233328163-233328185 GTCAGCAAGGCTAAGGTGTGAGG - Intronic
948161317 2:235827277-235827299 GTGAGCAAGGAGAGTCTGCGTGG - Intronic
948227252 2:236320843-236320865 GGGAGGAAGGCGATGGCGGGGGG - Intergenic
948494753 2:238340134-238340156 GGGAGCAGGGCCAGGGTCGGGGG - Intronic
948653446 2:239463054-239463076 GTCAGCCAGGGGAGGGTGGCAGG + Intergenic
948888675 2:240896528-240896550 GTGAGGAAGGGGAGGCAGGGCGG + Intronic
948897587 2:240934520-240934542 GTCAGTGAGGCCAGGGTGGGTGG - Intronic
1169109514 20:3022836-3022858 GTGGGTCAGGTGAGGGTGGGGGG + Intronic
1169207087 20:3746647-3746669 AGGAGAAAGGCGAGGGAGGGAGG + Intronic
1170546300 20:17437987-17438009 GGGAGCACGGTGTGGGTGGGGGG - Intronic
1171103729 20:22411859-22411881 GTGATAAGGGCAAGGGTGGGAGG - Intergenic
1171312015 20:24152157-24152179 GTGAGCCAGGGAAGGGTAGGAGG - Intergenic
1173392299 20:42646129-42646151 TGGAGCAAGGGAAGGGTGGGTGG - Intronic
1173701419 20:45075173-45075195 CTGAGCAAGGCCAGGCTGTGAGG + Exonic
1173838089 20:46138790-46138812 GAGAGCAAGGAGGGAGTGGGAGG + Intergenic
1175725119 20:61312856-61312878 AAGAGCAAGCCGAGGATGGGTGG - Intronic
1175825225 20:61933329-61933351 GGGAAGAAGGCGAGGATGGGAGG - Intronic
1176027529 20:62993557-62993579 GGGAGGCAGGGGAGGGTGGGAGG + Intergenic
1177210293 21:18062450-18062472 TTGAGAGAGGCCAGGGTGGGAGG - Intronic
1178407611 21:32337357-32337379 GTGAGCAGGGGGAGGGAGTGAGG - Intronic
1178453692 21:32727923-32727945 GTGAGCAAGCCGGCGGGGGGCGG - Intronic
1178805382 21:35834784-35834806 GGGAGCCAGGAGAGGGTGGCGGG + Intronic
1179396998 21:41049704-41049726 CTCAGAAAGGAGAGGGTGGGAGG - Intergenic
1179471326 21:41612729-41612751 GTGAGCAAAGCAAGGATTGGAGG + Intergenic
1179913976 21:44464602-44464624 GAGGGCCAGGCGAGGGTGGGAGG - Intergenic
1180068637 21:45425157-45425179 GTGAGGAAGGAGGCGGTGGGTGG - Intronic
1180155860 21:45977239-45977261 GGGAGGAGGGAGAGGGTGGGAGG - Intergenic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186164 21:46140413-46140435 GTGAGCCACGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180687059 22:17677486-17677508 GTGAGGGAGGCCAAGGTGGGCGG + Intronic
1180742147 22:18061244-18061266 ATGTCCAAGGCGACGGTGGGTGG + Intergenic
1180996046 22:19965811-19965833 GTGGGCATTGGGAGGGTGGGAGG + Intronic
1181100559 22:20536188-20536210 ATCAGCAAGCCCAGGGTGGGAGG + Intronic
1181844731 22:25698088-25698110 GGGAGGAAGGAGAGGGAGGGAGG + Intronic
1181999763 22:26910904-26910926 GAGAGAGAGGAGAGGGTGGGAGG - Intergenic
1182480938 22:30608283-30608305 GTGAAGAAGTCGAGGGTTGGAGG + Intronic
1182772293 22:32804287-32804309 CTGTGCAAGGCGAGGGAGGTCGG - Intronic
1183284492 22:36953538-36953560 GGGAGCAGGAGGAGGGTGGGTGG + Intergenic
1183352659 22:37342781-37342803 GGGAGCAAGGTGTGGGTGGGGGG + Intergenic
1183697296 22:39430623-39430645 GTGAGGGAGGTGATGGTGGGAGG - Exonic
