ID: 1138425537

View in Genome Browser
Species Human (GRCh38)
Location 16:56929742-56929764
Sequence GCAGTGACAGCAGCCAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138425537_1138425540 3 Left 1138425537 16:56929742-56929764 CCCATTTTGGCTGCTGTCACTGC No data
Right 1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG No data
1138425537_1138425543 16 Left 1138425537 16:56929742-56929764 CCCATTTTGGCTGCTGTCACTGC No data
Right 1138425543 16:56929781-56929803 CAGAGATGGGATGTTGCAATAGG No data
1138425537_1138425546 29 Left 1138425537 16:56929742-56929764 CCCATTTTGGCTGCTGTCACTGC No data
Right 1138425546 16:56929794-56929816 TTGCAATAGGCCAGGCATGGAGG No data
1138425537_1138425539 2 Left 1138425537 16:56929742-56929764 CCCATTTTGGCTGCTGTCACTGC No data
Right 1138425539 16:56929767-56929789 AAAACCCTGCTTCACAGAGATGG No data
1138425537_1138425545 26 Left 1138425537 16:56929742-56929764 CCCATTTTGGCTGCTGTCACTGC No data
Right 1138425545 16:56929791-56929813 ATGTTGCAATAGGCCAGGCATGG No data
1138425537_1138425544 21 Left 1138425537 16:56929742-56929764 CCCATTTTGGCTGCTGTCACTGC No data
Right 1138425544 16:56929786-56929808 ATGGGATGTTGCAATAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138425537 Original CRISPR GCAGTGACAGCAGCCAAAAT GGG (reversed) Intergenic
No off target data available for this crispr