ID: 1138423494

View in Genome Browser
Species Human (GRCh38)
Location 16:56915067-56915089
Sequence GTGTTTGAGCCCCCAAAGCT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138423487_1138423494 30 Left 1138423487 16:56915014-56915036 CCTATACCTGGCTCACGGAAGGC 0: 1
1: 0
2: 1
3: 15
4: 148
Right 1138423494 16:56915067-56915089 GTGTTTGAGCCCCCAAAGCTAGG 0: 1
1: 0
2: 0
3: 3
4: 117
1138423488_1138423494 24 Left 1138423488 16:56915020-56915042 CCTGGCTCACGGAAGGCCTTCAG 0: 1
1: 0
2: 3
3: 35
4: 243
Right 1138423494 16:56915067-56915089 GTGTTTGAGCCCCCAAAGCTAGG 0: 1
1: 0
2: 0
3: 3
4: 117
1138423490_1138423494 8 Left 1138423490 16:56915036-56915058 CCTTCAGGTCACTACACGTTGAA 0: 1
1: 0
2: 0
3: 1
4: 63
Right 1138423494 16:56915067-56915089 GTGTTTGAGCCCCCAAAGCTAGG 0: 1
1: 0
2: 0
3: 3
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138423494 Original CRISPR GTGTTTGAGCCCCCAAAGCT AGG Exonic
900534667 1:3170914-3170936 GTGTTTCAGCTCCCAGAGCTCGG + Intronic
900654120 1:3746835-3746857 GTGTCGGAGCCCCCACACCTGGG + Intergenic
901239916 1:7686879-7686901 GTGGTTGAAGCCCCAAATCTAGG - Intronic
901650759 1:10741880-10741902 GTGTTTTTTCCCCCAAAGCCAGG + Intronic
905224144 1:36468134-36468156 GTGCCTGAGCCCCCTGAGCTGGG - Exonic
907723590 1:56997819-56997841 ATATTTGAGCCCTCATAGCTGGG - Exonic
909057942 1:70845049-70845071 GGGTGCGAGCCCCCAAACCTTGG + Intergenic
909430677 1:75583989-75584011 GAATTTGAGACCTCAAAGCTTGG - Intronic
910484760 1:87700946-87700968 GTGTTGGAGCCCCCAACCCCTGG - Intergenic
915932141 1:160067438-160067460 GTGTTTTAGCACCCAATGGTGGG - Intronic
922342394 1:224668573-224668595 GTGCATGCTCCCCCAAAGCTGGG + Intronic
1065518922 10:26552891-26552913 GAGTTAGAGCCCCCAAACCAAGG - Intronic
1066631722 10:37465030-37465052 CTGTGTGAGACCCCAAAACTAGG + Intergenic
1067057266 10:43059481-43059503 GGGTGTGAGCCCCTGAAGCTGGG + Intergenic
1067220906 10:44343655-44343677 GCTTTTGAGCACACAAAGCTGGG + Intergenic
1071794354 10:88989641-88989663 CTGTTTGGGCCCTCAAATCTAGG - Intronic
1080746043 11:35109552-35109574 ATGTGTAAGCCACCAAAGCTTGG - Intergenic
1083963165 11:66025768-66025790 GTGTTGGAGCCCGCTAAGGTGGG + Exonic
1084547469 11:69821609-69821631 GTGTGTGATGCCCCAAAGGTAGG + Intergenic
1085200144 11:74696935-74696957 AGGTCTGAGCCCCCAAACCTGGG - Intronic
1085459344 11:76683946-76683968 GTGTCTGAGCACCAAAATCTGGG - Intergenic
1089101237 11:115964508-115964530 GTTTGTGAAACCCCAAAGCTTGG - Intergenic
1091835708 12:3584073-3584095 GTGGTTAAGCCCCCAAGCCTGGG - Intronic
1094749029 12:33383628-33383650 GTGTTTGAGCCCACAGGCCTAGG + Intronic
1098706256 12:73693760-73693782 GTGTTTGGTCCCACAAATCTTGG - Intergenic
1102445672 12:113000455-113000477 GTGCATGAGCCCCCAATGTTTGG - Intronic
1102466255 12:113132484-113132506 GAGTGTGAGCCCACAAACCTGGG - Intronic
1108716260 13:53081051-53081073 GTCTTCCAGCCTCCAAAGCTGGG + Intergenic
1108968520 13:56342238-56342260 ATGTGTAAGCCACCAAAGCTTGG + Intergenic
1116656267 14:47657245-47657267 GTGTTTTATACCACAAAGCTGGG + Intronic
1116765132 14:49061149-49061171 GTCTTTGTGTCCCCAAACCTTGG + Intergenic
1118050855 14:62026099-62026121 GTATCTGAGCCCTCAAAGTTTGG + Intronic