1184315939 22:43689305-43689327 GTGAGCCACGCGAGGGAGAGTGG + Intronic
1184437608 22:44488930-44488952 GGGAGAAAGGGGAGGGAGGGAGG + Intergenic
1184478984 22:44736353-44736375 GTGTCCAAGGGGATGGTGGGAGG - Intronic
1184690915 22:46116876-46116898 GTGAGCGGGGCGTAGGTGGGCGG - Intergenic
1184959319 22:47917740-47917762 GGGAGGAAGGAGAGGGAGGGAGG - Intergenic
1184959380 22:47917957-47917979 GGGAGAAAGGAGAGGGAGGGAGG - Intergenic
1185167097 22:49268181-49268203 GAGAGCCAGGCAGGGGTGGGTGG - Intergenic
1185338732 22:50282383-50282405 GTGGTCAGGGCCAGGGTGGGCGG - Intronic
1185339783 22:50286117-50286139 GTGAGCAGGGCTGGGGTGGACGG + Intronic
1185427929 22:50783865-50783887 GTGAGCACGTCAGGGGTGGGGGG + Intergenic
1203296179 22_KI270736v1_random:44902-44924 GGGAGCAAGAGGAGGCTGGGAGG + Intergenic
949359104 3:3213043-3213065 CTCAGGAAGCCGAGGGTGGGAGG - Intergenic
949767455 3:7542932-7542954 GAGGGTATGGCGAGGGTGGGAGG - Intronic
950429030 3:12940456-12940478 GGGAGCAAGCAGAGGGCGGGCGG + Intronic
950522432 3:13505101-13505123 ATGACCAAGGGGAGGGAGGGAGG - Exonic
951330155 3:21357337-21357359 GTGAGCATGGCCAGGCTGGAGGG - Intergenic
953232343 3:41076121-41076143 GGGAACAAGGCAGGGGTGGGAGG + Intergenic
953762636 3:45702490-45702512 CTGAGCAAGGCTGGGGAGGGAGG - Intronic
953958282 3:47247768-47247790 ATGAGAAAGGCGAGGACGGGAGG + Intronic
954155138 3:48681273-48681295 GAGGGCAAGGTGAGGGTGGGCGG - Exonic
954301775 3:49704146-49704168 GGGAGCAAGGCCTGGGCGGGGGG + Intronic
954425958 3:50443259-50443281 GAGAGCAGAGCCAGGGTGGGTGG - Intronic
955018027 3:55090696-55090718 GTAAGCAAGGGGCGGGTGGTTGG - Intergenic
956908734 3:73794949-73794971 GAGAGGCAGGCGAGGGTAGGAGG + Intergenic
956960867 3:74399289-74399311 GTCAGAAAGTGGAGGGTGGGAGG - Intronic
956999502 3:74868923-74868945 GTGAGAAAGTGGAGGATGGGTGG + Intergenic
958054750 3:88394877-88394899 TTGAGAGAGGAGAGGGTGGGAGG + Intergenic
959943255 3:112101798-112101820 CTGAGAAAGGCGTAGGTGGGAGG - Intronic
961524957 3:127490797-127490819 GAGAGGAAGGCAAGGGGGGGTGG - Intergenic
961807239 3:129498240-129498262 GTGACCACGGCAAGGGTGAGAGG - Intronic
961818810 3:129564827-129564849 GTGAGCCAGGCGAGGAGTGGTGG - Intronic
962365944 3:134781503-134781525 GTGAGGAAGGCGGGAGAGGGTGG + Intronic
962884506 3:139611694-139611716 GTGAGCCAGGGCTGGGTGGGGGG + Intronic
962920059 3:139942555-139942577 GTGTGCATGGCAAGGGCGGGAGG + Intronic
964231554 3:154476055-154476077 GTGAGAACGGCGGGGGTGGGGGG + Intergenic
964278763 3:155038369-155038391 GTGAGCAGAGCCAGGGTTGGTGG - Intronic
966919136 3:184601208-184601230 GCGAGTGAGGCGGGGGTGGGGGG - Intronic
967007650 3:185399616-185399638 GAGAGAAAGGCGGGGGGGGGGGG + Intronic
967100302 3:186210509-186210531 GTTACCAACGCCAGGGTGGGAGG - Intronic
968870424 4:3239239-3239261 GTGAGGGGAGCGAGGGTGGGCGG + Intronic
968981012 4:3849357-3849379 GAGGACAAGGCTAGGGTGGGAGG - Intergenic
