ID: 1138423554

View in Genome Browser
Species Human (GRCh38)
Location 16:56915458-56915480
Sequence GTCCCTCGTAGCAAGCCCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 56}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138423554_1138423559 1 Left 1138423554 16:56915458-56915480 CCTCAGGGCTTGCTACGAGGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1138423559 16:56915482-56915504 GGGGCACGGCCAAGCTGACTAGG 0: 1
1: 0
2: 0
3: 11
4: 88
1138423554_1138423563 30 Left 1138423554 16:56915458-56915480 CCTCAGGGCTTGCTACGAGGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1138423563 16:56915511-56915533 TCTCGTGCTCCTGAGGGACCTGG 0: 1
1: 0
2: 0
3: 13
4: 269
1138423554_1138423561 23 Left 1138423554 16:56915458-56915480 CCTCAGGGCTTGCTACGAGGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1138423561 16:56915504-56915526 GAACAGCTCTCGTGCTCCTGAGG 0: 1
1: 0
2: 1
3: 4
4: 76
1138423554_1138423562 24 Left 1138423554 16:56915458-56915480 CCTCAGGGCTTGCTACGAGGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1138423562 16:56915505-56915527 AACAGCTCTCGTGCTCCTGAGGG 0: 1
1: 0
2: 0
3: 10
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138423554 Original CRISPR GTCCCTCGTAGCAAGCCCTG AGG (reversed) Exonic
911102523 1:94105723-94105745 CTCCCTCGAAGCAAGCTCTGTGG - Intronic
914326575 1:146623225-146623247 CTCCCTTGGGGCAAGCCCTGGGG + Intergenic
918464288 1:184806112-184806134 GTCCCACTTAGCCAGGCCTGTGG - Intronic
921161120 1:212472712-212472734 GTCCCTCAAAGCCAGCCTTGGGG + Intergenic
923045617 1:230353742-230353764 GACCCTCCAAGAAAGCCCTGAGG + Intronic
1068198771 10:53754773-53754795 GTTCCTCGAAGCAAGTACTGTGG + Intergenic
1069663598 10:70139922-70139944 GCCCCGCGGAGCAAGCTCTGAGG - Exonic
1076675305 10:132144452-132144474 GTCCCTCGAACAAAGCCCTCTGG + Intronic
1088626554 11:111734084-111734106 GCCCCTCGCAGTAAACCCTGGGG - Intronic
1102809443 12:115811470-115811492 GTCACTTGAAGCAAGACCTGTGG - Intergenic
1108518120 13:51221957-51221979 GAACCTCGTGGCAAGCCCTGGGG + Intergenic
1112551345 13:100423889-100423911 GGCCCTCGTAGCAAAGCCTCAGG - Intronic
1113788857 13:113016770-113016792 GTGCCTCTGAGCAAGGCCTGAGG - Intronic
1113936593 13:113998164-113998186 GTCCCTCGAAGGAAGCAGTGTGG - Intronic
1114670995 14:24411011-24411033 CTCCCTCAGAGCCAGCCCTGGGG - Intronic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1124347114 15:28930344-28930366 GTCCCTCTGAGCCTGCCCTGGGG + Intronic
1126932542 15:53670929-53670951 GTCTCAGGTAGGAAGCCCTGGGG - Intronic
1127807382 15:62533821-62533843 GCCCCATGCAGCAAGCCCTGTGG + Intronic
1132317371 15:100899804-100899826 GTCCCTTGGAGCAGCCCCTGTGG + Intronic
1133555332 16:6901348-6901370 GTCCCACCTAGCAAGGCCAGGGG + Intronic
1135642514 16:24133393-24133415 GGCCCTCTTAGGAATCCCTGCGG - Intronic