1122875271 14:104660972-104660994 GTGTTTGCGCCTACAAAGCCGGG - Intergenic
1124617878 15:31255761-31255783 GTGTTTTATGCCACAAAGCTCGG + Intergenic
1125526959 15:40382766-40382788 GTGTTGGAGCCCCCAGGTCTGGG - Exonic
1127914864 15:63447058-63447080 GTGCTTCTGCCCCCAAAGATGGG - Intergenic
1129119829 15:73389559-73389581 TTTTTTGGGCTCCCAAAGCTGGG - Intergenic
1130366802 15:83248173-83248195 ATGTTTAAGGCCCCACAGCTAGG + Intergenic
1131177699 15:90220276-90220298 GTGTGTCTGACCCCAAAGCTGGG - Intronic
1132196874 15:99920042-99920064 GTGTAATAGCCCCCAGAGCTGGG - Intergenic
1133398246 16:5465419-5465441 GTGTTTGCAACCCCAAATCTAGG - Intergenic
1133520582 16:6552331-6552353 GTCTTTCAGTCCCCAAAACTGGG - Intronic
1138423494 16:56915067-56915089 GTGTTTGAGCCCCCAAAGCTAGG + Exonic
1138885722 16:61075715-61075737 GTGTTTCAGGCACAAAAGCTTGG - Intergenic
1140741439 16:77945150-77945172 GGGTTTGTGCCCCCACAGATTGG - Intronic
1142560372 17:805934-805956 GTGTTTGACCCCCAGCAGCTGGG - Intronic
1143218752 17:5244150-5244172 GCATTTGACCCCCAAAAGCTCGG + Intergenic
1144512130 17:15886429-15886451 GTGGTTCAGCCCTCAAGGCTGGG - Intergenic
1148810025 17:50284367-50284389 GTGTTTTAGCCTACACAGCTGGG - Intergenic
1149072423 17:52558423-52558445 ATATTTGAGCCCCCAAATCCAGG + Intergenic
1149985166 17:61341739-61341761 GAGATTCAGCCCCCAAAGATGGG + Intronic
1152250677 17:79211103-79211125 GTGTTGGAACCTCCAAAACTCGG - Intronic
1152292776 17:79449731-79449753 GTATGTGCGCCCCCAGAGCTGGG - Intronic
1153296370 18:3550543-3550565 GTGATTGAGGCCCCAAGGGTGGG + Intronic
1153742416 18:8142527-8142549 GTGTCTGAGCCCCCAAGACCAGG - Intronic
1155325531 18:24660679-24660701 GTGTGTGAGGGCCCAATGCTGGG + Intergenic
1158948248 18:62466748-62466770 GTGTTTAAGCCACCAAGTCTTGG - Intergenic
1165421293 19:35723234-35723256 GTGTTAGGGCCCCCAAACTTGGG - Exonic
1168240054 19:55084376-55084398 GAGTCTGAGCCCCCACTGCTTGG - Intronic
926810035 2:16747765-16747787 GTGTGTGAGCCATCAATGCTGGG - Intergenic
930541002 2:52706539-52706561 GGATTTGAGCTCCCAAAACTGGG - Intergenic
932844245 2:75119116-75119138 GGCTTTCAGCCCTCAAAGCTTGG + Intronic
937780769 2:125834640-125834662 TTGTTTTGGCCCCCAAAGGTGGG + Intergenic
942401737 2:175610110-175610132 GTGCTTGAGCCCAGAAACCTCGG - Intergenic
945290377 2:208120878-208120900 TTGTTTAAGCCCCTATAGCTGGG - Intergenic
1174180062 20:48668949-48668971 GTCTTGGAGCTCCTAAAGCTAGG + Intronic
1174193785 20:48758464-48758486 GTCTTTCACCCCCCCAAGCTCGG - Intronic
1175868085 20:62192132-62192154 GTGACTGAGCCCCTAACGCTGGG - Intronic
1175964405 20:62653262-62653284 AGGATTGAGCCCCCAAAGCTGGG - Intronic
1179823349 21:43950056-43950078 GTGGTGGAGCCCCCAGAGCCTGG + Intronic
1179922467 21:44514542-44514564 GTGTTGCAGCTTCCAAAGCTTGG - Intronic
1180981711 22:19881230-19881252 GTGCTGGAACCCCCAAGGCTGGG - Intronic
1182458741 22:30469669-30469691 CTGTTTGGGCCCCCAAACCCAGG - Intronic
1185281273 22:49971132-49971154 ACGTGTGTGCCCCCAAAGCTAGG - Intergenic
950472271 3:13193633-13193655 GTGTTCTAGACCCCTAAGCTTGG - Intergenic
950589306 3:13924801-13924823 ATGTGTAAGCCACCAAAGCTTGG - Intergenic
