ID: 1138423553

View in Genome Browser
Species Human (GRCh38)
Location 16:56915456-56915478
Sequence CGCCTCAGGGCTTGCTACGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138423542_1138423553 25 Left 1138423542 16:56915408-56915430 CCAGAAGGCTTGGGGCTCCCAGG 0: 1
1: 0
2: 1
3: 26
4: 271
Right 1138423553 16:56915456-56915478 CGCCTCAGGGCTTGCTACGAGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1138423548_1138423553 -10 Left 1138423548 16:56915443-56915465 CCCACTGTCTGACCGCCTCAGGG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1138423553 16:56915456-56915478 CGCCTCAGGGCTTGCTACGAGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1138423541_1138423553 26 Left 1138423541 16:56915407-56915429 CCCAGAAGGCTTGGGGCTCCCAG 0: 1
1: 1
2: 2
3: 29
4: 288
Right 1138423553 16:56915456-56915478 CGCCTCAGGGCTTGCTACGAGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1138423546_1138423553 -9 Left 1138423546 16:56915442-56915464 CCCCACTGTCTGACCGCCTCAGG 0: 1
1: 0
2: 0
3: 12
4: 198
Right 1138423553 16:56915456-56915478 CGCCTCAGGGCTTGCTACGAGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1138423544_1138423553 8 Left 1138423544 16:56915425-56915447 CCCAGGCTGCTCTGAAGCCCCAC 0: 1
1: 0
2: 0
3: 28
4: 494
Right 1138423553 16:56915456-56915478 CGCCTCAGGGCTTGCTACGAGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1138423545_1138423553 7 Left 1138423545 16:56915426-56915448 CCAGGCTGCTCTGAAGCCCCACT 0: 1
1: 0
2: 1
3: 31
4: 279
Right 1138423553 16:56915456-56915478 CGCCTCAGGGCTTGCTACGAGGG 0: 1
1: 0
2: 0
3: 2
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138423553 Original CRISPR CGCCTCAGGGCTTGCTACGA GGG Exonic
903853061 1:26319832-26319854 CCCCTGAGGGCTGGGTACGATGG + Intronic
918819685 1:189236748-189236770 CGTCTCAGGGCTTGCAGCCATGG + Intergenic
923045618 1:230353744-230353766 AGCCTCAGGGCTTTCTTGGAGGG - Intronic
924647779 1:245895078-245895100 GGCTTCTGGGCATGCTACGATGG - Intronic
1069663596 10:70139920-70139942 AGCCTCAGAGCTTGCTCCGCGGG + Exonic
1076710514 10:132331514-132331536 TGCCTCAGGACTTGCTGCCAGGG - Intronic
1107966800 13:45604483-45604505 CACATCAGGGCTTGCTGTGAGGG - Intronic
1120070561 14:80097859-80097881 CACCTCAGTGCTTGCTACAACGG - Intergenic
1121634156 14:95442516-95442538 CTCCTCAGGGCTTGTTACAACGG + Intronic
1137368184 16:47878928-47878950 TGCCTCAGGGTTTGCTTCTAGGG + Intergenic
1138423553 16:56915456-56915478 CGCCTCAGGGCTTGCTACGAGGG + Exonic
1141017841 16:80467062-80467084 CTCCTCTGGGGTTGCTATGAGGG - Intergenic
1141892324 16:86934702-86934724 GGCCACAGGGCTTGGTACGTGGG + Intergenic
1142338768 16:89507671-89507693 CGCCTCCCCGCTTCCTACGATGG + Intronic
1161373095 19:3924574-3924596 CGCCTCAGGACATGCTAGGGAGG - Exonic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
936954820 2:118013587-118013609 CGCCGCAGGGCTAGCCCCGAGGG - Intronic
938026199 2:127950940-127950962 TGCCTCAGGACTTGCTCCAAAGG + Intronic
1184390781 22:44201951-44201973 GGCCACAGGGCCTGCTTCGATGG - Intronic
950673539 3:14541004-14541026 CGCCTCTGGGCTTGATAGGCAGG + Intronic
960934862 3:122892567-122892589 CGTCTCCGGGCTTGCTGCGGAGG - Intergenic
968830256 4:2929786-2929808 AGCCGCAGGGCCTGCTACGCGGG + Exonic
971958893 4:33458685-33458707 CTTCTCTGGGTTTGCTACGATGG - Intergenic
982370226 4:154626322-154626344 CGCAGCAGGCCTTGCTCCGATGG + Intergenic
985783803 5:1883902-1883924 CCCCGCAGGGCTGGCTGCGAGGG + Intronic
998535541 5:142926942-142926964 CACCTCAGGGCATGCTGGGAAGG - Intronic
1008053259 6:46921649-46921671 CCCCTGAGGTCTTGCTACAAAGG + Intronic
1010106795 6:72179842-72179864 GGCCCCAAGGCTTGCTGCGAGGG - Exonic
1011700186 6:89948578-89948600 CGCATCATGGCTTCCTACCAAGG - Intronic
1013464897 6:110409381-110409403 AGCCTCAGGGGCTGCTATGAGGG + Intronic
1019496854 7:1344836-1344858 CCACTCAGGGCTTTCTAAGAGGG - Intergenic
1032249837 7:130246475-130246497 CGCCACAGTGCTTTCTACAATGG - Intergenic
1040107623 8:43549450-43549472 TGCCGCAGGGCCTGCCACGAAGG + Intergenic
1048390954 8:133963969-133963991 CACCTCAGGGCTTGGTTCCATGG + Intergenic
1049549476 8:143250422-143250444 CGGCTCAGGGCTTCTTCCGAGGG - Exonic
1059642637 9:116232612-116232634 CGCCTCAGGTCTTTTTACGTTGG - Intronic
1060474160 9:123974537-123974559 CCCCTCTGGGCTTGCTCTGATGG - Intergenic
1190243514 X:48676200-48676222 CCCCGCTGGGTTTGCTACGAAGG + Intergenic
1190308540 X:49100969-49100991 CCCCGCTGGGTTTGCTACGAAGG + Intronic