1137368185 16:47878930-47878952 GTCCCTAGAAGCAAACCCTGAGG - Intergenic
1138423554 16:56915458-56915480 GTCCCTCGTAGCAAGCCCTGAGG - Exonic
1140006989 16:71087720-71087742 CTCCCTTGGGGCAAGCCCTGGGG - Intronic
1140886830 16:79251701-79251723 GTCCCTCAGTGCAATCCCTGGGG + Intergenic
1141892326 16:86934704-86934726 ACCCCACGTACCAAGCCCTGTGG - Intergenic
1151815838 17:76471013-76471035 CTCCCTGGGAGCAGGCCCTGGGG + Exonic
1163506164 19:17707630-17707652 GCCCCCCATAGCCAGCCCTGAGG + Intergenic
926684915 2:15691077-15691099 GACCCTGGAAGCAAGCTCTGAGG + Intronic
926897768 2:17713336-17713358 GTACCTCCTAGCAACTCCTGAGG + Intronic
931569718 2:63656049-63656071 GAACCTCTTTGCAAGCCCTGTGG + Intronic
935131748 2:100265749-100265771 GTCCCCAGTAGAAAGCCCTCAGG - Intergenic
936954819 2:118013585-118013607 GGCCCTCGGGGCTAGCCCTGCGG + Intronic
1173379819 20:42530196-42530218 GTTCACTGTAGCAAGCCCTGAGG + Intronic
1173569305 20:44066418-44066440 GAACCTCGTAGCAATCTCTGTGG - Intronic
1183358960 22:37373555-37373577 GTCGCCCTTAGCCAGCCCTGTGG + Exonic
1184390780 22:44201949-44201971 TTCCATCGAAGCAGGCCCTGTGG + Intronic
957071132 3:75568749-75568771 GTCCCTGTTAGCAGGCGCTGGGG + Intergenic
961542206 3:127607620-127607642 GTCCCTAGAAGCAAGGCCTGAGG - Intronic
967092529 3:186147408-186147430 GACCCTCATAGCAACCTCTGAGG - Exonic
968830257 4:2929788-2929810 TGCCCGCGTAGCAGGCCCTGCGG - Exonic
979292105 4:118989854-118989876 GTCCCTGAGAGTAAGCCCTGAGG + Intronic
985783805 5:1883904-1883926 CTCCCTCGCAGCCAGCCCTGCGG - Intronic
993880323 5:93353288-93353310 GGCCCTTGTACCAAGCTCTGAGG + Intergenic
1000965228 5:167648010-167648032 ATACATCGTAGCAAGTCCTGAGG - Intronic
1002542670 5:179916624-179916646 GTGCCTCGCAGCCAGGCCTGAGG + Intronic
1009642189 6:66352069-66352091 GACCCTAGTACCAAACCCTGTGG + Intergenic
1010106794 6:72179840-72179862 AGCCCTCGCAGCAAGCCTTGGGG + Exonic
1013464898 6:110409383-110409405 TTCCCTCATAGCAGCCCCTGAGG - Intronic
1016400879 6:143678322-143678344 GTCCCTCGGAGAAACCCCAGAGG + Intronic
1022038445 7:26556496-26556518 GTCCCTGATAGCAACCCCAGAGG + Intergenic
1024562077 7:50653221-50653243 CTCCCTCGGAGCATGCACTGGGG - Intronic
1034955784 7:155333766-155333788 ATGCCTCGAAGGAAGCCCTGTGG - Intergenic
1046004686 8:108464575-108464597 GTCCTCCGTACCAACCCCTGGGG - Intronic
1048097612 8:131312461-131312483 GGCACTTGTAGCAAGCTCTGGGG - Intergenic
1057519132 9:95747143-95747165 ATACCTGGTAGCAGGCCCTGGGG + Intergenic
1060237595 9:121876863-121876885 GTCTGTTGTAGCAAACCCTGCGG + Intronic
1062572168 9:137190732-137190754 GTCCCTCTCAGCAAGGACTGGGG + Intergenic
1189027171 X:37407866-37407888 GGCCCTGGTAGGAAGCCCTAAGG + Intronic
1189145732 X:38652868-38652890 CTCACTCGTAGGAAGCCCTTAGG + Intronic
1195011875 X:100740645-100740667 TTACCTCTTAGCAAGTCCTGTGG - Intergenic