950733105 3:14979896-14979918 GTGATTCAACCCCCAAAGATAGG - Intronic
953042168 3:39265092-39265114 GTGTCTGAGCCCTCAAAGTGAGG - Exonic
953550613 3:43899553-43899575 GTGTGTTAGCCCCCAAAGTGAGG + Intergenic
954627411 3:52030126-52030148 GTGTGTGAGGCCCTAAAGATGGG - Intergenic
955024263 3:55152257-55152279 TTGTTTGAACCCCCAAATTTTGG + Intergenic
955178160 3:56638084-56638106 AGGCTTGAGCCCCCAAACCTGGG - Intronic
959229694 3:103632292-103632314 ATGTGTTAGCCACCAAAGCTTGG - Intergenic
962532085 3:136291883-136291905 GTGTGGGAGCCCCCAATGATTGG + Intronic
966827983 3:183981238-183981260 GTGTAAGTGCCCACAAAGCTAGG - Intronic
974071430 4:57127659-57127681 ACGTGTGAGCCACCAAAGCTTGG - Intergenic
980592195 4:134904802-134904824 GTGTTTGAGCCCTCAAAGGATGG + Intergenic
981750512 4:148089297-148089319 ATGTTTGGGCCCAGAAAGCTGGG + Intronic
982904291 4:161048657-161048679 ATGTGTAAGCCACCAAAGCTTGG + Intergenic
985785270 5:1889991-1890013 GTCTTTGTGCCCCCAGGGCTTGG + Intergenic
989696910 5:44212431-44212453 ATGTGTAAGCCACCAAAGCTTGG - Intergenic
992098480 5:73382799-73382821 GAACTTGAGCCCCCAAAGCCAGG - Intergenic
998604435 5:143619061-143619083 GTGTCTGAGCCACAAAAGCCAGG - Intergenic
1000559348 5:162766809-162766831 ATATTTGTGCCCCCAATGCTGGG + Intergenic
1002694231 5:181073540-181073562 GTGTGGGAGCCCTCAAGGCTGGG - Intergenic
1006779557 6:36623112-36623134 GTGTTTGAGCTCACAGAACTGGG - Intergenic
1008763191 6:54879044-54879066 GTGTCAGAGGCCCCAAAGTTGGG + Intronic
1010319782 6:74492267-74492289 GGGTTTGAGCCCCAAACTCTTGG - Intergenic
1013013204 6:106138198-106138220 ATGTCTGAGCCCCCGAAGATAGG + Intergenic
1019138963 6:169931216-169931238 TTGCTTTAGCCCCAAAAGCTGGG - Intergenic
1019459555 7:1149753-1149775 GTGTTTGTGCTTCCAAACCTAGG + Intergenic
1026192831 7:68145154-68145176 GTGTCTCAGCCTCCAGAGCTGGG + Intergenic
1027502580 7:78971705-78971727 GTATTTGATCCCCCAAAATTTGG - Intronic
1031752830 7:125598818-125598840 ATGTGTGAGCCCCCAGAGGTGGG + Intergenic
1042382554 8:68134678-68134700 GTATTTGAGCTCTCCAAGCTTGG - Intronic
1043421584 8:80103956-80103978 TTGCTTGAACCCCAAAAGCTAGG + Intronic
1046373724 8:113347871-113347893 GTATCTGAGAGCCCAAAGCTGGG + Intronic
1048226502 8:132592296-132592318 TTCCCTGAGCCCCCAAAGCTAGG - Intronic
1052666056 9:31496800-31496822 ATGTGTAAGCCACCAAAGCTTGG + Intergenic
1056665312 9:88576886-88576908 GTGTTGGAGCCCCTTAAGCATGG - Intronic
1059448682 9:114356452-114356474 GGGATGGAGCCTCCAAAGCTGGG - Intronic
1059502610 9:114767884-114767906 TTCTTTGAACCCCCAAAGCAAGG + Intergenic
1060108671 9:120891126-120891148 GAGATTGAGCCCCCAGGGCTGGG + Intronic
1188223473 X:27568928-27568950 GTGTTTGAGTTCCAAAGGCTTGG - Intergenic
1189559264 X:42175765-42175787 CTGCTTGAGCCCTAAAAGCTAGG + Intergenic
1192847558 X:74922117-74922139 GTGTTGGAGCACACAAAGATGGG - Intronic
1194083470 X:89498159-89498181 TGTTGTGAGCCCCCAAAGCTGGG + Intergenic
1194196196 X:90895572-90895594 GAGTTTGAGGCCCCAAAATTTGG - Intergenic
1200436120 Y:3154040-3154062 TGTTGTGAGCCCCCAAAGCTGGG + Intergenic
1200542040 Y:4469764-4469786 GAGTTTGAGGCCCCAAAATTTGG - Intergenic
1202029427 Y:20556271-20556293 CAGTTTGAGCCACTAAAGCTGGG + Intergenic