ID: 1138425142

View in Genome Browser
Species Human (GRCh38)
Location 16:56926774-56926796
Sequence CTTTATACGCAGAATTTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138425142_1138425144 -6 Left 1138425142 16:56926774-56926796 CCATACAAATTCTGCGTATAAAG No data
Right 1138425144 16:56926791-56926813 ATAAAGTCACTGGCACTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138425142 Original CRISPR CTTTATACGCAGAATTTGTA TGG (reversed) Intergenic
No off target data available for this crispr