969239333 4:5888651-5888673 GTGCGCAGGGCGGGGGTCGGCGG - Intronic
969501124 4:7553808-7553830 GAGAGGAAGGTGAAGGTGGGAGG + Intronic
969561334 4:7950249-7950271 GTGAGCAAGGGGATGGATGGTGG - Intergenic
969629157 4:8325466-8325488 GTGAGCTTGCCAAGGGTGGGCGG - Intergenic
970193103 4:13533510-13533532 GTGGCCGAGGCGTGGGTGGGGGG - Intergenic
970235929 4:13957895-13957917 GTGACCAGGGCGTGGGTGTGGGG + Intergenic
970686834 4:18578010-18578032 GTAATGAAGGCGGGGGTGGGGGG - Intergenic
971082042 4:23224255-23224277 GTGAGGTGGGCAAGGGTGGGGGG + Intergenic
973393605 4:49576262-49576284 GAGTGAAAGGTGAGGGTGGGGGG + Intergenic
973816410 4:54623405-54623427 GTGAGGAAGGCGAGAGTGGAAGG - Intergenic
973982491 4:56317758-56317780 GTGAGCTGGGTGAGGGTAGGGGG - Intronic
974586303 4:63883084-63883106 GTGAGGAAGGGGATGGGGGGTGG - Intergenic
974895821 4:67937320-67937342 GTGAGGAAGGCAAAGGTAGGAGG - Intronic
975391471 4:73822897-73822919 GGGAGAAAGGGGAGGGAGGGAGG + Intergenic
975618816 4:76275221-76275243 ATGAGCAAGGCTAAGGTGGCAGG - Intronic
977509530 4:97945207-97945229 CTTAGAAAGGGGAGGGTGGGAGG - Intronic
978052280 4:104216486-104216508 GTGAGCAAGTGGGTGGTGGGGGG - Intergenic
980749745 4:137072723-137072745 GTGAGAAAGACGGGGGTGCGGGG - Intergenic
982276312 4:153640022-153640044 GTGTCTAAAGCGAGGGTGGGAGG + Intergenic
983455511 4:167958271-167958293 GAGAGTGAGGCGAGGGTAGGGGG + Intergenic
983467468 4:168112775-168112797 TTTTGCAAGGCCAGGGTGGGCGG + Intronic
985544738 5:503969-503991 GTGAGGAAGGTGGGGGTGGGTGG - Intronic
985574195 5:665947-665969 GTGAGCAGGGCGGGGATGGAAGG - Intronic
985808871 5:2068672-2068694 GTGAGTCAGTGGAGGGTGGGAGG + Intergenic
986317947 5:6603739-6603761 GTCAGCAGGTCGGGGGTGGGTGG - Intronic
990414199 5:55570726-55570748 GTGAGGGAGGCTAGGGTGCGTGG - Intergenic
990739555 5:58898230-58898252 GTGAACAAGCCAAGGGTTGGCGG - Intergenic
992769597 5:80035193-80035215 GGGAGAAAGGCGCGGGTGTGAGG - Intronic
993001820 5:82388469-82388491 GGGTGCAAGGAGAGGGTTGGCGG - Intergenic
995551413 5:113285495-113285517 GTGAGCAGGGGGAGAGTGGAAGG - Intronic
997593798 5:135092695-135092717 GTGAGGAAGGAGAGGGTGTATGG - Intronic
998400368 5:141845707-141845729 GTGTGAAGGGGGAGGGTGGGTGG - Intergenic
999090092 5:148928442-148928464 TTGGACAAGGCTAGGGTGGGTGG - Intronic
999458620 5:151738889-151738911 GGGGGCAAGGAGAGGGTGGGAGG + Intergenic
1000145401 5:158448785-158448807 ATGAACAAGGAGAGGGTGGTTGG - Intergenic
1001118756 5:168961426-168961448 ATGAGCAGGGTGAGAGTGGGAGG + Intronic
1001140172 5:169137693-169137715 GGGAGCAAGGCAAGGATGTGAGG - Intronic
1002273639 5:178089359-178089381 GTGAGAGAGGTGAGGGTGGTGGG - Intergenic
1003042366 6:2700177-2700199 GTGAGCAATGCGAGTTTGAGAGG - Intronic
1003087708 6:3074194-3074216 GTGAGCACGGTGAGGCTGAGTGG - Intronic
1003115939 6:3284013-3284035 GGAAGCCAGGCCAGGGTGGGAGG + Intronic
