ID: 1138423490

View in Genome Browser
Species Human (GRCh38)
Location 16:56915036-56915058
Sequence TTCAACGTGTAGTGACCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138423490_1138423495 9 Left 1138423490 16:56915036-56915058 CCTTCAGGTCACTACACGTTGAA 0: 1
1: 0
2: 0
3: 1
4: 63
Right 1138423495 16:56915068-56915090 TGTTTGAGCCCCCAAAGCTAGGG 0: 1
1: 0
2: 2
3: 26
4: 262
1138423490_1138423494 8 Left 1138423490 16:56915036-56915058 CCTTCAGGTCACTACACGTTGAA 0: 1
1: 0
2: 0
3: 1
4: 63
Right 1138423494 16:56915067-56915089 GTGTTTGAGCCCCCAAAGCTAGG 0: 1
1: 0
2: 0
3: 3
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138423490 Original CRISPR TTCAACGTGTAGTGACCTGA AGG (reversed) Exonic