ID: 1138425540

View in Genome Browser
Species Human (GRCh38)
Location 16:56929768-56929790
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138425537_1138425540 3 Left 1138425537 16:56929742-56929764 CCCATTTTGGCTGCTGTCACTGC No data
Right 1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG No data
1138425538_1138425540 2 Left 1138425538 16:56929743-56929765 CCATTTTGGCTGCTGTCACTGCA No data
Right 1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138425540 Original CRISPR AAACCCTGCTTCACAGAGAT GGG Intergenic