1003235787 6:4294446-4294468 GGGGGCAAGGTGAGGGAGGGAGG - Intergenic
1003611310 6:7617234-7617256 GTGAGGGAGGCCACGGTGGGAGG - Intergenic
1003665931 6:8111421-8111443 GTGGGCAGGGCAAGGGTGGATGG - Intergenic
1004131201 6:12921620-12921642 GGGAGGAAGGAGAGGGAGGGAGG + Intronic
1004447058 6:15710145-15710167 GTGAGGGAGGGGAGGGAGGGAGG - Intergenic
1005262106 6:24072199-24072221 ATGAGCAGGGCCAGTGTGGGTGG - Intergenic
1006114018 6:31765832-31765854 GTGGGCAAGGCCGGGGAGGGTGG - Intronic
1006217741 6:32459797-32459819 GTGAGCAAGGCGGGTGGGGGAGG - Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1006604005 6:35243547-35243569 GTGGGAAATGCGGGGGTGGGTGG + Intronic
1006984228 6:38166794-38166816 TTGAGGATGGCGACGGTGGGGGG - Intergenic
1007041506 6:38726621-38726643 GTGAGCAAAGCCATGGTGGAGGG + Intronic
1007178570 6:39912695-39912717 GTGGGCTCGGCTAGGGTGGGGGG - Intronic
1007182245 6:39937773-39937795 GTGGGCAAGGTTAAGGTGGGCGG - Intergenic
1007929285 6:45676051-45676073 GTGAGCATGGCAGGGGTGGCTGG + Intergenic
1008320349 6:50104422-50104444 GTGGGCAGGGTGGGGGTGGGAGG + Intergenic
1008625970 6:53316691-53316713 GTGGGCAAGGTGAGGGAGAGGGG + Intronic
1009705109 6:67239429-67239451 GTGAGGGAGGCGAGGGTGCCTGG - Intergenic
1012333087 6:98018067-98018089 GGTAGCAAGGGGAGGGAGGGAGG + Intergenic
1013226189 6:108120752-108120774 AGGAGCAAGGCGAGGGAGGTGGG - Intronic
1013330248 6:109094255-109094277 GTGTACAAGGAGAGGGTGAGAGG - Exonic
1014290378 6:119551329-119551351 GTGAGCAAGGGGAGGATGGAAGG - Intergenic
1015725529 6:136295738-136295760 TTTAGGAAGGTGAGGGTGGGAGG - Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017643378 6:156515871-156515893 GTGAGTGAGGCAAAGGTGGGTGG - Intergenic
1017813906 6:158003132-158003154 GTGGGCATGGCGTTGGTGGGAGG + Intronic
1018803568 6:167241498-167241520 GTGTGCGAGGCCAGGGAGGGAGG - Intergenic
1018806642 6:167267005-167267027 GTGTGCGAGGCCAGGGAGGGAGG + Intergenic
1019027676 6:168983922-168983944 GTGAGCACGGCCAGGCTGGCTGG - Intergenic
1019102526 6:169642690-169642712 GTTAGCAAGCAGAGGGTGTGAGG + Intronic
1019467222 7:1196366-1196388 GTGATGAAGGGGCGGGTGGGGGG + Intergenic
1019467313 7:1196617-1196639 GTGATGAAGGGGGGGGTGGGGGG + Intergenic
1019467351 7:1196726-1196748 GTGATGAAGGGGGGGGTGGGGGG + Intergenic
1019701325 7:2476171-2476193 GTGACCAGGGCTGGGGTGGGAGG + Intronic
1019781399 7:2942338-2942360 GTAAGGAAGGGGAGGGAGGGAGG - Intronic
1022171612 7:27837315-27837337 ATGAGCAGGGCAAGGGTGGTGGG + Intronic
1022447124 7:30479744-30479766 GTGGGCAAGGCGGGGGCCGGGGG - Intergenic
1022973708 7:35538623-35538645 GGGAGGAAGGAGAGGTTGGGGGG - Intergenic
1024383137 7:48722561-48722583 TGGAGCAAGGTGGGGGTGGGGGG + Intergenic
1025979449 7:66394124-66394146 GGGAGGGAGGCGGGGGTGGGGGG - Intronic
1026402407 7:70028067-70028089 GCAAGCAAGATGAGGGTGGGGGG - Intronic
