ID: 1138425541

View in Genome Browser
Species Human (GRCh38)
Location 16:56929771-56929793
Sequence CATCCCATCTCTGTGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138425541_1138425544 -8 Left 1138425541 16:56929771-56929793 CCCTGCTTCACAGAGATGGGATG No data
Right 1138425544 16:56929786-56929808 ATGGGATGTTGCAATAGGCCAGG No data
1138425541_1138425548 28 Left 1138425541 16:56929771-56929793 CCCTGCTTCACAGAGATGGGATG No data
Right 1138425548 16:56929822-56929844 ATCTGTACTGCTAGCACTTTTGG No data
1138425541_1138425545 -3 Left 1138425541 16:56929771-56929793 CCCTGCTTCACAGAGATGGGATG No data
Right 1138425545 16:56929791-56929813 ATGTTGCAATAGGCCAGGCATGG No data
1138425541_1138425546 0 Left 1138425541 16:56929771-56929793 CCCTGCTTCACAGAGATGGGATG No data
Right 1138425546 16:56929794-56929816 TTGCAATAGGCCAGGCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138425541 Original CRISPR CATCCCATCTCTGTGAAGCA GGG (reversed) Intergenic