ID: 1138423487

View in Genome Browser
Species Human (GRCh38)
Location 16:56915014-56915036
Sequence GCCTTCCGTGAGCCAGGTAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138423487_1138423494 30 Left 1138423487 16:56915014-56915036 CCTATACCTGGCTCACGGAAGGC 0: 1
1: 0
2: 1
3: 15
4: 148
Right 1138423494 16:56915067-56915089 GTGTTTGAGCCCCCAAAGCTAGG 0: 1
1: 0
2: 0
3: 3
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138423487 Original CRISPR GCCTTCCGTGAGCCAGGTAT AGG (reversed) Exonic