1026980899 7:74526095-74526117 GTGAGCCAGGCGGAGGTTGGGGG + Intronic
1029707080 7:102281815-102281837 GGGAGCAAGGAGGGGGTGAGTGG - Intronic
1031847119 7:126819226-126819248 GTGAGAAAGGGGAGAGTGAGGGG - Intronic
1033453255 7:141480403-141480425 GGGAGCAAGATGGGGGTGGGTGG + Intergenic
1033597054 7:142865870-142865892 AGGAGCCAGGGGAGGGTGGGTGG - Intronic
1033943280 7:146681601-146681623 GTGGGAAAGGGGAGAGTGGGAGG + Intronic
1035303538 7:157915438-157915460 GCGGGGAAGGCGGGGGTGGGGGG - Intronic
1035582228 8:747545-747567 GGGCGCAGGGCGGGGGTGGGGGG + Intergenic
1036143032 8:6225704-6225726 GTGGGGAAGGAGAGGGAGGGAGG - Intergenic
1036208940 8:6826637-6826659 GTGAGGAATGTGAGGATGGGTGG + Intronic
1036757002 8:11477385-11477407 GAGAGGAAGGAGGGGGTGGGTGG - Intergenic
1038022861 8:23564495-23564517 GGGAGGAAGGGAAGGGTGGGAGG + Intronic
1038311603 8:26449650-26449672 GTGAGCAGGAGGAGGGAGGGCGG + Intronic
1038938190 8:32275624-32275646 GTGAGCAAGGAGAGAGTAGAGGG + Intronic
1039385159 8:37129156-37129178 GTGAGGCAGGCAGGGGTGGGTGG - Intergenic
1039970165 8:42315432-42315454 GTGAGCAAGGCACGTTTGGGAGG + Intronic
1042209620 8:66366742-66366764 GTAAGGAAGGGGAGGGTGGCAGG - Intergenic
1043508478 8:80926119-80926141 GTGAGGGAGGAGAGAGTGGGAGG - Intergenic
1044806706 8:96015980-96016002 GTGAACAAGGAAAGAGTGGGTGG - Intergenic
1048191215 8:132291108-132291130 GTAAGCCAGACTAGGGTGGGAGG + Intronic
1048346793 8:133581853-133581875 GTGTGCAAGCCGAGTGTGTGTGG + Intergenic
1049262330 8:141646384-141646406 GGGAGGAAGGCAAGGGTGGCTGG - Intergenic
1049460552 8:142725711-142725733 GTGAGCAATGCTAGGGTGTTGGG + Intergenic
1049659914 8:143815365-143815387 TTGAGCATGGTGCGGGTGGGCGG + Exonic
1049698298 8:143994344-143994366 GTGAGGCAGGGGAGGTTGGGAGG - Intronic
1050230805 9:3524972-3524994 GTGTGCAAGGGGTGTGTGGGGGG + Intronic
1050718834 9:8561589-8561611 CTGAGCAAGGTGGGGGTGAGGGG + Intronic
1051356192 9:16241666-16241688 GACAGCAGGGCGGGGGTGGGTGG - Intronic
1051529524 9:18084704-18084726 GAAAGCAATGGGAGGGTGGGAGG - Intergenic
1052883164 9:33618109-33618131 GGGAGCACGGGGAGGGAGGGAGG + Intergenic
1053174989 9:35916134-35916156 AAGAGCAGGGCGAGGGTTGGAGG - Intergenic
1054824000 9:69552853-69552875 ATGAGCAAGGTGAGGGTAGAAGG - Intronic
1055782527 9:79834737-79834759 GTGAGAGAGGGGAGGGAGGGAGG + Intergenic
1057007429 9:91573031-91573053 GTGAGCAAGGCATGGGGGGTGGG + Intronic
1057164357 9:92914388-92914410 GACAGCAAGGGGAGGCTGGGTGG + Intergenic
1057198179 9:93126656-93126678 GTCAGCAAGGCGGGTGGGGGAGG + Intronic
1057864677 9:98669964-98669986 GCGACCAGGGCGGGGGTGGGAGG + Intronic
1058346530 9:103970190-103970212 GTGAGAGAGGGGAAGGTGGGGGG - Intergenic
1058944215 9:109841649-109841671 GGGAGAGAGGGGAGGGTGGGGGG + Intronic
1058944258 9:109841765-109841787 GAGAGAAAGGAGAGGGTGGGGGG + Intronic
1059331100 9:113536378-113536400 GTGAGCCAGGGGAGGTGGGGAGG + Intronic
