ID: 1138425538

View in Genome Browser
Species Human (GRCh38)
Location 16:56929743-56929765
Sequence TGCAGTGACAGCAGCCAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138425538_1138425543 15 Left 1138425538 16:56929743-56929765 CCATTTTGGCTGCTGTCACTGCA No data
Right 1138425543 16:56929781-56929803 CAGAGATGGGATGTTGCAATAGG No data
1138425538_1138425539 1 Left 1138425538 16:56929743-56929765 CCATTTTGGCTGCTGTCACTGCA No data
Right 1138425539 16:56929767-56929789 AAAACCCTGCTTCACAGAGATGG No data
1138425538_1138425546 28 Left 1138425538 16:56929743-56929765 CCATTTTGGCTGCTGTCACTGCA No data
Right 1138425546 16:56929794-56929816 TTGCAATAGGCCAGGCATGGAGG No data
1138425538_1138425544 20 Left 1138425538 16:56929743-56929765 CCATTTTGGCTGCTGTCACTGCA No data
Right 1138425544 16:56929786-56929808 ATGGGATGTTGCAATAGGCCAGG No data
1138425538_1138425545 25 Left 1138425538 16:56929743-56929765 CCATTTTGGCTGCTGTCACTGCA No data
Right 1138425545 16:56929791-56929813 ATGTTGCAATAGGCCAGGCATGG No data
1138425538_1138425540 2 Left 1138425538 16:56929743-56929765 CCATTTTGGCTGCTGTCACTGCA No data
Right 1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138425538 Original CRISPR TGCAGTGACAGCAGCCAAAA TGG (reversed) Intergenic