1059399827 9:114061951-114061973 GGGAGCAAAGGCAGGGTGGGTGG - Intronic
1059440891 9:114306226-114306248 ATGAGGTAGGCGAGGGTGCGTGG - Intronic
1060477832 9:123999300-123999322 CTGAGCAAGGCGAGAAAGGGGGG + Intergenic
1061807263 9:133143409-133143431 GTGAGCGAGGAGGTGGTGGGAGG + Intronic
1061930277 9:133828822-133828844 GTGTGGAAGGCGAGGCTGGAGGG - Intronic
1061999000 9:134206662-134206684 GAGAGGAAGGGGAGGGTGGGAGG + Intergenic
1062215299 9:135385890-135385912 GTGGGCACGGGGAGGGTGGAGGG - Intergenic
1062403208 9:136381497-136381519 GGGAGCCAGGCCAGGGTGGGAGG + Intronic
1062501452 9:136853702-136853724 GTGCCCAAGGGGAGGGCGGGTGG + Intronic
1062633958 9:137480289-137480311 GTGAGCACGGGGAGGGCCGGTGG - Intronic
1185485869 X:481597-481619 GGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485886 X:481652-481674 GGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485926 X:481786-481808 GGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485932 X:481803-481825 GGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485977 X:481962-481984 GGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1186020597 X:5251145-5251167 GGGAGGAAGGGGAGGGAGGGAGG + Intergenic
1186445170 X:9621010-9621032 GTGAGCACGGAGTGGGAGGGAGG + Intronic
1187175068 X:16888809-16888831 GTCAGCAAGGTGGGTGTGGGTGG + Intergenic
1187559541 X:20388952-20388974 TTCAGCATGGCGTGGGTGGGGGG - Intergenic
1187696791 X:21930431-21930453 GTGAGGAGATCGAGGGTGGGAGG - Intergenic
1187953859 X:24496697-24496719 GTGACCAAGGGGATGGTGGTGGG - Intronic
1188592245 X:31852038-31852060 GTGAGCAAGGGGAGAGTAGTAGG + Intronic
1188699183 X:33237167-33237189 GGGAGGAAGGGGAGGGAGGGAGG - Intronic
1190915266 X:54807660-54807682 CCGAGGAAGGCGAGGGGGGGTGG + Exonic
1191858043 X:65643385-65643407 CTGGGCAAGGCAAGAGTGGGAGG + Intronic
1192232658 X:69276764-69276786 GTCAGCCAGGCCAGGATGGGTGG + Intergenic
1192313563 X:70035302-70035324 GAGAGGAAAGAGAGGGTGGGGGG - Intronic
1193679631 X:84502297-84502319 GTGAGAAGGGCGAAGGAGGGAGG - Intronic
1194771714 X:97915103-97915125 GAGAGCAAGCCGAAGGAGGGTGG + Intergenic
1195658786 X:107358661-107358683 GTGAAGAAGGAGAGGGAGGGAGG + Intergenic
1196025664 X:111039184-111039206 GTGAGCAAGGGAAGGGTGGCAGG - Intronic
1197744849 X:129925196-129925218 GTGAGCAGAGCCAGGGTGGTGGG + Intronic
1198054973 X:132984927-132984949 GTGAGCAAGGAGAGGGAGCAAGG - Intergenic
1198451098 X:136767603-136767625 GCGAGCCGGGCGAGGGTGCGCGG + Intronic
1200059522 X:153478046-153478068 GTGGGCAAGGCTTGGGTGGAGGG - Intronic
1200099674 X:153684415-153684437 GTGGGAAGGGCGCGGGTGGGGGG + Intronic
1200204158 X:154303839-154303861 ATGAGCAAGAAGATGGTGGGGGG - Intronic
1200259837 X:154608251-154608273 CTGAGGAAGGCGAGGGGGGTTGG - Intergenic
1200266791 X:154650489-154650511 CTGAGGAAGGCGAGGGGGGTTGG - Intergenic